A microsporum polytrichomonas fungi that promotes the growth of Dendrobium officinale and its application

Abstract

The invention discloses a microspore pseudodisk multi-hairy spore for promoting the growth of Dendrobium officinale and its application. The classification name is Pestalotiopsis microspora, the classification position is Ascomycota, Coelosporales, Black disc order (family), and the genus Pestalotiopsis. The strain number is JSNLSHGS‑13, and it has been preserved in the General Microbiological Center of China Microbiological Culture Collection Committee, with a preservation number of CGMCC NO.18543 and a preservation date of September 2, 2019. The microspore pseudodisk multi-hairy spore Pestalotiopsis microspora strain JSNLSHGS‑13 of the present invention has a significant effect on promoting the growth of Dendrobium officinale seedlings, and has a certain effect on reducing the application of chemical fertilizers; at the same time, it can be artificially cultivated, which is convenient for large-scale production and has good development and application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a microsporic polytrichosporium capable of promoting the growth of Dendrobium officinale and an application thereof. Background Art

[0002] At present, the market demand for Dendrobium candidum mainly relies on artificial cultivation, but the growth rate of artificially cultivated Dendrobium candidum is slow. In order to pursue yield, people abuse pesticides and fertilizers, resulting in low quality, high pesticide residues, and food safety incidents. Based on this, researchers have gradually turned the research direction of fertilizer and drug use in the production and cultivation of Dendrobium candidum to microbial resources. Since Dendrobium belongs to the orchid family, it needs to coexist with fungi to complete its entire life history. There are many types of Dendrobium in nature, and its mycorrhizal fungal resources are also rich, which provides a wealth of microbial resources for research for the majority of researchers. How to screen out mycorrhizal agents with significant effects to further promote the growth of Dendrobium candidum has become an important direction for the research and development of the Dendrobium candidum industry. Summary of the invention

[0003] Purpose of the invention: In view of the shortcomings and defects of the prior art, one of the purposes of the present invention is to provide a mycorrhizal fungus, Pestalotiopsis microspora, which has a significant growth-promoting effect on the cultivation of Dendrobium officinale, and the strain number is JSNLSHGS-13. Another purpose of the present invention is to provide the use of the above strain in promoting the growth of Dendrobium officinale.

[0004] Technical solution: The microspore pseudodisk multi-hairy spore of the present invention that promotes the growth of Dendrobium candidum is classified and named as Pestalotiopsis microspora, and its classification status is the subphylum Ascomycota, class Coelosporales, order Black discs (family), genus Pestalotiopsis, strain number is JSNLSHGS-13, and it has been deposited in the General Microbiological Center of China Microbiological Culture Collection Committee, with a deposit number of CGMCC NO.18543 and a deposit date of September 2, 2019. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101.

[0005] The main biological characteristics of the strain are: after culturing on PDA medium for 7 days, the colony diameter is 5.4 cm, the growth is slow, the colony is flat, the surface is white and flocculent, there is a ring of pigment on the back, the growth is round, the edges are irregular, the hyphae are not well developed, and the growth rate is slow.

[0006] The full sequence of the ITS region was amplified and sequenced. The full sequence of 16sRNA obtained by PCR amplification (SEQ ID NO.1) was GTGACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGCGGACCATTAAACTCTTGTTATTTTATGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATT CTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAACCCCCAATTTTTTGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGA.

[0007] The invention discloses an application of Pseudodiscotrichum microsporum for promoting the growth of Dendrobium officinale.

[0008] The microbial agent produced by the strain JSNLSHGS-13 of the present invention.

[0009] The preparation method of the microbial agent produced by the strain JSNLSHGS-13 of the present invention comprises the following steps:

[0010] 1) Prepare a solid culture medium using corn flour as a culture medium, ammonium sulfate as an exogenous nitrogen source, and glucose as an exogenous carbon source; adjust the pH to 5.5-6.5, and inoculate the strain JSNLSHGS-13 after sterilization;

[0011] 2) Cultivate at 25°C to 30°C, 12h light / 12h dark for 20d to 30d;

[0012] 3) The solid bacterial agent cultured in step 2) is crushed into powder to obtain a microbial agent.

[0013] In the step 1), the mass ratio of corn flour, ammonium sulfate and glucose is 40-50:5:8-10; 45-55 g of pure water is added to every 100 g of the mixture in the above mass ratio, and the mixture is mixed and sterilized to prepare a solid culture medium.

[0014] The sterilization conditions are sterilization at 121° C. and 0.11 MP high pressure for 30 minutes.

[0015] The invention discloses an application of a microbial agent produced by the strain JSNLSHGS-13 in the cultivation of Dendrobium officinale.

[0016] The inoculation amount of the bacterial agent per cubic meter of Dendrobium officinale cultivation substrate is 20g to 50g.

[0017] The relative water content of the Dendrobium officinale cultivation medium is maintained between 60% and 90% for more than 10 days.

[0018] Dendrobium officinale tissue culture seedlings were selected as cultivation materials. The seedlings were washed, dried until the roots turned white, weighed, and planted in the inoculated cultivation medium at a planting density of 5 plants / clump and 30 clumps / ㎡.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: the Pestalotiopsis microspora strain JSNLSHGS-13 of the present invention has a significant growth-promoting effect on Dendrobium officinale seedlings, has a certain effect on reducing the application of chemical fertilizers, and can significantly increase the chlorophyll content of Dendrobium officinale seedlings after application, reduce MDA and POD enzyme activities, and thus promote its growth. At the same time, the strain can be artificially cultured, has simple culture conditions, is convenient to apply, is easy to preserve, is easy to mass produce, and has good development and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The front morphology of the colony cultured by the strain of the present invention;

[0021] Figure 2 It is the back morphology of the colony cultured by the strain of the present invention. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific implementation methods.

[0023] Embodiment 1:

[0024] In June 2017, a strain JSNLSHGS-13 that can promote the growth of Dendrobium officinale seedlings was isolated and screened from the roots of high mountain Dendrobium in good growth condition in the Dendrobium cultivation area in Jiangsu Agricultural Expo Park in Jurong City, Jiangsu Province.

[0025] The colony characteristics of the strain JSNLSHGS-13 are as follows: after culturing on PDA medium for 7 days, the colony diameter is 5.4 cm, and the growth is slow. The colony is flat, with white floccules on the surface, annular pigment precipitation on the back, and grows in a wheel shape with irregular edges, underdeveloped hyphae, and slow growth.

[0026] The full sequence of the ITS region was amplified and sequenced. The full sequence of 16s RNA obtained by PCR amplification is shown below. Full sequence obtained by PCR amplification (SEQ ID NO.1):

[0027] GTGACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTTCTTATAGCTGCTGCCG

[0028] GCGGACCATTAAACTCTTGTTATTTTATGTAATCTGAGCGTCTTATTTTAATAAGTCA

[0029] AAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT

[0030] GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACA

[0031] TTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCTTAA

[0032] GCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAA

[0033] CGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTTCTCGCTTTTGTTAGGTG

[0034] CTATAACTCCCAGCCGCTAAACCCCCAATTTTTTGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGA.

[0035] Morphological and molecular biological identifications showed that the strain was Pestalotiopsis microspora, isolated from the subphylum Ascomycota, class Coelosporales, order Melanosporales (family), genus Pestalotiopsis microspora, strain number JSNLSHGS-13, and has been deposited in the General Microbiological Center of China Microbiological Culture Collection Committee, with the deposit number CGMCC NO.18543 and the deposit date of September 2, 2019. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101.

[0036] Embodiment 2:

[0037] Microbial agent produced by Pestalotiopsis microspora strain JSNLSHGS-13.

[0038] Corn flour was used as the culture matrix, ammonium sulfate as the exogenous nitrogen source, and glucose as the exogenous carbon source. 42 g, 8 g, and 10 g were weighed, mixed, and then 30 g of water was added to prepare a solid culture medium. The pH was adjusted to 5.5-6.5, sterilized at 121°C and 0.11 MP high pressure for 30 min, and the Pestalotiopsis microspora strain JSNLSHGS-13 was inoculated; cultured at 25-30°C, 12 h light and 12 h dark for 20-30 days. The cultured solid bacterial agent was crushed into powder for later use.

[0039] Embodiment 3:

[0040] Analysis of the effect of microbial agent produced by Pestalotiopsis microspora strain JSNLSHGS-13 on promoting the growth of Dendrobium officinale.

[0041] 1) Dendrobium officinale tissue culture seedlings were selected as cultivation materials, washed, dried until the roots turned white, weighed, and planted in the inoculated cultivation matrix described in Example 2 at a planting density of 5 plants / clump and 30 clumps / ㎡, and the uninoculated matrix was set as a non-control (ck).

[0042] 2) Carry out normal water and fertilizer management. After 60 days of cultivation, take out the Dendrobium officinale seedlings by multi-point random sampling and analyze the growth-promoting effect.

[0043] 1. Average growth rate (%): Clean the cultivation medium on the roots and tubers, air-dry under natural conditions, weigh the fresh weight of the Dendrobium officinale seedlings with an analytical balance (0.0001g), subtract the weight of the Dendrobium officinale seedlings before transplanting, and get the net weight gain. (Net weight gain / weight of the Dendrobium officinale seedlings before transplanting) × 100% is the average growth rate.

[0044] 2. Content of chlorophyll a, chlorophyll b and chlorophyll a+b: Weigh about 0.5g of healthy Dendrobium officinale leaves, chop them, add 25mL of a mixed extract of anhydrous ethanol and acetone (volume ratio of 1:1), and extract for 24h in the dark. After 24h, centrifuge the extract and measure the absorbance A645 and A663 of each supernatant at 645nm and 663nm using a UV-visible spectrophotometer.

[0045] The measured data were used to calculate the chlorophyll a, chlorophyll b and total chlorophyll contents respectively according to the following formulas.

[0046] Ca(mg / g)=(12.71A663-2.59A645)*V / 1000m;

[0047] Cb(mg / g)=(22.88A645-4.67A663)*V / 1000m;

[0048] Ca+b(mg / g)=(8.04A663+20.29A645)*V / 1000m;

[0049] In the above formula: V represents the final volume (mL) of the mixed extract of anhydrous ethanol and acetone in a volume ratio of 1:1, and m represents the fresh weight (g) of the Dendrobium officinale leaves used.

[0050] 3. Peroxidase (POD) activity assay: POD assay was performed using a POD kit (purchased from Suzhou Grace Biotechnology Co., Ltd.). Weigh 0.1 g of the upper leaves of Dendrobium officinale planted by mycorrhizal treatment with growth-promoting mycorrhizal fungi, add 1 ml of extract, and homogenize in an ice bath. Centrifuge at 4°C × 12000 rpm for 10 min. Take the supernatant and place it on ice for testing. Adjust the wavelength of the spectrophotometer to 470 nm and zero with distilled water. Add sample 40, reagent one, reagent two, and reagent three to a 1 mL cuvette in sequence and mix well. Immediately read the absorbance value A1 at 470 nm, and read the absorbance value A2 one minute later. Record the data. Note: If △A is less than 0.005, the reaction time can be extended to 5 min.

[0051] POD(ΔOD 470 / min / g fresh weight) = ΔA ÷ (W × V1 ÷ V) ÷ 0.5 ÷ T = 50 × ΔA ÷ W. Definition of enzyme activity calculation: One unit of enzyme activity is the absorbance value of 0.5 at 470 nm per gram of tissue in the reaction system per minute.

[0052] The results of the analysis of the effect of the microbial agent produced by the Pestalotiopsis microspora strain JSNLSHGS-13 on promoting the growth of Dendrobium officinale are shown in Table 1.

[0053] Table 1- Analysis of the effect of microbial agents produced by strain JSNLSHGS-13 on promoting the growth of Dendrobium officinale

[0054]

[0055] The Pestalotiopsis microspora strain JSNLSHGS-13 of the present invention has an obvious growth-promoting effect on Dendrobium officinale seedlings, has a certain effect on reducing the application of chemical fertilizers, and can significantly increase the chlorophyll content of Dendrobium officinale seedlings after application, reduce MDA and POD enzyme activities, and thus promote its growth. At the same time, the strain can be artificially cultured, has simple culture conditions, is convenient to apply, is easy to preserve, is easy to mass produce, and has good development and application prospects.

Claims

1. A microspore pseudodisk multi-hairy spore fungus that promotes the growth of Dendrobium officinale, which is classified and named as Pestalotiopsis microspora, with a strain number of JSNLSHGS-13, and has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with a deposit number of CGMCC NO.18543 and a deposit date of September 2, 2019.

2. The microbial agent produced by the strain JSNLSHGS-13 according to claim 1.

3. The method for preparing the microbial agent according to claim 2, characterized in that: The steps include: 1) Prepare a solid culture medium using corn flour as a culture medium, ammonium sulfate as an exogenous nitrogen source, and glucose as an exogenous carbon source; adjust the pH to 5.5-6.5, and inoculate the strain JSNLSHGS-13 after sterilization; 2) Cultivate at 25°C to 30°C, 12h light / 12h dark for 20d to 30d; 3) The solid bacterial agent cultured in step 2) is crushed into powder to obtain a microbial agent.

4. The preparation method according to claim 3, characterized in that: In the step 1), the mass ratio of corn flour, ammonium sulfate and glucose is 40-50:5:8-10; 45-55 g of pure water is added to every 100 g of the mixture in the above mass ratio, and the mixture is mixed and sterilized to prepare a solid culture medium.

5. Use of the microbial agent according to claim 2 in the cultivation of Dendrobium officinale.

6. The use according to claim 5, characterized in that: The inoculation amount of the bacterial agent per cubic meter of Dendrobium officinale cultivation substrate is 20g to 50g.

7. The use according to claim 6, characterized in that: The relative water content of the Dendrobium officinale cultivation medium is maintained between 60% and 90% for more than 10 days.

8. The use according to claim 6, characterized in that: Dendrobium officinale tissue culture seedlings were selected as cultivation materials. The seedlings were washed, dried until the roots turned white, weighed, and planted in the inoculated cultivation medium at a planting density of 5 plants / clump and 30 clumps / ㎡.

Images