The loci of InDel related to essential amino acid accumulation in rice OsAUX5 gene and its application

Abstract

The invention provides an InDel site related to the accumulation of essential amino acids in rice in the OsAUX5 gene of rice and an application thereof. The InDel site is located at the 3344946th position of the 11th chromosome of the rice genome, the sequence is shown in SEQ ID NO.1, and the allele is a deletion of the sequence shown in SEQ ID NO.2. The invention separates and clones the OsAUX5 protein that controls the essential amino acid content of rice endosperm, identifies the InDel site related to the essential amino acid content of rice in the promoter region of the OsAUX5 gene, and finds that overexpressing the OsAUX5 gene can significantly enhance the essential amino acid content of rice, and the essential amino acid content of mature rice of the transgenic positive plant is significantly higher than that of the wild type. The excellent OsAUX5 allele type is introduced into a conventional rice variety by hybridization, and the transgenic plant or hybrid offspring can accumulate essential amino acids in rice.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology, and particularly relates to an InDel site in the rice OsAUX5 gene related to the accumulation of essential amino acids in rice and an application thereof. Background Art

[0002] Essential amino acids are a class of amino acids that the human body cannot synthesize on its own or cannot synthesize at a sufficient rate to meet its needs and must be obtained from food. They are key components of the nutritional value of food protein. People primarily consume essential amino acids from animal and plant proteins, but excessive reliance on meat can lead to complications such as hypertension, hyperlipidemia, and coronary heart disease. Increasing the essential amino acid content by modifying the composition of plant protein is an important approach to addressing this issue.

[0003] Rice is a staple food for over half of the world's population. Improving the essential amino acid content of rice is crucial for enhancing human nutrition and health. Currently, methods for increasing the essential amino acid content of rice typically involve selecting different varieties or improving cultivation techniques. However, few high-quality varieties with high essential amino acid content have been bred commercially. Improving the essential amino acid content of rice through cultivation techniques and the natural environment is complex and significantly affected by both human and natural factors.

[0004] The essential amino acid content trait of rice is a typical quantitative genetic trait. Genome-wide association study (GWAS) is an effective method for identifying complex quantitative traits. In recent years, this method has been used to discover some quantitative trait loci (QTLs) that control the essential amino acid content of rice. However, the key genes controlling these QTLs have not yet been cloned, and the true effect of these QTLs on the essential amino acid content of rice cannot be determined. Insertion / deletion (InDel) molecular markers refer to the differences between two parents in the whole genome. Compared with the other parent, there is a certain number of nucleotide insertions or deletions in the genome of one parent. Based on the insertion / deletion sites in the genome, primers for amplifying these insertion / deletion sites can be designed. PCR amplification can be used to assist in the breeding of different varieties of plants. Therefore, cloning the key genes that control the essential amino acid content of rice has great application prospects for improving the nutritional quality of rice. Summary of the Invention

[0005] The first object of the present invention is to provide an InDel site in the promoter region of the rice OsAUX5 gene that is significantly associated with the accumulation of essential amino acids in rice. The InDel site is located at position 3344946 of chromosome 11 of the rice genome, and its nucleotide sequence is shown in SEQ ID NO.1. The allele is a deletion of the nucleotide sequence shown in SEQ ID NO.2.

[0006] A second object of the present invention is to provide an InDel site detection reagent, comprising a primer pair for detecting the allele type of the InDel site as shown in SEQ ID NO. 1; the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 3 and a downstream primer as shown in SEQ ID NO. 4.

[0007] A third object of the present invention is to provide a method for identifying rice varieties with high or low essential amino acid content, comprising the following steps:

[0008] (1) Extracting DNA from rice to be identified;

[0009] (2) using the extracted DNA as a template, performing PCR amplification using a primer pair; the primer pair includes an upstream primer as shown in SEQ ID NO. 3 and a downstream primer as shown in SEQ ID NO. 4;

[0010] (3) The insertion / deletion polymorphism in the promoter region of the rice OsAUX5 gene was identified based on agarose gel electrophoresis of the PCR amplification product. If a band was amplified, the rice variety to be identified had a low level of essential amino acids; if no band was amplified, the rice variety to be identified had a high level of essential amino acids.

[0011] A fourth object of the present invention is to provide a rice plant with high essential amino acids, comprising the following steps: extracting rice RNA and reverse transcribing it into cDNA, amplifying the OsAUX5 gene coding region using a primer pair by PCR, wherein the nucleotide sequence of the coding region is SEQ ID NO. 7; the primer pair comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 5 and a downstream primer as shown in SEQ ID NO. 6; constructing the OsAUX5 gene coding region into an expression vector; and then transforming the expression vector into a rice plant with a low essential amino acid content to obtain an OsAUX5 overexpressing plant, i.e., a rice plant with high essential amino acids.

[0012] A fifth object of the present invention is to provide a rice plant with high essential amino acids, comprising introducing the OsAUX5 gene of a rice plant with high essential amino acids into a rice plant with low essential amino acids, thereby obtaining a transgenic rice plant containing the OsAUX5 allele. The nucleotide sequence of the OsAUX5 gene of the rice plant with high essential amino acids is shown in SEQ ID NO.17.

[0013] A sixth object of the present invention is to provide a rice plant with a high essential amino acid content, comprising the following steps: performing gene editing on position 3344946 of rice chromosome 11 as the target region, wherein the mutated OsAUX5 gene is mutated to knock out the nucleotide sequence shown in SEQ ID NO. 2, and obtaining homozygous plants from the self-pollinated progeny of the gene-edited plants; the homozygous plants are rice plants with a high essential amino acid content.

[0014] The seventh object of the present invention is to provide a gene chip for detecting the InDel site, comprising the detection reagent.

[0015] An eighth object of the present invention is to provide a kit for detecting the aforementioned InDel site, comprising the aforementioned detection reagent. Furthermore, the kit is used to identify rice varieties with high or low essential amino acid content. Furthermore, the kit also comprises another primer pair for detecting the T allele at the aforementioned InDel site. Furthermore, the kit also comprises an amplification buffer, a dNTP mix, a DNA polymerase, and ddH2O.

[0016] The ninth objective of the present invention is to provide the application of the InDel site in molecular breeding.

[0017] The tenth object of the present invention is to provide the application of the InDel site in variety identification and protection.

[0018] The eleventh object of the present invention is to provide the application of the InDel site in the identification of hybrid offspring.

[0019] The twelfth object of the present invention is to provide the application of the InDel site in the location of important trait genes.

[0020] The present invention utilizes multiple rice germplasm resources and, through GWAS, isolates and clones an amino acid transporter, OsAUX5, that controls essential amino acids in rice endosperm. Simultaneously, an InDel site significantly associated with rice essential amino acid content was identified within the OsAUX5 gene promoter region, and amplification primer pairs were designed based on the InDel site. The present invention also discovered that introducing the nucleotide sequence of the OsAUX5 gene coding region into recipient rice varieties is of great significance for increasing the essential amino acid content of rice. Overexpression of the OsAUX5 gene can significantly enhance the essential amino acid content of rice, with transgenic plants exhibiting significantly higher essential amino acid content than wild-type plants. The present invention transfers a high-essential amino acid allele (T) into a low-essential amino acid allele (TCACATATACATTTGTCGA), enhancing the essential amino acid content of low-genotype rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a graph showing the essential amino acid content in 195 different rice varieties in Example 1.

[0022] Figure 2 This is the map of the gene OsAUX5 that controls the accumulation of essential amino acids in rice identified using the GWAS method in Example 2.

[0023] Figure 3 The diagram shows the gene structure of OsAUX5 in Example 3, InDel location information, and genotype analysis of japonica and indica rice.

[0024] Figure 4 This is the expression level detection of japonica rice and indica rice in Example 4.

[0025] Figure 5 This is the plasmid map in Example 5.

[0026] Figure 6 This is the detection of the expression level of OsAUX5 in the OsAUX5 overexpressing plants in Example 5.

[0027] Figure 7 This is the determination of amino acid content in OsAUX5 overexpressing rice plants in Example 6.

[0028] Figure 8 This is the identification of the InDel marker in the rice OsAUX5 promoter region in Example 7.

[0029] Figure 9 This is the plasmid map in Example 8.

[0030] Figure 10 This is the determination of the essential amino acid content in rice plants introduced with a high content of the OsAUX5 allele in Example 9. DETAILED DESCRIPTION

[0031] The present invention is further defined in the following examples. Based on the following description and these examples, those skilled in the art can ascertain the essential characteristics of the present invention and, without departing from the essence and scope of the present invention, can make various changes and modifications to the present invention to adapt it to various uses and conditions.

[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0033] Indica and japonica rice are the two main subspecies of cultivated rice in Asia. They have gradually differentiated through natural selection and artificial selection during long-term cultivation and domestication. Indica and japonica rice have obvious genetic differences, and there are significant differences in their agronomic morphology and physiological and biochemical characteristics.

[0034] The following examples relate to the isolation and cloning of OsAUX5 and the identification of superior alleles, and illustrate the application mechanism of this fragment.

[0035] Example 1: Determination of essential amino acid content in indica and japonica rice varieties.

[0036] A total of 195 rice varieties, including 100 indica rice varieties and 95 japonica rice varieties, were planted in the same field. The mature rice was dried at 60°C, shelled, and ground into rice flour. The rice flour was sieved and the amino acid content was determined using a tandem mass spectrometry system (ABSCI EXQTRAP6500). Figure 1 As shown in the results, indica rice varieties showed higher essential amino acid contents than japonica rice varieties, including valine, leucine, phenylalanine and threonine.

[0037] Example 2: Identification of the gene OsAUX5 that regulates the essential amino acid content in rice.

[0038] Using the rice genome-wide SNP information in the RiceVarMap database (http: / / ricevarmap.ncpgr.cn / ) and the determined essential amino acid content of rice, GWAS was used to identify QTL loci that control the essential amino acid content of rice. Figure 2 As shown, the OsAUX5 gene locus was significantly associated with the essential amino acid content (valine, leucine and phenylalanine).

[0039] Example 3: Variation of the OsAUX5 gene promoter region in indica and japonica rice.

[0040] The amino acid transporter OsAUX5 (RAP-DB accession number: Os11g0169200) was used to analyze the nucleotide sequence variation of the OsAUX5 promoter region using 195 cultivated rice genome data from the RiceVarMap database.

[0041] Sequence analysis showed that there is an InDel site in the OsAUX5 promoter region of indica and japonica rice, located at position 3344946 of rice chromosome 11. The InDel site causes sequence variation between indica and japonica rice subspecies, and its polymorphism is T / TCACATATACATTTGTCGA. Figure 3 As shown, the 3344946th base on chromosome 11 of indica rice is T, and the 3344946th base on chromosome 11 of japonica rice is TCACATATACATTTGTCGA.

[0042] Example 4: Detection of OsAUX5 gene expression in indica and japonica rice varieties.

[0043] RNA was extracted from 50 rice samples and reverse transcribed into cDNA, 25 each from indica and japonica rice. The obtained cDNA was used as a template to detect the expression level of OsAUX5 gene using the upstream primer shown in SEQ ID NO.11 and the downstream primer shown in SEQ ID NO.12. The detection results are shown in Figure 2. Figure 4 As shown, indica rice varieties express higher levels than japonica rice varieties, indicating that superior OsAUX5 alleles can be used for molecular marker development for rice varieties with high amino acid accumulation. The sequence CACATATACATTTGTCGA is found at position 3344946 on chromosome 11 of japonica rice varieties, and the flanking sequences are shown in SEQ ID NO. 9. The sequence T is found at position 3344946 on chromosome 11 of indica rice varieties, and the flanking sequences are shown in SEQ ID NO. 10.

[0044] F: 5'-TACCTCATCAGCGTGCTCTA-3' (SEQ ID NO.11)

[0045] R: 5'-ACCACTGGATGACATGGTTG-3' (SEQ ID NO.12)

[0046] AATTTTTTGAGGTCACATATACATTTGTCGACAACTTTTCTTC(SE Q ID NO.9)

[0047] AATTTTTTGAGGTCAACTTTTCTTC(SEQ ID NO.10)

[0048] Example 5: Creation and identification of OsAUX5 overexpressing plants.

[0049] The creation includes constructing an OsAUX5 overexpression genetic transformation vector, and obtaining OsAUX5 overexpression rice through an Agrobacterium-mediated rice genetic transformation system. Specifically, RNA of japonica rice varieties is extracted, reverse transcribed into cDNA, the obtained cDNA is used as a template, and a primer pair is used to amplify the OsAUX5 coding region of japonica rice, as shown in SEQ ID NO.7, and the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer as shown in SEQ ID NO.6. KODFX (Toyobo) PCR enzyme is used for amplification, the annealing temperature is 58°C, the extension time is 1min and cycled 35 times, and the target gene containing the sequence shown in SEQ ID NO.7 is connected to the expression vector pJC034 using the gateway system, and the correct sequencing is carried out. Figure 5The expression vector in was transformed into Agrobacterium tumefaciens AH109 by electroporation. The amino acid sequence of the encoded protein is shown in SEQ ID NO. 8. Example 5 The expression vector was transformed into japonica rice variety ZH11 using rice transgenic technology to obtain OsAUX5 overexpressing plants OsAUX5-OE1 and OsAUX5-OE2.

[0050] F: 5'-AAAAAGCAGGCTTAATGGCGTCGGAGAAGGT-3' (SEQ IDNO.5)

[0051] R: 5'-AGAAAGCTGGGTAATGCAATTATGCAACAG-3' (SEQ ID NO.6)

[0052] The primers for identifying OsAUX5 transgenic plant lines are the upstream primer of SEQ ID NO.11 and the downstream primer of SEQ ID NO.12.

[0053] F: 5'-TACCTCATCAGCGTGCTCTA-3' (SEQ ID NO.11)

[0054] R: 5'-ACCACTGGATGACATGGTTG-3' (SEQ ID NO.12)

[0055] The results of real-time fluorescence quantitative PCR analysis were as follows: Figure 6 As shown, the expression levels of OsAUX5-OE1 and OsAUX5-OE2 overexpressing OsAUX5 were significantly increased compared with that of OsAUX5.

[0056] Example 6: Determination of essential amino acid content in OsAUX5 overexpressing transgenic lines.

[0057] The mature seeds of the OsAUX5 overexpressing transgenic strain obtained in Example 5 were dried and shelled, and then ground into powder. The essential amino acid content was determined using a tandem mass spectrometry system (ABSCI EXQTRAP 6500). The results are as follows: Figure 7 As shown: The essential amino acid content in rice in the OsAUX5 overexpressing transgenic lines OsAUX5-OE1 and OsAUX5-OE was significantly increased compared with ZH11.

[0058] Example 7: Application of molecular marker sites related to the rice essential amino acid accumulation gene OsAUX5.

[0059] The rice genomic DNA to be tested was used as a template, and the rice OsAUX5 gene was amplified by PCR using the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.4. The PCR amplified fragment was then subjected to agarose gel electrophoresis. The insertion / deletion polymorphism of the rice OsAUX5 gene was identified based on the agarose gel electrophoresis results. Figure 8 As shown: if a band is amplified, the rice essential amino acid of the rice variety to be identified is low; if no band is amplified, the rice essential amino acid of the rice variety to be identified is high.

[0060] F: 5'-AGTTGTCGACAAATGTATATGTGAC-3' (SEQ ID NO.3)

[0061] R: 5'-GACGCTCGTCGATTTGTACTG-3' (SEQ ID NO.4)

[0062] Example 8: The high-content allele type (T) was transferred into the low-content genotype (TCACATATACATTTGTCGA) plant.

[0063] The invention comprises constructing a genetic transformation vector of a high-content allele type of OsAUX5, and obtaining a rice line of a high-content allele type of OsAUX5 through an Agrobacterium-mediated rice genetic transformation system. First, DNA of indica rice (Zhenshan 97B variety) is extracted as a template, and then the OsAUX5 gene of indica rice as shown in SEQ ID NO.17 is amplified by PCR using primers. KODFX (Toyobo) PCR enzyme is used for amplification, the annealing temperature is 58°C, the extension time is 3 minutes and 35 cycles are repeated, and the amplification uses the upstream primer as shown in SEQ ID NO.13 and the downstream primer as shown in SEQ ID NO.14. The amplified fragment is connected to the expression vector pJE009 using the gateway system, as shown in FIG. Figure 9 The correctly sequenced expression vector was electroporated into Agrobacterium tumefaciens AH109, ​​and then transformed into the japonica rice variety ZH11 using rice transgenic technology, generating rice lines with a high-content OsAUX5 allele. Vector insertion was verified, and amplification was performed using the upstream primer shown in SEQ ID NO. 15 and the downstream primer shown in SEQ ID NO. 16. Plants that amplified a band were identified as transgenic-positive.

[0064] F: 5'-AAAAAGCAGGCTTACTGGTACCAGTAGTGGAGACTCG-3' (SEQ ID NO.13)

[0065] R: 5'-AGAAAGCTGGGTACTAGTGTCTTGGAGGGCACTGG-3' (SE Q ID NO.14)

[0066] F: 5'-GAGAGAGATAGATTTGTAGAGAG-3' (SEQ ID NO.15)

[0067] R: 5'-ATGGCGTCGGAGAAGGTGG-3' (SEQ ID NO.16)

[0068] In the present invention, the excellent OsAUX5 genotype is introduced into conventional cultivars through hybridization. The transgenic plants or hybrid offspring can accumulate essential amino acids in the rice endosperm, thereby improving the nutritional quality of rice and meeting people's demand for essential amino acids.

[0069] Example 9: Determination of essential amino acid content in transgenic rice lines carrying a high-content OsAUX5 allele.

[0070] The mature seeds of the rice strain with high OsAUX5 allele obtained in Example 8 were dried and shelled, and then ground into powder. The essential amino acid content was determined using a tandem mass spectrometry system (ABSCI EXQTRAP6500). The results are as follows: Figure 10 As shown: The essential amino acid content in rice lines with high-content OsAUX5 alleles was significantly increased compared with japonica rice ZH11.

[0071] Example 10: Gene editing was performed on position 3344946 of chromosome 11 of rice. After mutation, the OsAUX5 gene was mutated to knock out the sequence of SEQ ID NO. 2. Homozygous gene-edited plants were obtained from the self-pollinated progeny of the gene-edited plants. The homozygous gene-edited plants were rice plants with a high content of essential amino acids.

[0072] The above examples demonstrate that OsAUX5 is a key amino acid transporter gene in rice. Overexpression of the OsAUX5 gene can significantly increase the essential amino acid content of rice. Furthermore, introducing the OsAUX5 genotype from an indica rice variety into a japonica rice variety can increase the essential amino acid content of the japonica rice variety. Therefore, by growing rice varieties that overexpress OsAUX5 or its superior alleles, the human body's essential amino acid needs can be met, thereby improving the nutritional quality of rice.

[0073] Although embodiments of the present invention have been shown and described above, it will be understood that the embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and vary the embodiments within the scope of the present invention.

Claims

1. A detection reagent, characterized in that: The detection reagent comprises a primer pair, and the primer pair is used to detect rice OsAUX5 The allele type of the InDel site on the gene promoter region that is significantly related to the accumulation of essential amino acids in rice is shown in SEQ ID NO.1; the primer pair includes an upstream primer with a nucleotide sequence shown in SEQ ID NO.3 and a downstream primer shown in SEQ ID NO.

4.

2. A method for identifying rice varieties with high or low essential amino acid content, characterized in that: The steps include: (1) Extracting DNA from rice to be identified; (2) using the extracted DNA as a template and performing PCR amplification using a primer pair; the primer pair includes an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4; (3) Identification of rice based on agarose gel electrophoresis of PCR amplification products OsAUX5 Insertion / deletion polymorphism in the gene promoter region, if a band is amplified, the rice variety to be identified is low in essential amino acids; If no band is amplified, the rice variety to be identified is high in essential amino acids.

3. The detection reagent according to claim 1 is used in one or more of the following: (1) Application in rice molecular breeding; the application is to cultivate rice plants with high essential amino acids; (2) Application in rice variety identification and protection; the application is the identification of rice varieties with high or low essential amino acid content.

4. A gene chip, characterized in that: Contains the detection reagent as claimed in claim 1.

5. A kit, characterized in that: Contains the detection reagent as claimed in claim 1.

Images