Method for constructing an animal model of depression

Abstract

The present invention provides a method for constructing an animal model of depression. Using the CRISPR-Cas9 knockout method, gene editing is performed on fertilized eggs to knockout the gene encoding the SelS protein in animals, and then the fertilized eggs are cultured to obtain a mouse model of depression.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a method for constructing an animal model of depression. Background Art

[0002] Selenoprotein is an important metabolite of dietary selenium, characterized by containing one or more selenium-containing amino acids - selenocysteine (Sec) encoded by the stop codon UGA. Selenoprotein S (SelS) is a member of the selenoprotein family, first discovered by Walder et al. in the liver of type II diabetic model rats and named Tanis. Subsequent studies have shown that Tanis, AD-015, SelS, SELENOS, VIMP, and SEPS1 are the same protein. SELENOS has different biological functions in different tissues and organs: it plays an antioxidant protection and anti-ER stress role in the pancreas and blood vessels, while promoting the occurrence and development of insulin resistance in the liver, adipose tissue, and skeletal muscle. SelS is related to the occurrence and development of diabetes, large vascular diseases, cancer, and autoimmune inflammatory diseases, but current research has not mentioned the relationship between SelS and depression. Summary of the Invention

[0003] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide a method for constructing an animal model of depression, which is used to quickly construct an animal model of depression and provide a new way for the research of depression.

[0004] One aspect of the present invention provides a kit for constructing an animal model of depression, and the kit contains reagents for knocking out the SelS protein expression gene in animals.

[0005] Further, the reagents include reagents required for the CRISPR-Cas9 knockout method or reagents used in stem cell recombination technology. For example: RNaseAWAY, injection and dilution buffer, RNA enzyme inhibitor, M2 medium, M16 medium, Mineral oil.

[0006] Further, the reagents required for the CRISPR-Cas9 knockout method include two sgRNAs, and their nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively. In addition, the reagents also include Cas 9. The two sgRNAs mainly target the non-conserved regions of Intron 2 and Intron 3 of the Sel S gene.

[0007] Further, the animal is a mouse. By using the above kit, gene editing can be performed on fertilized eggs to obtain edited fertilized eggs, and then cultured to obtain the required animal model.

[0008] Another aspect of the present invention provides a method for constructing an animal model of depression, which includes knocking out the SelS protein expression gene in an animal by means of gene knockout.

[0009] Further, the method of gene knockout can be the CRISPR-Cas9 knockout method or stem cell recombination technology.

[0010] Further, the animal can be a mouse or other experimental animals, such as rats.

[0011] Further, when the method is the CRISPR-Cas9 knockout method, gene editing is performed on animal fertilized eggs. The CRISPR-Cas9 knockout method is a commonly used gene editing method well-known to those skilled in the art and will not be elaborated here.

[0012] Further, the reagents used in the CRISPR-Cas9 knockout method include two sgRNAs, the nucleotide sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, and Cas 9.

[0013] Further, the method specifically is: performing gene editing on fertilized eggs by means of the CRISPR-Cas9 knockout method, and then culturing the fertilized eggs to obtain a mouse model of depression.

[0014] Further, the method includes the following steps:

[0015] a. Constructing sgRNA;

[0016] b. Constructing a CRISPR-Cas9 vector for cleaving the target gene;

[0017] c. Constructing a targeting vector;

[0018] d. Injecting RNA and the targeting vector into animal fertilized eggs;

[0019] e. Obtaining F0 mice.

[0020] As described above, the method for constructing an animal model of depression of the present invention has the following beneficial effects:

[0021] By using this method, an animal model of depression can be constructed quickly and effectively, which is beneficial to the research on depression. Description of the Drawings

[0022] Figure 1 Shown is the construction and identification of selenoprotein S knockout mice. A. Schematic diagram of primer design principle; B. Primer information; C. PCR results of genotype identification of KO mouse tails; D. Western Blot results of genotype identification of KO mouse brain tissues.

[0023] Figure 2 Shown is the monitoring of the body weights of selenoprotein S knockout mice at different months of age. A. Body weight of 3-month-old KO mice; B. Body weight of 6-month-old KO mice; C. Body weight of 9-month-old KO mice.

[0024] Figure 3 Shown is the monitoring of blood lipids of 6-month-old selenoprotein S knockout mice. A. HDL-C level in the serum of 6-month-old mice; B. LDL-C level in the serum of 6-month-old mice; C. TC / CHO level in the serum of 6-month-old mice; D. TG level in the serum of 6-month-old mice.

[0025] Figure 4 Shown is the monitoring of the white blood cell level in the blood of 6-month-old selenoprotein S knockout mice.

[0026] Figure 5 Shown is the monitoring of lymphocyte-related levels in the blood of 6-month-old selenoprotein S knockout mice. A. Absolute value level of lymphocytes in the blood of 6-month-old mice; B. Percentage level of lymphocytes in the blood of 6-month-old mice.

[0027] Figure 6 Shown is the monitoring of intermediate cell-related levels in the blood of 6-month-old selenoprotein S knockout mice. A. Level of intermediate cells in the blood of 6-month-old mice; B. Percentage level of intermediate cells in the blood of 6-month-old mice.

[0028] Figure 7 Shown is the monitoring of granulocyte-related levels in the blood of 6-month-old selenoprotein S knockout mice. A. Level of granulocytes in the blood of 6-month-old mice; B. Percentage level of granulocytes in the blood of 6-month-old mice.

[0029] Figure 8 Shown is the monitoring of platelet-related levels in the blood of 6-month-old selenoprotein S knockout mice. A. Mean platelet volume in the blood of 6-month-old mice; B. Platelet volume distribution width in the blood of 6-month-old mice; C. Platelet count in the blood of 6-month-old mice; D. Platelet hematocrit in the blood of 6-month-old mice.

[0030] Figure 9 Shown is the monitoring of red blood cell-related levels in the blood of 6-month-old selenoprotein S knockout mice. A. Red blood cell content in the blood of 6-month-old mice; B. Mean corpuscular volume of red blood cells in the blood of 6-month-old mice; C. Hematocrit of red blood cells in the blood of 6-month-old mice; D. Coefficient of variation of red blood cell distribution width in 6-month-old mice; E. Standard deviation of red blood cell distribution width in the blood of 6-month-old mice.

[0031] Figure 10Shown is the monitoring of hemoglobin-related levels in the blood of 6-month-old selenoprotein S knockout mice. A. Hemoglobin content in the blood of 6-month-old mice; B. Mean corpuscular hemoglobin content in the blood of 6-month-old mice; C. Mean corpuscular hemoglobin concentration in the blood of 6-month-old mice.

[0032] Figure 11 Shown are the results of the FST and TST experiments on 13-month-old S knockout mice, n = 12, student t test, *p < 0.05.

[0033] Figure 12 Shown are the results of the FST and TST experiments on 3-month-old S knockout mice, n = 24, student t test, *p < 0.05.

[0034] Figure 13 Shown is the open field test to detect the spontaneous activity and exploratory ability of 3-month-old mice. A. Number of grids passed through by the mice during exploration; B. Number of times the mice stood; C. Number of defecations of the mice. (*: vs control group, **p < 0.01, *p < 0.05).

[0035] Figure 14 Shown is the open field test to detect the spontaneous activity and exploratory ability of 6-month-old mice. A. Number of grids passed through by the mice during exploration; B. Number of times the mice stood; C. Number of defecations of the mice (*: vs control group, ***p < 0.001, **p < 0.01).

[0036] Figure 15 Shown is the open field test to detect the spontaneous activity and exploratory ability of 10-month-old mice. A. Number of grids passed through by the mice during exploration; B. Number of times the mice stood; C. Number of defecations of the mice (*: vs control group, *p < 0.05).

[0037] Figure 16 Shown is the elevated plus maze test to detect the anxiety level of 3-month-old mice. A, E. Latency of the mice to first enter the open arm and the closed arm; B, F. Total distance traveled by the mice in the open arm and the closed arm; C, G. Total time the mice stayed in the open arm and the closed arm; D, H. Number of times the mice entered the open arm and the closed arm. (*: vs control group, **p < 0.01, *p < 0.05).

[0038] Figure 17 Shown is the elevated plus maze test to detect the anxiety level of 6-month-old mice. A, E. Latency of the mice to first enter the open arm and the closed arm; B, F. Total distance traveled by the mice in the open arm and the closed arm; C, G. Total time the mice stayed in the open arm and the closed arm; D, H. Number of times the mice entered the open arm and the closed arm.

[0039] Figure 18Shown as the elevated plus maze test to detect the anxiety of 10-month-old mice. A, E. Latency of mice entering the open arms and closed arms for the first time; B, F. Total distance of mice moving in the open arms and closed arms; C, G. Total time of mice staying in the open arms and closed arms; D, H. Number of times mice enter the open arms and closed arms. (*: vs control group, **p < 0.01, *p < 0.05).

[0040] Figure 19 Shown as the Y maze test to detect the spontaneous activity and memory ability of 3-month-old mice. A. Total number of times mice enter the arms; B. Spontaneous alternation rate of mice.

[0041] Figure 20 Shown as the Y maze test to detect the spontaneous activity and memory ability of 6-month-old mice. A. Total number of times mice enter the arms; B. Spontaneous alternation rate of mice. (*: vs control group, ***p < 0.001).

[0042] Figure 21 Shown as the Y maze test to detect the spontaneous activity and memory ability of 10-month-old mice. A. Total number of times mice enter the arms; B. Spontaneous alternation rate of mice. (*: vs control group, *p < 0.05).

[0043] Figure 22 Shown as the novel object recognition test to detect the exploration and memory ability of 3-month-old mice. A. Total exploration time of each group of mice during the familiarization period; B. Discrimination ratio of mice between new and old objects during the test period.

[0044] Figure 23 Shown as the novel object recognition test to detect the exploration and memory ability of 6-month-old mice. A. Total exploration time of each group of mice during the familiarization period; B. Discrimination ratio of mice between new and old objects during the test period. (*: vs control group, ***p < 0.001).

[0045] Figure 24 Shown as the novel object recognition test to detect the exploration and memory ability of 10-month-old mice. A. Total exploration time of each group of mice during the familiarization period; B. Discrimination ratio of mice between new and old objects during the test period. (*: vs control group, ***p < 0.001).

[0046] Figure 25 Shown as the contextual fear test to detect the ability of 3-month-old mice to learn, remember the association between unpleasant experiences and the environment.

[0047] Figure 26 Shown as the contextual fear test to detect the ability of 6-month-old mice to learn, remember the association between unpleasant experiences and the environment.

[0048] Figure 27Shown as the ability of the scene fear experiment to detect the association between the learning and memory of unpleasant experiences and the environment in 10-month-old mice.

[0049] Figure 28 Shown as the Morris water maze test for the spatial learning and memory abilities of 3-month-old mice. A. Escape latency of mice during the place navigation; B: Average swimming speed of mice in each group; C: Number of times mice crossed the platform during the spatial exploration experiment; D Time that mice swam in the quadrant where the platform was located during the spatial exploration experiment.

[0050] Figure 29 Shown as the Morris water maze test for the spatial learning and memory abilities of 6-month-old mice. A. Escape latency of mice during the place navigation; B: Average swimming speed of mice in each group; C: Number of times mice crossed the platform during the spatial exploration experiment; D Time that mice swam in the quadrant where the platform was located during the spatial exploration experiment.

[0051] Figure 30 Shown as the Morris water maze test for the spatial learning and memory abilities of 10-month-old mice. A. Escape latency of mice during the place navigation; B: Average swimming speed of mice in each group; C: Number of times mice crossed the platform during the spatial exploration experiment; D Time that mice swam in the quadrant where the platform was located during the spatial exploration experiment.

[0052] Figure 31 Shown as the Morris water maze test for the spatial learning and memory abilities of 13-month-old mice. A. Escape latency of mice during the place navigation; B: Average swimming speed of mice in each group; C: Number of times mice crossed the platform during the spatial exploration experiment; D Time that mice swam in the quadrant where the platform was located during the spatial exploration experiment.

[0053] Figure 32 Shown as the ELISA results of 5-HT in the serum of 13-month-old KO mice.

[0054] Figure 33 Shown as the detection of BDNF protein expression level in the brain tissue of 13-month-old KO mice by Western blot.

[0055] Figure 34 Shown as the detection of BDNF mRNA level in the brain tissue of 13-month-old KO mice by qPCR.

[0056] Figure 35 Shown as the detection of mRNA levels of inflammatory factors and apoptosis-related factors in the brain tissue of 13-month-old KO mice by qPCR.

[0057] Figure 36Shown as the long-term potentiation (LTP) of synapses of neurons in the CA1 region of the hippocampus in the brains of 13-month-old mice. A. Electrophysiological recording electrodes for mouse brain slices, and the detection position of mouse brain slices is the hippocampal CA1; B. Time flow chart of the slope of fEPSP of neurons in the CA1 region of the hippocampal mouse brain slice; C. Average slope of fEPSP of synapses of neurons in the CA1 region of the hippocampal mouse brain slice after high-frequency stimulation. (****p < 0.0001, n = 6).

[0058] Figure 37 Shown as the number of dendritic spines of neurons in the hippocampal region of the brains of 13-month-old KO mice observed by Golgi staining. A. Observation of the number of dendritic spines of neurons in the hippocampal region of the mouse brain; B. Analysis of the number of dendritic spines of neurons in the hippocampal region of the mouse brain. (*p < 0.05, n = 30; Scale bar: 5μm).

[0059] Figure 38 Shown as the synaptic structure in the hippocampal region of the brains of 13-month-old mice observed by transmission electron microscopy. A. Transmission electron micrograph of the synaptic structure in the hippocampal region; B. Statistics of synaptic cleft in the hippocampal region; C. Statistics of the thickness of the postsynaptic membrane in the hippocampal region; D. Statistics of the synaptic interface curvature in the hippocampal region; E. Statistics of the number of synapses in the hippocampal region. (*p < 0.05, n = 30; Scale bar: 500nm).

[0060] Figure 39 Shown as the synaptic structure in the cerebral cortex region of the brains of 13-month-old mice observed by transmission electron microscopy. A. Transmission electron micrograph of the synaptic structure in the cortical region; B. Statistics of synaptic cleft in the cortical region; C. Statistics of the thickness of the postsynaptic membrane in the cortical region; D. Statistics of the synaptic interface curvature in the cortical region; E. Statistics of the number of synapses in the cortical region. (**p < 0.01, n = 30; Scale bar: 500nm).

[0061] Figure 40 Shown as the detection of the protein expression levels of PSD95 and Synaptophysin in the hippocampal region of mouse brain tissue. A. Western-blot detection map of PSD95 and Synaptophysin proteins; B. Quantitative analysis of the gray value of PSD95 protein; C. Quantitative analysis of the gray value of Synaptophysin protein. (**p < 0.01, ***p < 0.001, n = 6).

[0062] Figure 41 Pathway of changes in depression-related factors.

[0063] Figure 42 Construction process of selenoprotein S knockout mice. Specific implementation manners

[0064] The following describes the embodiments of the present invention through specific examples. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the process equipment or devices not specifically noted in the following embodiments are all conventional equipment or devices in the art. In addition, it should be understood that one or more method steps mentioned in the present invention do not exclude the existence of other method steps before and after the combined steps or the insertion of other method steps between these clearly mentioned steps, unless otherwise stated; it should also be understood that the combined connection relationship between one or more devices / devices mentioned in the present invention does not exclude the existence of other devices / devices before and after the combined devices / devices or the insertion of other devices / devices between these two clearly mentioned devices / devices, unless otherwise stated. Moreover, unless otherwise stated, the numbers of the method steps are only convenient tools for identifying the method steps, rather than limiting the arrangement order of the method steps or the scope in which the present invention can be implemented. The change or adjustment of their relative relationship, without substantial change in the technical content, should also be regarded as the scope in which the present invention can be implemented.

[0065] Table 1 Main instruments and manufacturers for behavioral experiments

[0066]

[0067]

[0068] Example 1 Construction and identification of selenoprotein S knockout mice

[0069] To study the potential functions involved in SELENOS, we constructed SELENOS gene knockout (KO) mice using the method of injecting Cas 9 / sgRNA into fertilized eggs. Operating method: Inject PMsG and hcG into the mice (not simultaneously). After injection, put them together in a cage. At the same time, mate the estrous receptor mice with ligated male mice. Select the receptor mice with plugs and place them properly. After the injection is completed, perform tubal transplantation. After the donor mice are sacrificed, take the oocytes and place them in the operating solution. Treat them with hyaluronic acid to make the zona pellucida fall off. Place the eggs in KSOM medium for culture. Then, perform fertilized egg injection under a microscope, that is, inject sgRNA and Cas9 mRNA into the fertilized eggs. Continue to culture the successfully injected eggs in KSOM medium, and then perform tubal transplantation. Wait quietly for 19 days until the genetically modified mice are born. Refer to Figure 42 。

[0070] Analyze the structure of the Sel S gene, confirm that Exon3 of the Sel S gene can be floxed, and design sgRNAs in the non-conserved regions of Intron 2 and Intron 3 of the Sel S gene respectively:

[0071] sgRNA: GACCTGGGCCGGTCAAGTGATGG (SEQ ID NO.1).

[0072] sgRNA: AGAGATGTATGTACATGCCG TGG (SEQ ID NO.2).

[0073] As Figure 1 shown in the schematic diagram of A, the primers used to identify KO mice were designed at the flanks of Exon3 (WT-F / Mut-R), and the detailed sequences of the primers are as Figure 1 shown in B, Table 2 and Table 3. Through PCR amplification and product sequencing, homozygous KO mice could generate a shifted mutant fragment of 856 bp, indicating that the KO mice were successfully constructed ( Figure 1 C). Through Western Blot experiments, it was found that compared with wild-type (WT), SELENOS protein was not present in the brain tissues of 6-month-old KO mice, further confirming that SELENOS had been successfully knocked out ( Figure 1 D).

[0074] Table 2

[0075]

[0076]

[0077] Table 3

[0078]

[0079] Among them, the second stage was repeated 32 times.

[0080] Example 2 Monitoring of various indicators of selenium protein S knockout mice

[0081] To detect the basic health status of KO mice, we monitored the body weights of KO mice at 3, 6, and 9 months of age. The results are as Figure 2 shown. Compared with age-matched WT mice, homozygous KO mice showed no significant differences in size and body weight and were fertile.

[0082] Similarly, we detected the blood glucose levels of KO mice at 3, 6, and 9 months of age. The results showed that compared with age-matched WT mice, the blood glucose levels of KO mice did not change significantly.

[0083] Detection of the blood lipid levels in 6-month-old KO mice revealed that, compared with age-matched WT mice, there were no significant differences in the levels of high-density lipoprotein-cholesterol (HDL-C), low-density lipoprotein-cholesterol (LDL-C), total cholesterol (TC / CHO), and triglyceride (TG) in the sera of KO mice. Figure 3 )

[0084] To understand the physiological status of KO mice, we performed a blood routine analysis on 6-month-old mice. Blood routine is the most general and basic blood test. Blood routine examines the cellular part of the blood. Diseases are judged by observing the changes in the number and morphological distribution of red blood cells (RBC), white blood cells (WBC), and platelets (PLT). Pathological leukocytosis is commonly seen in acute suppurative infections, uremia, leukemia, tissue injury, acute hemorrhage, etc. Pathological leukopenia is seen in aplastic anemia, certain infectious diseases, cirrhosis, hypersplenism, radiotherapy and chemotherapy, etc. As Figure 4 shown, compared with age-matched WT mice, there were no significant differences in the levels of white blood cells in the blood of KO mice.

[0085] Lymphocytes (Lymph) are a type of white blood cell and are the smallest white blood cells, produced by lymphoid organs. Higher levels of lymphocytes are commonly seen in infectious mononucleosis, viral infections, acute infectious lymphocytosis, and lymphocytic leukemia, etc.; lower levels are commonly seen in immune deficiencies, etc. As Figure 5 shown, compared with WT mice, there were no significant differences in the absolute value (Lymph) and percentage (Lymph%) of lymphocytes in the blood of 6-month-old selenoprotein S knockout mice.

[0086] Intermediate cells (MID) are also a type of white blood cell, specifically including monocytes, eosinophils, and basophils. Increased monocytes are commonly seen in monocytic leukemia, etc., increased eosinophils are commonly seen in various allergic diseases and blood diseases, etc., and increased basophils are commonly seen in chronic myeloid leukemia, etc. A decrease in intermediate cells generally has no important clinical significance. As Figure 6 shown, compared with WT mice, there were no significant differences in the levels and percentages of intermediate cells in the blood of 6-month-old selenoprotein S knockout mice.

[0087] Granulocytes (Gran) are also components of white blood cells. An increase or decrease in granulocytes may be caused by infections, inflammation, the body's stress response, blood system diseases, etc. Similarly, there were no significant differences in the levels of granulocytes and the percentage of granulocytes in the blood of 6-month-old selenoprotein S knockout mice compared with those of WT mice ( Figure 7 ).

[0088] Platelets have specific morphological structures and biochemical compositions, and have a relatively constant number in normal blood. They play important roles in physiological and pathological processes such as hemostasis, wound healing, inflammatory responses, thrombosis, and organ transplant rejection. Too few platelets will result in coagulation disorders. However, too many platelets will form thrombi, making it difficult for blood to flow. As Figure 8 shown, there were no significant differences in the mean platelet volume (PV), platelet distribution width (DW), platelet count, and plateletcrit (T) in the blood of 6-month-old selenoprotein S knockout mice compared with those of WT mice.

[0089] Red blood cells are the most numerous type of blood cells in the blood and are also the main medium for transporting oxygen in the body of vertebrates through the blood. They also have immune functions. An increase in red blood cells is common in polycythemia vera and compensatory polycythemia. Some heart and lung diseases can also cause an increase in red blood cells; a decrease in red blood cells below the normal value is common in anemia and bleeding. As Figure 9 , there were no significant differences in the red blood cell content, mean corpuscular volume (MCV), hematocrit (HCT), coefficient of variation of red blood cell distribution width (RDW-CV), and standard deviation of red blood cell distribution width (RDW-SD) in the blood of 6-month-old selenoprotein S knockout mice compared with those of WT mice ( Figure 10 ).

[0090] Hemoglobin is the main component of red blood cells and is one of the important indicators for clinical diagnosis of anemia. As Figure 10, compared with WT mice, there were no significant differences in the hemoglobin content, mean corpuscular hemoglobin (MCH), and mean cellular hemoglobin concentration (MCHC) in the blood of 6-month-old selenoprotein S knockout mice Figure 9 ).

[0091] It can be seen that we successfully obtained KO mice, and the homozygous KO mice were fertile. Compared with age- and sex-matched WT mice, there were no significant differences in the size, body weight, and blood lipids of KO mice. By routine blood tests to evaluate the white blood cells, red blood cells, hemoglobin, and platelets of KO mice, no significant changes were found either.

[0092] Example 3 Mouse Behavioral Tests

[0093] The forced swim test (FST) : It is used to evaluate the learned helplessness of rodents and is often used to detect the effects of antidepressants on animal models of depression. Forced swimming experiment device: 32 cm high, 20 cm wide, 20 cm long

[0094] Steps: Place the animal in a restricted environment (cold water). The animal struggles desperately to escape in this environment but cannot escape, thus providing an inescapable oppressive environment. After a period of time, the animal exhibits a typical "immobile state", reflecting a so-called "behavioral despair state". One day before the experiment, conduct training first. Put the mice into the swimming bucket (the water depth is 2 / 3, and the water temperature is 23 - 35 °C). After training for 5 minutes and resting for 5 minutes, continue training for a total of 15 minutes. After 15 minutes, take out the animals, dry them, and then put them back into their respective cages. During the experiment, calculate for 6 minutes, and take the last 4 minutes for statistics. Calculate the immobility latency / total time ratio.

[0095] The tail suspension test (TST) : Due to the obvious morphological changes it produces, it is often used to study the characteristics of depression. Steps: Stick the mouse's tail to the hook (hanging head down) so that the distance from the head to the bottom of each mouse is the same. The animal struggles desperately to escape in this environment but cannot escape, thus providing an inescapable oppressive environment. After a period of time, the animal exhibits a typical "immobile state", reflecting a so-called "behavioral despair state". Calculate for 6 minutes, and take the last 4 minutes for statistics. Calculate the immobility latency / total time ratio. Forced swimming device: 12 cm in diameter, 30.5 cm high.

[0096] The results are as follows:

[0097] Figure 11 : In the behavioral tests of SelS gene knockout mice at 13 months of age, it was found that the despair period was significantly increased in the forced swimming test and the tail suspension test, indicating that the knockout of the SelS gene caused obvious depressive symptoms in mice.

[0098] Figure 12 : In the behavioral tests of SelS gene knockout mice at 3 months of age, it was found that the despair period was significantly increased in the forced swimming test, but there was no significant difference compared with the control group in the tail suspension test, indicating that depressive symptoms began to appear in SelS gene knockout mice at 3 months of age.

[0099] Open field test: The device is an open field box made of gray plastic with dimensions of 40×40×40 cm. The floor is made of hard plastic and is divided into 5 equal-sized grids (each grid is 8×8 cm). There is a camera device above the open field for recording. The entire experiment needs to be carried out in a quiet environment. Before the experiment starts, the open field needs to be cleaned with alcohol to ensure no strange smell. During the experiment, the mouse is taken out of the cage and placed in the center of the open field box, and allowed to move freely for 5 minutes. During this period, video recording and timing are carried out. Record the number of grids the mouse crosses, the number of defecations of the mouse, and the number of times the mouse stands on its hind legs within 5 minutes. After the test of each mouse is completed, the mouse is placed in another pre-prepared cage. Subsequently, the open field box is cleaned with 75% alcohol to remove the smell and dried with a paper towel to prevent the residual smell of the previous mouse from interfering with the experiment of the next mouse. This experiment uses the SMART v3.0 video tracking system to record the movement of the mouse, and the Graphpad Prism 8.0 software for data analysis and graphing. p < 0.05 indicates that the results have significant differences.

[0100] The results are as Figures 13 - 15 , Figure 13 The spontaneous activity ability of SelS gene knockout mice at 3 months of age was weaker than that of the control group mice, and the number of standing times decreased, indicating that the anxiety level of KO mice was severe.

[0101] Figure 14 The number of grids crossed by SelS gene knockout mice at 6 months of age was significantly reduced, indicating that the spontaneous activity ability and exploration ability of KO mice were weaker than those of the control group mice; the number of standing times of the mice decreased, indicating that the exploration desire of KO mice for external things was reduced.

[0102] Figure 15 The number of grids crossed and the number of standing times of SelS gene knockout mice at 10 months of age decreased, indicating that the spontaneous activity ability and exploration ability of KO mice were weaker than those of the control group mice.

[0103] In summary: The spontaneous activity and exploration ability of KO mice were reduced, and the anxiety level was increased.

[0104] Elevated plus - maze test: The elevated plus-maze consists of two opposite open arms (30×5 cm) and two opposite closed arms (30×5×15 cm), shaped like a "+" sign. The maze is 50 cm above the ground, and there is a camera device above for recording. Before the experiment starts, to reduce the stress stimulation of the new environment on the mice during the experiment and prevent the mice from always hiding in the closed arms, the mice are first placed in an open field to adapt for 5 minutes before the experiment, and the maze is cleaned with alcohol to ensure no strange smell. When the experiment starts, the mice are taken out of the cage and placed in the center of the maze facing the closed arms, allowing them to move freely for 5 minutes, during which video recording and timing are carried out. Record the latency of the mice's first entry into the open arm (closed arm) within 5 minutes, the distance traveled in the open arm (closed arm), the total time spent in the open arm (closed arm), and the number of times entering the open arm (closed arm). After each mouse's test is completed, the maze is cleaned with 75% alcohol and dried with a paper towel to prevent the residual information of the previous mouse from affecting the training of the next mouse. This experiment uses the SMART v3.0 video tracking system to record the movement of the mice, and the Graphpad Prism 8.0 software for data analysis and graphing processing.

[0105] The results are as Figures 16 - 18 , Figure 16 The latency of SelS gene knockout mice to first enter the open arm at 3 months of age is prolonged, the total time spent in the open arm is significantly reduced, and the total distance traveled in the closed arm is significantly increased, indicating that the exploratory ability of KO mice in a novel environment is significantly reduced and the anxiety level is severe.

[0106] Figure 17 There are no significant changes in the various indicators of SelS gene knockout mice at 6 months of age, but there is a tendency for the total number of times entering the closed arm to decrease, indicating that the exploratory ability of 6-month-old KO mice in a novel environment is reduced and the anxiety level is increased.

[0107] Figure 18 The total distance traveled by SelS gene knockout mice in the closed arm at 10 months of age is reduced, and the total time spent in the closed arm is increased, indicating that the exploratory ability of 10-month-old KO mice in a novel environment is significantly reduced and the anxiety level is severe.

[0108] In summary: Compared with WT mice, the anxiety level of KO mice is significantly increased.

[0109] Y - maze test:The device is a radial maze box made of grey plastic, consisting of three arms of equal length that are 120 degrees apart from each other. Each arm is 30 cm long, and the maze is 50 cm above the ground, with a camera device above for recording. The entire experiment needs to be carried out in a quiet environment. Before the experiment starts, the maze should be cleaned with alcohol to ensure no odors. During the experiment, the mouse is taken out of the cage and placed at the end of one arm, allowing it to move freely for 5 minutes while being filmed and timed. Record the order and total number of times the mouse enters each arm within 5 minutes, and count the number of correct alternating responses. Among them, the spontaneous alternation rate (%) = number of correct alternating responses / (total number of arm entries - 2) × 100%. After each mouse's test is completed, the maze is cleaned with 75% alcohol to remove the odor and dried with a paper towel to prevent the residual odor of the previous mouse from interfering with the experiment of the next mouse. This experiment uses the SMART v3.0 video tracking system to record the movement of the mouse, and the Graphpad Prism 8.0 software for data analysis and graphing processing.

[0110] The results are as Figures 19 - 21 , Figure 19 In SelS gene knockout mice at 3 months of age, there were no significant changes in the total number of arm entries and the spontaneous alternation rate, indicating that the recognition and memory ability of 3-month-old KO mice in a novel environment was not significantly different from that of control mice.

[0111] Figure 20 In SelS gene knockout mice at 6 months of age, the total number of arm entries decreased significantly, and the spontaneous alternation rate showed no significant change, indicating that the exploratory desire of 6-month-old KO mice for new things decreased, and the memory ability showed no significant change.

[0112] Figure 21 In SelS gene knockout mice at 10 months of age, the total number of arm entries decreased, and the spontaneous alternation rate showed no significant change, indicating that the exploratory desire of 10-month-old KO mice for new things decreased, and the memory ability showed no significant change.

[0113] In summary: The memory ability of KO mice did not change significantly; the exploratory desire for new things decreased.

[0114] Novel object recognition test: It consists of three stages: the adaptation period, the familiarization period, and the testing period. There are three objects, A, B, and C. Among them, A and B are exactly the same, and C is completely different from A and B in terms of color and shape. Before the experiment, the site and objects should be disinfected with 75% alcohol. During the experiment, the behavior laboratory should be kept quiet, and the appropriate light intensity, temperature, and humidity should be maintained. Adaptation period: The mice are sequentially placed in the experimental box without objects for 5 minutes to allow them to move freely to adapt to the environment, thereby reducing the stress stimulation of the new environment on the mice during the experiment. After each mouse finishes adapting, the experimental box is cleaned with 75% alcohol to prevent the residual information of the previous mouse from affecting the training of the next mouse. Familiarization period: The two identical objects A and B are placed at the diagonals of the experimental box. The mouse is placed in the field with its back facing the two objects for 5 minutes, and attention should be paid to the same distance between the tip of the mouse's nose and the two objects. The video recording device is turned on to record the exploration of the two identical objects by the mouse. (The nose or mouth facing the object and within 2 cm of the object can be regarded as the exploration of the new object). The detection index in the familiarization period is the total exploration time or number of times of the two objects by the mouse. After each mouse finishes the test, the experimental box is cleaned with 75% alcohol to prevent the residual information of the previous mouse from affecting the training of the next mouse. Testing period: One of the two identical objects, B, is replaced with object C. At this time, object A is called the familiar object, and object C is called the novel object. To prevent experimental errors caused by the mouse's preference for position, at this time, object A and object C should be placed at the other two diagonal positions of the test box. Record the exploration of the two different objects by the mouse within 5 minutes. After each mouse finishes the test, the experimental box is cleaned with 75% alcohol to prevent the residual information of the previous mouse from affecting the training of the next mouse. The detection index in the testing period is the resolution ratio (DR) of the mouse to the new and old objects. The specific calculation formula is: DR = N / (N + F), where "N" represents the exploration time or number of times of the mouse for the novel object, and "F" represents the exploration time or number of times of the mouse for the familiar object. In this experiment, the SMART v3.0 video tracking system is used to record the movement of the mice, and the Graphpad Prism 8.0 software is used for data analysis.

[0115] The results are as Figures 22 - 24 , Figure 22 In 3-month-old SelS gene knockout mice, there were no significant changes in the total number of explorations of the two objects during the familiarization period and the resolution ratio of the new and old objects during the testing period, indicating that there were no significant changes in the memory ability of KO mice.

[0116] Figure 23 In 6-month-old SelS gene knockout mice, the total number of explorations of the two objects during the familiarization period decreased significantly, while the resolution ratio of the new and old objects during the testing period did not change significantly, indicating that the spontaneous activity and exploration of 6-month-old KO mice in a novel environment decreased, but the memory ability did not change significantly.

[0117] Figure 24 In 10-month-old SelS gene knockout mice, the total exploration times of the two objects during the familiarization period were significantly reduced, while the discrimination ratio of the old and new objects during the test period showed no obvious change. This indicates that the exploration desire for new things in 10-month-old KO mice decreased, but their memory ability did not change significantly.

[0118] In summary, the memory ability of KO mice did not change significantly, but the exploration desire for new things decreased significantly.

[0119] Contextual fear conditioning test The operation steps refer to the "Instruction Manual for the Scenario Fear Experiment System" of Jiangsu Sians Biotechnology Co., Ltd. The specific operation steps are as follows: Training stage (the first day) ① Adjust the instrument to ensure that there is current on the grid floor and sound from the loudspeaker, and record the current intensity and sound intensity (decibels). ② Put the mouse into the fear box for 2 minutes. ③ First, apply a sound stimulus, 80 Db for 30 seconds, and then give an electric shock, 0.35 mA for 2 seconds. ④ No stimulus for 20 seconds. ⑤ Repeat steps (③ - ⑤) to strengthen the associative memory of the mouse to the sound stimulus and electric shock. ⑥ After each mouse is tested, clean the operation box with 75% alcohol to prevent the residual information of the previous mouse from affecting the training of the next mouse. Test stage (the second day) Enter the test stage on the second day after the training stage. This stage includes three tests, namely: Context test, Altered context test, and Conditioning stimulus test. There is no electric shock in all three tests, and there is no sound stimulus in the Context test and Altered context test. The fear box in the Context test is the same as that in the training stage, while the fear box needs to be modified in the Altered context test and Conditioning stimulus test. Context test: Put the mouse into the fear box for 2 minutes. The freezing time of the mouse in this stage is the contextually conditioned fear of the mouse. After each mouse is tested, clean the operation box with 75% alcohol. ② Conduct the Altered context test and Auditory conditioning stimulus test 1 hour after the Context test. The specific operations are as follows: a. Modify the fear box: Replace the conductive grid floor with a black smooth plastic board; use a black smooth plastic board to partition a small triangular area inside the box so that the mouse can only move in this area; thoroughly clean the operation box with 4% acetic acid solution to change the olfactory cue. b. Put the mouse into the modified fear box. c. No stimulus for 2 minutes. (Altered context test) d. Apply an auditory conditioning stimulus for 2 minutes. (Auditory conditioning stimulus test) e. No stimulus for 60 seconds. f. After each mouse is tested, clean the operation box with 4% acetic acid solution and conduct the test on the next animal. Use the ANYmaze v5.1 video tracking system to record the freezing situation of the mouse, and use the Graphpad Prism 8.0 software for data analysis.

[0120] The results are as follows Figures 25 - 27 , Figure 25 There were no significant changes in the freezing time of SelS gene knockout mice at 3 months old in the unconditional fear, associative test, altered association test, and auditory conditioned stimulus test, indicating that the memory ability of 3-month-old KO mice was not significantly changed.

[0121] Figure 26 The freezing time of SelS gene knockout mice at 6 months old showed an increasing trend during each test period, and the freezing time was significantly increased in the unconditional fear test and associative test. This indicates that the anxiety and fear emotions of 6-month-old KO mice were aggravated.

[0122] Figure 27 The freezing time of SelS gene knockout mice at 10 months old showed an increasing trend in the associative test, indicating that the fear emotion of 10-month-old KO mice was somewhat aggravated.

[0123] In summary: The memory ability of KO mice did not change significantly, while the fear emotion increased significantly.

[0124] Morris water maze test : The device is a cylindrical pool with a diameter of 160 cm and a height of 50 cm. During the experiment, the pool is filled with water to a height of about 26 cm, and the water temperature is maintained at 20 ± 1°C. There are a lighting lamp and a camera device at the top of the pool, and the pool is surrounded by curtains to prevent the surrounding environment from affecting the mice. According to the settings of the water maze system, the water maze is artificially divided into four quadrants. A circular platform with a diameter of 12 cm is placed in one of the quadrants, 30 cm away from the pool wall, and the platform height is 1 - 2 cm lower than the water surface. The camera at the top records and collects the movement trajectories of the mice, and then the relevant data is analyzed using water maze analysis software. The experimental steps are as follows: The place navigation lasts for 5 days, and the experiment is carried out at the same time every day. Before the experiment, the mice are first placed on the platform to memorize for 10 s, and then the mice are put into the water from the opposite quadrant facing the pool wall, and the time it takes for the mice to find the platform is recorded. The time limit is 60 s. If the mice fail to find the platform within 60 s, the mice are placed back on the platform to memorize for 10 s again, and finally the mice are dried and returned to the cage. The camera and software record the swimming trajectory data of the mice and the time (escape latency) for the mice to find the platform. Spatial exploration experiment: 24 h and 72 h after the end of the place navigation experiment, the platform is removed for the spatial exploration experiment, where the 24 h one is the short-term memory test and the 72 h one is the long-term memory test. The mice are put into the pool from the opposite quadrant, and the number of times the mice pass through the original platform position and the time they stay in the original platform quadrant are recorded. The SMART v3.0 video tracking system is used to record the movement of the mice, and the Graphpad Prism 8.0 software is used for data analysis and graphing.

[0125] The results are as follows Figures 28 - 31 , Figure 28In 3-month-old SelS gene knockout mice, there were no significant differences in the number of times they crossed the location of the original platform and the swimming time in the quadrant where the platform was located compared to the WT group in short-term and long-term memory tests. In addition, there were no obvious differences in the swimming speed between the two groups of mice. This indicates that the memory ability of 3-month-old KO mice has not changed significantly.

[0126] Figure 29 There were no significant differences in the daily escape latency of 6-month-old SelS gene knockout mice. Moreover, in short-term and long-term memory tests, there were no significant differences in the number of times they crossed the original platform and the swimming time in the quadrant where the platform was located. This indicates that the memory ability of 6-month-old KO mice has not changed significantly.

[0127] Figure 30 There were no significant differences in the daily escape latency of 10-month-old SelS gene knockout mice. Moreover, in short-term and long-term memory tests, there were no significant differences in the number of times they crossed the original platform and the swimming time in the quadrant where the platform was located. This indicates that the learning and memory abilities of 10-month-old KO mice have not changed significantly.

[0128] Figure 31 There were no significant differences in the escape latency of SelS gene knockout mice in the first 4 days of 13 months old; the escape latency of KO group mice on the fifth day was significantly longer than that of the control group. However, in short-term and long-term memory tests, the number of times they crossed the original platform and the swimming time in the quadrant where the platform was located were not significantly different from those of the WT group. This indicates that the learning and memory abilities of 13-month-old KO mice have decreased.

[0129] In summary: The learning and memory abilities of 3-month-old / 6-month-old / 10-month-old KO mice showed no obvious changes compared to the WT group; the learning and memory abilities of 13-month-old KO mice decreased.

[0130] Summary:

[0131] By using behavioral methods such as the water maze to detect the behavioral indicators of mice at four time periods respectively, we found that: the spontaneous activity and exploration ability of 3-, 6-, and 10-month-old KO mice decreased, and the anxiety level increased, but there were no obvious differences in memory compared to the control group; the learning and memory abilities of 13-month-old KO mice decreased, and the depressive-like behavior was significantly aggravated.

[0132] Example 3 Depression indicators

[0133] Depression is caused by insufficient 5-hydroxytryptamine. When suffering from depression, the level of 5-hydroxytryptamine is low. When the content of 5-hydroxytryptamine is relatively low or even insufficient, it will reduce the activity of nerves and cause loss of autonomy, and at this time, it is very easy to suffer from depression. Figure 32 The serum 5-HT ELISA of 13-month-old KO mice was shown.

[0134] Schematic diagram of the changes in neurotransmitters, inflammation-related factors, apoptosis-related factors caused by depression, and the damage to cranial nerves, see Figure 41 。

[0135] Previous studies have shown that in major depressive disorder, mitogen-stimulated IL-1β production and lymphocyte IL-1β mRNA levels increase. In animal models of depression, the continuous increase in central nervous system IL-6 may play a pathophysiological role in the basis of antidepressant treatment resistance. It was found that the levels of TNFα and IL-1β increased in the CRS-induced mouse model of depression.

[0136] Biomarkers BDNF, Bcl-2, and Bax are regulated by stress and depression. BDNF plays a neuroprotective role by regulating Bcl-2 family members. However, when the external stimulus is excessive or long-term, the Bcl-2 family will activate caspase-3 and poly(ADP-ribose) polymerase (PARP) with the decrease in BDNF expression, and finally apoptosis occurs, resulting in cranial nerve damage and impaired brain function. It was found that the BDNF level decreased significantly in the CRS-induced depression model mice.

[0137] Figure 33 and Figure 34 showed that after knocking out the selS gene at 13 months, the synthesis of BDNF protein in the mouse brain tissue decreased significantly, and the mRNA expression level increased significantly.

[0138] Figure 35 showed that the pro-inflammatory factors IL-1β, IL-6, and TNFα related to depression increased significantly; and the apoptosis factors related to depression increased significantly

[0139] Example 4 Effects of SelS on synapses

[0140] Effect of SelS deficiency on long - term potentiation (LTP) of synapses in the hippocampal neurons of mice

[0141] It was found that depressive mood can cause changes in the electrophysiological level of rats. The previous results showed that 13-month-old KO mice not only showed obvious depressive-like behaviors, but also their memory level decreased. To explore the synaptic plasticity of 13-month-old KO mice, we used the MED64 planar microelectrode array recording system to detect the LTP of synapses of neurons in the hippocampal CA1 region of the KO mice brain. The results are as Figure 36 shown: There was no significant difference in the basic fEPSP slope of the hippocampal CA1 region between the WT and KO groups of mice; after high-frequency stimulation, the fEPSP slope of both groups of mice increased significantly, and LTP was successfully induced; within 1 hour after the recording stimulation, the percentage change in the increase of the fEPSP slope of KO mice was significantly lower than that of WT mice; these results indicate that the synaptic plasticity of KO mice neurons decreased.

[0142] Dendritic spine structure of neurons in the brain of KO mice

[0143] Dendritic spines are small protrusions from the dendrites of neurons. They are the postsynaptic sites of neural connections and the sites of synapse formation, and can receive most excitatory inputs. Changes in dendritic spines directly reflect the plasticity of synaptic structure. To explore whether the decrease in LTP in 13-month-old KO mice is due to changes in dendritic spines, we used Golgi staining to detect the dendritic spines of hippocampal neurons in brain slices of 13-month-old mice. The results showed that the density of dendritic spines in the hippocampal tissue of KO mice was significantly lower than that in the WT group ( Figure 37 ).

[0144] Observation of the morphology and quantity changes of synapses in neurons of the brain tissue of KO mice by transmission electron microscopy

[0145] Dendritic spines are the main sites of synapse formation. The formation, change, and maintenance of dendritic spines are crucial for synaptic function and nerve conduction. To detect the effect of SelS knockout on synapses in mouse brain tissue, we used transmission electron microscopy to observe the neurons synapses in the hippocampus and cortex tissues of 13-month-old mice ( Figure 38 &39). The results showed that in the hippocampal tissue ( Figure 38 ), compared with the WT group, the synaptic interface curvature in the hippocampal tissue of KO mice increased ( Figure 38 D), the number of synapses decreased ( Figure 38 E), while the synaptic cleft ( Figure 38 B) and synaptic thickness ( Figure 38 C) showed no obvious changes.

[0146] As Figure 39 , in the cortical tissue, the thickness of the postsynaptic membrane in the KO group decreased ( Figure 39 C), the number of synapses decreased ( Figure 39 E), while the synaptic cleft ( Figure 39 B) and synaptic interface curvature ( Figure 39 D) showed no significant changes.

[0147] Detection of synaptic - related protein levels in the brain tissue of KO mice

[0148] The normal functioning of synaptic-related structures is regulated by synaptic proteins distributed at different positions of synapses, including postsynaptic density protein 95 (PSD95) and synaptophysin (Syna), etc. PSD95 is the main postsynaptic scaffold protein and is crucial for the morphology and synaptic development of hippocampal neurons. Syna is an adsorption protein mainly produced on synaptic vesicles and plays an important role in the recycling of synaptic vesicles and the release of neurotransmitters. It is an important marker for synaptogenesis and synaptic remodeling. As Figure 40In the brains of 13-month-old KO mice, the levels of PSD95 and Syna both decreased significantly.

[0149] Summary

[0150] After SelS knockout, certain damages occurred in the synaptic structure and function of the mouse brain. Specifically, these include: a significant decrease in LTP, a significant reduction in dendritic spine density, changes in synaptic morphology, a significant decrease in the number, and a decrease in the expression levels of synaptic-related proteins.

[0151] The above embodiments are intended to illustrate the embodiments disclosed in the present invention and should not be construed as limitations on the present invention. In addition, various modifications listed herein and changes in the methods and compositions of the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in connection with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, all obvious modifications to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A method for constructing a mouse model of depression, the method comprising knocking out the mouse SelS protein expression gene by gene knockout, the method being the CRISPR-Cas9 knockout method for gene editing of mouse fertilized eggs; the reagents used in the CRISPR-Cas9 knockout method include two sgRNAs, the nucleotide sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

2. The method according to claim 1, wherein: the reagents used in the CRISPR-Cas9 knockout method include Cas9.

3. The method according to claim 1, wherein: the method is specifically: using the CRISPR-Cas9 knockout method to perform gene editing on fertilized eggs, and then culturing the fertilized eggs to obtain a mouse model of depression.

Images