Cd147-shrna and its use in preparing immunotherapeutic drugs

Abstract

The application discloses CD147-shRNA and application thereof in preparation of immunotherapy drugs, a base sequence of the shRNA is GCAATCACCAATAGCACTGAA; the shRNA sequence for silencing CD147 gene expression is cloned into a lentivirus vector to obtain a recombinant lentivirus particle containing the shRNA sequence, and a recombinant lentivirus for silencing CD147 expression is constructed; the obtained recombinant lentivirus is used for infecting tumor cells to realize the purpose of silencing CD147 gene expression. The shRNA sequence can significantly inhibit the expression of CD147 gene mRNA and protein levels in melanoma and lung cancer cells, increase the expression of chemotactic factor CCL5 and lymphocyte chemotaxis in vitro, increase the number of tumor infiltrating lymphocytes in vivo, inhibit tumor growth, and synergistically enhance the efficacy of immunotherapy for inhibiting tumor growth.

Description

Technical Field

[0001] This invention belongs to the field of gene technology, specifically relating to CD147-shRNA and its application in the preparation of immunotherapy and / or combined immunotherapy drugs. Background Technology

[0002] Tumor immunotherapy has revolutionized cancer treatment and is considered a strategy for treating and even potentially curing cancer. Immune checkpoint inhibitors are the most thoroughly researched class of tumor immunotherapy drugs to date, working by activating the immune system to kill tumor cells. The most common immune checkpoint inhibitors are monoclonal antibodies against PD-1 / PD-L1 and CTLA4, which can be used for patients with various types of cancer. However, only a small percentage of patients achieve long-term and durable efficacy, many develop primary or acquired resistance, and immunotherapy is expensive and has certain toxic side effects. Therefore, there is an urgent need to develop candidate drugs and strategies that can enhance the efficacy of immunotherapy or synergistically fight cancer.

[0003] Lymphocyte infiltration and function are associated with the efficacy of tumor immunotherapy, and the chemotactic migration of immune cells is regulated by the spatiotemporal expression of chemokines. CCL5 is a chemokine-inducing agent for CD8+. + Increased levels of CCL5, a key factor in T lymphocyte chemotaxis, can induce tumor lymphocyte infiltration and anti-tumor immune responses. Therefore, enhancing the expression level of the tumor cell chemokine CCL5 may have therapeutic significance.

[0004] CD147 belongs to the immunoglobulin superfamily and is a type I transmembrane multifunctional protein. CD147 is upregulated in activated T cells and various malignant tumor cells, and participates in T cell activation and proliferation as well as tumor cell migration, adhesion and invasion. Summary of the Invention

[0005] The purpose of this invention is to provide CD147-shRNA and its application in the preparation of immunotherapeutic drugs, for increasing CCL5 levels and the number of tumor-infiltrating lymphocytes, interfering RNA drugs that synergistically enhance immunotherapy, and their uses.

[0006] The technical solution adopted in this invention is as follows:

[0007] CD147 is used in the preparation of immunotherapy and / or combination immunotherapy drugs.

[0008] A CD147-shRNA, wherein the base sequence of the shRNA is: GCAATCACCAATAGCACTGAA.

[0009] A recombinant lentivirus is obtained by cloning the CD147-shRNA sequence described in this invention into a lentiviral vector.

[0010] The CD147-shRNA described in this invention is used in the preparation of immunotherapeutic drugs.

[0011] The CD147-shRNA described in this invention is used in the preparation of drugs that inhibit tumor growth and / or treat tumors.

[0012] The CD147-shRNA described in this invention is used in the preparation of drugs for treating melanoma and / or lung cancer.

[0013] A drug for inhibiting tumor growth, comprising the CD147-shRNA described in this invention.

[0014] Optionally, it may also contain immunotherapy drugs, including but not limited to PD-1 antibodies, for example, PD-1 antibodies manufactured by BioXcell#BE0273.

[0015] Optionally, the drug can be administered via CD147-shRNA transfection followed by PD-1 antibody injection.

[0016] The CD147 shRNA sequence of this invention can inhibit the expression of the CD147 gene by 80% to 90% compared with control cells, and can upregulate the expression and secretion of CCL5; when combined with PD-1 antibody, it can significantly inhibit tumor growth. Attached Figure Description

[0017] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:

[0018] Figure 1 A diagram showing CD147 mRNA expression detected by qPCR;

[0019] Figure 2 A plot showing the expression level of CD147 protein detected by Western blot;

[0020] Figure 3 A graph showing the CD147 protein expression level detected by flow cytometry;

[0021] Figure 4 A graph showing the expression of CCL5 in cell supernatant detected by ELISA;

[0022] Figure 5 To detect CD8 recruitment in chemotaxis experiments + A graph showing the number of T cells;

[0023] Figure 6 A diagram showing the number of tumor-infiltrating lymphocytes detected by immunohistochemistry;

[0024] Figure 7 The effect of silencing CD147 in conjunction with immunosuppressants on tumor growth. Detailed Implementation

[0025] CD147, a member of the immunoglobulin superfamily, is a type I transmembrane multifunctional protein. CD147 is upregulated in activated T cells and various malignant tumor cells, participating in T cell activation and proliferation, as well as tumor cell migration, adhesion, and invasion. However, whether CD147 affects lymphocyte infiltration by regulating CCL5, and whether targeted intervention on tumor cells with CD147 can synergize with immune checkpoint inhibitors to enhance therapeutic efficacy, have not been reported. Our study found that CD147 expression is upregulated in immune desert tumors and is closely related to tumor progression and immunosuppression, suggesting it may be a potential target for tumor immunotherapy or combination therapy. Currently, there are no reports of the association between silencing CD147 and immunotherapy.

[0026] Explanation of abbreviations in this invention:

[0027] PD-1 (programmed death 1);

[0028] PD-L1 (programmed death-ligand 1);

[0029] CTLA4 (cytotoxic T-lymphocyte antigen 4);

[0030] CCL5 (CC motif chemokine ligand 5);

[0031] CD147 (Cluster of Differentiation 147).

[0032] The inventors of this application have long been engaged in research on tumor immunology and therapy. Their research has found that the CD147 shRNA sequence can effectively reduce the expression of the CD147 gene, upregulate the expression of the chemokine CCL5, increase the number of tumor-infiltrating lymphocytes, and synergistically inhibit tumor growth when combined with immunotherapy. Therefore, CD147 can be used in the preparation of immunotherapies and / or in combination with immunotherapeutic drugs. Potential drugs or application methods that can inhibit CD147 include, but are not limited to, shRNA, siRNA, antibodies, inhibitors, and nucleic acid aptamers; and immunotherapeutic methods that can be combined include, but are not limited to, immune checkpoint inhibitors, CAR-T, TCRT, TILs, and vaccines.

[0033] This invention provides an interfering RNA drug that silences CD147, increases CCL5 levels and the number of tumor-infiltrating lymphocytes, and synergizes with immunotherapy, and its uses. shRNA: GCAATCACCAATAGCACTGAA.

[0034] The shRNA sequence for silencing CD147 gene expression was cloned into a lentiviral vector to obtain recombinant lentiviral particles containing the shRNA sequence. A recombinant lentivirus silencing CD147 expression was constructed, and the resulting recombinant lentivirus was used to infect tumor cells to achieve the goal of silencing CD147 gene expression. The shRNA sequence described above can significantly inhibit the expression of CD147 gene mRNA and protein levels in melanoma and lung cancer cells, increase lymphocyte chemotaxis in vitro, increase the number of tumor-infiltrating lymphocytes in vivo, inhibit tumor growth, and synergistically enhance the anti-tumor efficacy of immunotherapy.

[0035] The advantage of this invention lies in the design of a suitable shRNA sequence targeting CD147 and the construction of a lentiviral vector containing the aforementioned sequence. Efficacy experiments have confirmed that the shRNA constructed in this invention can significantly reduce the mRNA and protein expression levels of CD147, with a very significant knockdown effect. This invention is the first to demonstrate that knockdown of CD147 can upregulate the expression of the chemokine CCL5, increase the number of tumor-infiltrating lymphocytes, and significantly enhance the efficacy of immunotherapy. This suggests that CD147 is a potential target for immunotherapy or combination therapy. Inhibition of CD147 expression in tumor patients with high CD147 expression can be combined with immunotherapy to achieve therapeutic goals. Therefore, the shRNA of this invention can be used to prepare drugs for treating tumors and for synergistic tumor immunotherapy.

[0036] The CD147 shRNA sequence can inhibit the expression of the CD147 gene, downregulating it by 80-90% compared to control cells. It can upregulate the expression and secretion of CCL5. Combined treatment with PD-1 antibodies can significantly inhibit tumor growth.

[0037] Specifically, it includes:

[0038] CD147 is used in the preparation of immunotherapy and / or combination immunotherapy drugs.

[0039] A CD147-shRNA, the base sequence of which is: GCAATCACCAATAGCACTGAA.

[0040] A recombinant lentivirus is obtained by cloning the CD147-shRNA sequence of the present invention into a lentiviral vector.

[0041] The CD147-shRNA of this invention is used in the preparation of immunotherapeutic drugs.

[0042] The CD147-shRNA of the present invention is used for the preparation of drugs that inhibit tumor growth and / or treat tumors.

[0043] The CD147-shRNA of the present invention is used in the preparation of drugs for treating melanoma and / or lung cancer.

[0044] A drug for inhibiting tumor growth, comprising the CD147-shRNA of the present invention.

[0045] Optionally, it may also contain immunotherapy drugs, such as PD-1 antibodies, manufactured by BioXcell.

[0046] #BE0273.

[0047] Optionally, the drug can be administered via CD147-shRNA transfection followed by PD-1 antibody injection.

[0048] I. Gene Synthesis and Viral Vector Construction:

[0049] 1. Sequence design:

[0050] Based on the CD147 sequence, specific CD147 silencing sequences were designed using appropriate software from Invitrogen's website and synthesized using existing techniques. Using the CD147 CDS sequence (NM_001077184.1) as a basis, CD147 shRNA sequences were designed from Invitrogen's website. The selected fragments were BLAST-aligned, and the sequences specifically recognizing CD147, shCD147#1 (CCTGGTGTTGGTTACCATCAT) and shCD147#5, were selected.

[0051] (GCAATCACCAATAGCACTGAA). A professional company was commissioned to ligate the above two target sequences and the control nonsense sequence (CCTAAGGTTAAGTCGCCCTCG) to the vector;

[0052] 2. Conversion and Validation:

[0053] 1) Add the plasmid vector containing the DNA fragment to competent TOP10 E. coli (Tiangen, #CB104-02) (100 μl of competent TOP10 E. coli with 100 ng of DNA), mix well and incubate on ice for 30 minutes;

[0054] 2) Place the centrifuge tubes in a 42°C water bath for 90 seconds, then quickly transfer them to ice and let them stand for 2 minutes.

[0055] 3) Add 200 μl of LB medium to the centrifuge tube and incubate at 37°C and 220 rpm for 45 minutes on a shaker.

[0056] 4) Spread the transformed TOP10 E. coli from the centrifuge tubes onto LB plates;

[0057] 5) Invert the plate and incubate it overnight in a 37°C incubator;

[0058] 6) Randomly select single colonies and incubate them overnight on a shaker at 37°C and 220 rpm. Take 5 ml of the bacterial solution and send it to the company for sequencing verification.

[0059] 3. Plasmid extraction: Plasmids were extracted using the endotoxin-free plasmid large-scale extraction kit (Tiangen, #DP117);

[0060] 4. Lentiviral packaging:

[0061] 1) The extracted target plasmid (shCD147#1 or shCD147#5) and viral packaging helper plasmids pMD2.G and psPAX2 were transfected into 293FT cells using Lipo3000 (ThermoFisher, #L3000015);

[0062] 2) Collect the cell supernatant 24 h after transfection, filter it through a 0.22 μm filter membrane, and add it to the cells to be infected. 293FT cells are supplemented with culture medium and cultured for a longer period of time. Repeat this process 2-3 times.

[0063] 5. Detection of target gene silencing efficiency: After infection, the target gene was silenced using a solution containing 1 μg / ml puromycin (InvivoGen, #).

[0064] Positive cells were screened using ant-pr-1 culture medium. shCD147 cells with high silencing efficiency were screened using qPCR and Western blot assays, with results as follows: Figure 1 and Figure 2 The results showed that shCD147#5 had a higher silencing efficiency for CD147 expression in B16-F10 and LLC cells compared to shCD147#1.

[0065] II. qPCR detection of CD147 mRNA expression levels in different cell lines

[0066] 1. Melanoma B16-F10 cells and lung cancer LLC cells in logarithmic growth phase were seeded in six-well plates;

[0067] 2. When the cells reached 80% confluence, total RNA was extracted from each group of cells using the TRIzol method;

[0068] 1) Add 1 ml of Trizol solution (ThermoFisher, #15596026) to each six-well plate, quickly covering the entire plate. Use a pipette to aspirate the Trizol solution and pipette the cells from the plate, mixing thoroughly. Transfer the mixture to a 1.5 ml EP tube.

[0069] 2) Add 200 μl of chloroform solution to the EP tube, mix thoroughly, let stand at room temperature for 10 minutes, and centrifuge at 12000 rpm for 15 minutes at 4°C.

[0070] 3) Take the supernatant, add an equal volume of isopropanol, mix thoroughly, let stand at room temperature for 10 minutes, and centrifuge at 12000 rpm for 10 minutes at 4℃.

[0071] 4) Discard the supernatant, add 1 ml of 70% ethanol to wash the precipitate, and centrifuge at 12000 rpm for 5 minutes at 4°C.

[0072] 5) Discard the supernatant, air-dry the precipitate at room temperature, add an appropriate amount of RNAse-free H2O to dissolve it, and measure the RNA purity and concentration using a multi-functional microplate reader.

[0073] 3. Reverse transcription reaction

[0074] 1) RNA was reverse transcribed into cDNA using the PrimeScript RT Master Mix kit (Takara, #RR036A);

[0075] 2) The reaction system is as follows:

[0076]

[0077] 3) Set the reaction program: 37℃ for 15 min, 85℃ for 5 s, 4℃∝. After the reaction is complete, transfer the cDNA to -20℃ for storage.

[0078] 4. Quantitative Real-Time PCR

[0079] 1) The reaction system is as follows:

[0080]

[0081] 2) Set the reaction program: pre-denaturation: 95℃ for 15s; PCR: 55℃ for 30s, 72℃ for 30s, 40 cycles.

[0082] 3) Primer sequences related to gene expression detection

[0083]

[0084] Experimental results are as follows Figure 1As shown (shMOCK represents the control shRNA, given randomly and without any target), the mRNA level of CD147 was detected by real-time PCR. It was found that the CD147 shRNA #5 sequence could significantly silence the mRNA level of CD147 in B16-F10 and LLC cells.

[0085] III. Western blot detection of CD147 protein expression levels in different cell lines

[0086] 1. Melanoma and lung cancer cell lines in logarithmic growth phase were seeded into six-well plates;

[0087] 2. When the cells have grown to 80%, aspirate and discard the culture medium, wash twice with pre-cooled PBS, add RIPA lysis buffer (Beyotime, #P0013K), scrape the cells with a cell scraper, transfer the total cell protein to a clean EP tube, centrifuge at 13200 rpm for 10 minutes at 4°C, transfer the supernatant to a new EP tube, and quantify the protein using the BCA method.

[0088] 3. Prepare the working solution by mixing solution A and solution B at a ratio of 1:50 according to the BCA kit (ThermoFisher, #23225) instructions. Add 8 μl of the protein sample to a 96-well plate, add 200 μl of the working solution, and let stand for 30 minutes. Measure the absorbance of the protein sample at 562 nm using a multi-mode microplate reader, and calculate the protein concentration based on the standard curve.

[0089] 4. SDS-PAGE electrophoresis.

[0090] 1) Wash the glass plate and comb, let them dry, and then install them.

[0091] 2) Prepare 12% separating gel

[0092]

[0093] 3) Add the separating gel between the glass plates, flatten the liquid surface with anhydrous ethanol or ddH2O, and wait for solidification at room temperature.

[0094] 4) After the separating gel solidifies, discard the anhydrous ethanol or ddH2O and blot off the excess liquid with filter paper.

[0095] 5) Prepare the concentrated gel

[0096]

[0097] 6) Add the stacking gel to the separating gel, immediately insert the comb, and wait for it to solidify at room temperature.

[0098] 7) After the stacking gel solidifies, remove the comb and fix the gel in the electrophoresis tank. Add an appropriate amount of electrophoresis solution to the electrophoresis tank.

[0099] 8) Load 40 μg of protein sample. Set the voltage to 80 V for electrophoresis. After the sample enters the separating gel, change the voltage to 100 V until the protein sample migrates to the bottom of the separating gel.

[0100] 5. Immunoblot analysis assay

[0101] 1) Cut a PVDF membrane to the appropriate size, immerse it in methanol solution for 1 minute to activate it, and then place it in the transfer solution.

[0102] 2) After SDS-PAGE, remove the gel and place it in transfer buffer. Unfold the transfer clamp, black side down, and place the sponge, filter paper, gel, PVDF membrane, filter paper, and sponge in sequence. Use a glass rod to remove air bubbles between the layers and secure the transfer clamp. Place the transfer clamp in an electrophoresis tank filled with transfer buffer, cover, add some crushed ice, and incubate at 220mA for 150 minutes.

[0103] 3) Remove the PVDF membrane and transfer it to a box containing 5% skim milk. Incubate on a shaker for 60 minutes.

[0104] 4) Quickly wash the PVDF membrane three times with PBST on a shaker for 5 minutes each time. Transfer the PVDF membrane to an incubator with primary antibody and incubate overnight at 4°C.

[0105] 5) On the second day, use PBST to quickly wash the PVDF membrane three times on a shaker for 5 minutes each time.

[0106] 6) Transfer the PVDF membrane to an incubation box containing secondary antibody and incubate at room temperature for 60 minutes.

[0107] 7) Quickly wash the PVDF membrane three times with PBST on a shaker for 5 minutes each time.

[0108] 6. ECL chemiluminescence and film exposure

[0109] 1) Prepare the ECL luminescent solution (Fdbio, #FD8000) according to the instructions. The ratio of solution A to solution B is 1:1. Mix the luminescent solution with the membrane thoroughly and react for 1 minute. Place the membrane in the chemiluminescence imaging instrument, select the exposure time, and then observe and take pictures.

[0110] Experimental results are as follows Figure 2 As shown, the expression level of CD147 was detected by Western blot, and it was found that the CD147 shRNA#5 sequence could significantly silence the protein level of CD147 in B16-F10 and LLC cells.

[0111] IV. Flow cytometry detection of CD147 expression level on cell membrane surface

[0112] 1) Melanoma and lung cancer cell lines in logarithmic growth phase were seeded into six-well plates;

[0113] 2) When the cells have grown to 80%, discard the culture medium, wash twice with PBS, add 1 ml of trypsin, and incubate at 37°C for 1 min.

[0114] 3) Add 3 ml of complete culture medium to stop digestion, pipette the cells to a new 15 ml centrifuge tube, centrifuge at 800 rpm for 5 minutes, and discard the supernatant. Wash twice with PBS, centrifuge at 800 rpm for 5 minutes, and discard the supernatant.

[0115] 4) Add an appropriate amount of PBS to dilute the cell suspension to 1x10⁻⁶. 7 / ml, dispensed 100μl into each flow cytometry tube, added CD147 antibody (R&D, #AF772), incubated on ice in the dark for 30 minutes, washed twice with PBS, added 400μl of PBS, and detected fluorescence intensity. Quantitative analysis of the results was performed using FlowJo software.

[0116] Experimental results are as follows Figure 3 As shown, the expression level of CD147 on the surface of tumor cell membrane was detected by flow cytometry, and it was found that the CD147 shRNA#5 sequence could significantly silence the expression of CD147 on the cell membrane of two types of tumor cells.

[0117] V. Enzyme-linked immunosorbent assay (ELISA) to detect the expression level of CCL5 in cell supernatant

[0118] 1) Inoculate tumor cells into 100 mm culture plates containing complete culture medium.

[0119] 2) After the cells have adhered, replace the complete culture medium with serum-free culture medium.

[0120] 3) After 24 hours, collect the culture medium and centrifuge at 2000 rpm for 10 minutes at 4°C to remove suspended cells or cell debris.

[0121] 4) The expression level of CCL5 in the cell supernatant was detected by ELISA kit (MULTI Sciences, #EK2129 / 2-96).

[0122] Experimental results are as follows Figure 4 As shown, the expression level of CCL5 in the culture supernatant of tumor cells was detected by ELISA, and it was found that the CD147 shRNA#5 sequence could significantly promote the secretion of CCL5 by two types of tumor cells.

[0123] VI. CD8 + T cell chemotaxis assay

[0124] 1.CD8 +T cell isolation and activation

[0125] 1) Spleen was collected after euthanasia of the animal, based on the CD8+ of EasySep mice. + T-cell isolation kit (STEMCELL, #19853) instructions for isolating and purifying CD8 cells from mouse spleen. + T cells.

[0126] 2) CD8 cells isolated and activated using a T-cell activation / expansion kit (Miltenyi Biotec, #130-093-627) + T cells, CD8 fragments isolated by stimulation with anti-CD3 and anti-CD28 binding magnetic beads. + T cells were then transferred to RPMI-1640 medium containing 10% FBS and 100 U / mL recombinant mouse IL-2 (Biolegend, #575402) and cultured at 37°C and 5% CO2 for 48 hours.

[0127] 2.CD8 + T cell chemotaxis assay

[0128] 1) Chemotaxis analysis was performed in a 24-well chamber with 5 μm pores, and activated CD8 was used. + T cells were added to the upper chamber of a 5 μm well transwell plate. Tumor cell conditioned medium was added to the lower chamber. The plates were incubated at 37°C for 12 hours. The contents of the lower chamber were collected, and the number of CD8 cells migrating in the lower chamber was quantified using a cell counting chamber. + T cells.

[0129] Experimental results are as follows Figure 5 As shown, via CD8 + Chemotaxis experiments with T cells revealed that the CD147 shRNA#5 sequence significantly enhanced the induction of CD8+ by tumor cells. + The chemotactic capacity of T cells.

[0130] VII. Immunohistochemical staining method for detecting the number of tumor-infiltrating lymphocytes

[0131] 1) Incubate paraffin sections at 45℃ for 2 hours. Dewax for 15 minutes, twice. Gradient ethanol hydration: anhydrous ethanol for a few seconds, twice; 95% ethanol for a few seconds; 75% ethanol for a few seconds; ddH2O for a few seconds.

[0132] 2) Inactivate endogenous enzymes: Add 3% H2O2 and incubate at room temperature for 15 minutes.

[0133] 3) Heat repair antigen: Add antigen repair solution, microwave on high for 15 minutes, thaw for 2 minutes, microwave on medium-low for 20 minutes, and let it cool naturally.

[0134] 4) Wash the sections with PBST for 5 minutes, 3 times, on a shaker. Shake the sections dry, draw circles with an immunohistochemistry pen, add 50 μl of 5% BSA, and incubate at room temperature for 30 minutes. Add CD3 antibody (Invitrogen, #11-0032-82) and incubate overnight at 4°C.

[0135] 5) Wash the slides with PBST for 5 minutes, 3 times, on a shaker. Shake the slides dry, add 50 μl of secondary antibody (ZSGB-BIO, #PV-6001), and incubate at room temperature for 60 minutes. Wash the slides with PBST for 5 minutes, 3 times, on a shaker, and shake dry.

[0136] 6) Add DAB solution (ZSGB-BIO, #ZLI-9019) for color development. After sufficient color development, rinse in tap water for 20 minutes.

[0137] 7) Counterstain with hematoxylin for 30 seconds, rinse with tap water, and differentiate with 95% hydrochloric acid alcohol for 3 seconds.

[0138] 8) Gradient ethanol dehydration: 60% ethanol for a few seconds; 80% ethanol for a few seconds; anhydrous ethanol for a few seconds.

[0139] 9) After drying at 45℃, add neutral resin to seal the slide, and observe and photograph it under a microscope after air drying.

[0140] Experimental results are as follows Figure 6 As shown, immunohistochemical staining revealed that the CD147 shRNA#5 sequence significantly increased the infiltration of T lymphocytes in tumor tissue.

[0141] 8. Combination therapy of CD147 shRNA sequence with PD-1 antibody for tumor-bearing mice

[0142] C57BL / 6J mice (male, 6-8 weeks old, weighing 20-24g) (Beijing Vital River) were housed under SPF conditions and randomly divided into two groups. Control cells and CD147 shRNA#5-treated B16-F10 cells were subcutaneously injected into the right back of C57BL / 6 mice (cell count 5×10⁻⁶). 5 ( / mouse). Seven days later, once the tumors were palpable, mice were randomly divided into two groups, receiving intraperitoneal injections of 100 μg PD-1 antibody / control antibody, respectively. Tumor diameter was measured every 3 days using calipers, and tumor volume was calculated as length * width * width * 3.14 / 6. Mice were sacrificed 20 or 25 days after tumor inoculation, and the tumors were removed. All animal experimental procedures were approved by the Laboratory Animal Ethics Committee of Southern University of Science and Technology.

[0143] Experimental results are as follows Figure 7As shown in the figure, iso represents the isotype control antibody InVivoMAb rat IgG2a isotype control (manufacturer: BioXcell). The CD147 shRNA#5 sequence combined with PD-1 antibody can synergistically inhibit the growth of mouse tumors in vivo.

[0144] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0145] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0146] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. The application of CD147-shRNA in the preparation of drugs for treating melanoma, wherein the base sequence of the shRNA is: GCAATCACCAATAGCACTGAA.

2. A drug for inhibiting melanoma growth, characterized in that, It contains the CD147-shRNA of claim 1, and also contains the immunotherapeutic drug PD-1 antibody.

Images