A high-sensitivity TaqMan real-time fluorescent quantitative PCR method for detecting nucleic acid
By employing a multi-probe strategy and ultrafiltration enrichment technology, a highly sensitive TaqMan real-time fluorescence quantitative PCR system was constructed, which solved the problem of insufficient sensitivity in existing detection methods and achieved highly sensitive detection of trace nucleic acids, especially improving the sensitivity by nearly 2 times in the detection of African swine fever virus.
Patent Information
- Application Number
- CN202310872773.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-17
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2043-07-17
AI Technical Summary
The sensitivity of the existing TaqMan real-time PCR detection method is difficult to improve further, especially in trace nucleic acid detection, which affects the detection effect.
A multi-probe strategy was adopted, with specific primers and at least two probes designed, and fluorescent and quenching groups modified on each probe. Combined with ultrafiltration enrichment technology, a highly sensitive TaqMan real-time quantitative PCR system was constructed for highly sensitive detection.
The method significantly improves detection sensitivity, enabling the detection of nucleic acids at concentrations of 0.5–5 copies/μL without ultrafiltration enrichment, and detecting nucleic acids at initial concentrations as low as 10⁻³ copies/μL after ultrafiltration enrichment. The method also exhibits good specificity and repeatability.
Smart Images

Figure CN116732150B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of trace detection, and particularly relates to a high-sensitivity TaqMan real-time fluorescent quantitative PCR method for detecting nucleic acid. BACKGROUND
[0002] There are many factors affecting the sensitivity of TaqMan fluorescent quantitative PCR detection, including the types of enzymes, primer sequences, probe sequences, component ratios, PCR amplification parameters, etc. In terms of the principle of TaqMan fluorescent quantitative PCR, if the number of fluorescent groups released by the probe during each PCR cycle amplification is increased, the generated fluorescent signal can be doubled or even multiplied by several times, which can theoretically reduce the Ct value and improve the detection sensitivity. However, there are few similar studies on reducing the Ct value of fluorescent quantitative PCR detection, and only a small number of documents record that the double-probe method is the limit, because the detection sensitivity does not improve when the number of probes reaches three (Shea Ping Yip et, al. Use of dual TaqMan probes to increase the sensitivity of 1-step quantitative reverse transcription-PCR: application to the detection of SARS coronavirus. Clin Chem. 2005 Oct; 51(10): 1885-8.). Therefore, whether the sensitivity of TaqMan fluorescent quantitative PCR can be further improved to establish a high-sensitivity trace nucleic acid detection method has been the direction of efforts of researchers. SUMMARY
[0003] The application aims to provide a high-sensitivity TaqMan real-time fluorescent quantitative PCR method for detecting nucleic acid, and establish a trace detection method to provide a new idea for high-sensitivity detection of nucleic acid of a to-be-detected substance.
[0004] The application provides a high-sensitivity TaqMan real-time fluorescent quantitative PCR method for detecting nucleic acid, which comprises the following steps: designing specific primers and at least one probe according to a to-be-detected nucleic acid, constructing a high-sensitivity TaqMan real-time fluorescent quantitative PCR system by using the to-be-detected nucleic acid, the specific primers and the at least one probe, and performing a high-sensitivity TaqMan real-time fluorescent quantitative PCR reaction.
[0005] Preferably, the to-be-detected nucleic acid comprises nucleic acid of a pathogen.
[0006] Preferably, the probe is designed between the upstream primer and the downstream primer of the specific primers, and a fluorescent group and a quencher group are modified on each probe.
[0007] Preferably, the number of probes is not less than two, and each probe is modified with the same fluorescent group.
[0008] Preferably, the nucleic acid to be tested can also be enriched by ultrafiltration before performing a high-sensitivity TaqMan real-time quantitative PCR reaction.
[0009] The present invention also provides a highly sensitive TaqMan real-time quantitative PCR kit for detecting nucleic acids, comprising specific primers designed according to the nucleic acid to be tested and at least one probe, and / or reagents for ultrafiltration enrichment of nucleic acids;
[0010] The probe is designed between the upstream and downstream primers of the specific primer.
[0011] This invention provides a set of primers and probes for the specific detection of African swine fever virus, including primer ASFV-UF with nucleotide sequences as shown in SEQ ID No. 1 and primer ASFV-UR with SEQ ID No. 2;
[0012] It also includes at least one of the following probes: nucleotide sequences such as ASFV-Probe-109-R as shown in SEQ ID No. 3, ASFV-Probe-40-F as shown in SEQ ID No. 4, ASFV-Probe-118-F as shown in SEQ ID No. 5, and ASFV-Probe-190-R as shown in SEQ ID No. 6.
[0013] This invention also provides a highly sensitive TaqMan real-time quantitative PCR method for detecting African swine fever virus, comprising the following steps: constructing a reaction system using the nucleic acid of the sample to be tested and the above-mentioned primer and probe set, performing a TaqMan real-time quantitative PCR amplification reaction, and detecting an amplification curve to prove that the sample to be tested contains African swine fever virus;
[0014] The TaqMan real-time PCR amplification reaction program includes: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, 40 cycles.
[0015] Preferably, the reaction system of the TaqMan real-time PCR amplification reaction, in 20 μL, includes: 10 μL TaqMan qPCR Mix, 0.4 μL each of ASFV-UF and ASFV-UR, 2 μL of nucleic acid of the sample to be tested, 0.2 μL of each probe, and the remainder ddH2O.
[0016] Preferably, the concentrations of ASFV-UF and ASFV-UR are both 10 μmol / L, and the concentration of each probe is 15 μmol / L.
[0017] This invention also provides a method for detecting African swine fever virus by nucleic acid enrichment combined with high-sensitivity TaqMan real-time fluorescence quantitative PCR, comprising the following steps: ultrafiltration enrichment of viral nucleic acid in the test sample containing viral nucleic acid to obtain a template;
[0018] Using the template and the primer and probe set described above to construct a reaction system, a TaqMan real-time PCR amplification reaction was performed. The amplification curve detected proved that the sample to be tested contained African swine fever virus.
[0019] The TaqMan real-time PCR amplification reaction program includes: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, 40 cycles.
[0020] The present invention also provides a highly sensitive TaqMan real-time quantitative PCR kit for detecting African swine fever virus, comprising the above-mentioned primer and probe set, and / or reagents for ultrafiltration enrichment of nucleic acids.
[0021] The present invention also provides a set of primers and probes for the specific detection of pine wood nematode, including nucleotide sequences such as Bx-F shown in SEQ ID No. 11 and Bx-R shown in SEQ ID No. 12;
[0022] And includes at least one of the following probes: nucleotide sequences such as Bx-Probe-1 shown in SEQ ID No. 13 and Bx-Probe-2 shown in SEQ ID No. 14.
[0023] This invention provides a set of primers and probes specifically for detecting SARS-CoV-2, specifically a set of primers and probes designed for ORF1ab and / or N;
[0024] The primer and probe set designed for ORF1ab includes ORF1ab-20-F shown in SEQ ID No. 21 and ORF1ab-20-R shown in SEQ ID No. 22; it also includes at least one of the following probes: nucleotide sequences such as ORF1ab-20-Probe-F1 shown in SEQ ID No. 23, ORF1ab-20-Probe-F2 shown in SEQ ID No. 24, and ORF1ab-20-Probe-R1 shown in SEQ ID No. 25;
[0025] The primer-probe set designed for N includes N-29-F as shown in SEQ ID No. 26 and N-29-R as shown in SEQ ID No. 27; it also includes at least one of the following probes: nucleotide sequences such as N-29-Probe-F as shown in SEQ ID No. 28 and N-29-Probe-R as shown in SEQ ID No. 29.
[0026] Beneficial Effects: This invention provides a highly sensitive TaqMan real-time quantitative PCR method for detecting nucleic acids, comprising the following steps: designing specific primers and at least one probe based on the nucleic acid to be tested; constructing a highly sensitive TaqMan real-time quantitative PCR system using the nucleic acid to be tested, the specific primers, and at least one probe; and performing a highly sensitive TaqMan real-time quantitative PCR reaction. This invention is the first to utilize a multi-probe strategy, with or without ultrafiltration enrichment technology, to successfully establish a highly sensitive TaqMan real-time quantitative PCR detection method. Taking African swine fever virus (ASFV) detection as an example, this invention designs multiple probes for the ASFV B646L gene and compares the effects of different numbers of probes and combinations of probes on detection sensitivity, thereby effectively improving the sensitivity of the TaqMan real-time quantitative PCR detection method. When ultrafiltration enrichment technology is not used, the minimum detection limit can reach 0.5–5 copies / μL; when ultrafiltration enrichment technology is used, especially when using ultrafiltration to enrich viral nucleic acids in water, after 1000-fold enrichment, the initial concentration in the sample can be detected as low as 10. -3 ASFV nucleic acid copies / μL enables highly sensitive detection of trace viral nucleic acids.
[0027] The highly sensitive detection method described in this invention has a coefficient of variation of less than 1% between and within groups, good repeatability, and its detection sensitivity is nearly twice that of the WOAH recommended method. At the same time, this method has no cross-reactivity with common clinical porcine viruses such as PCV2, PCV3, PCV4, PEDV, PDCoV, CSFV, PRRSV, and PRV, indicating that the method has good specificity.
[0028] This invention also utilizes pine wood nematode and SARS-CoV-2 virus to detect the multi-probe strategy, confirming that the Ct value of the single probe is comparable to the control Ct value. However, when using dual probes for detection, the Ct value decreases compared to the single probe, indicating improved detection sensitivity. When using three probes for detection, the Ct value continues to decrease, and the detection sensitivity continues to improve. Attached Figure Description
[0029] Figure 1 The relative positions of different primers and probes in the B646L gene;
[0030] Figure 2Amplification curves of real-time quantitative PCR with different numbers of probes;
[0031] Figure 3 This is the amplification standard curve for the three-probe system;
[0032] Figure 4 The graph shows the sensitivity detection results for TaqMan real-time quantitative PCR.
[0033] Figure 5 This is a graph showing the specificity detection results of TaqMan real-time quantitative PCR. Detailed Implementation
[0034] This invention provides a method for detecting nucleic acids using highly sensitive TaqMan real-time quantitative PCR, comprising the following steps: designing specific primers and at least one probe based on the nucleic acid to be tested; constructing a highly sensitive TaqMan real-time quantitative PCR system using the nucleic acid to be tested, the specific primers, and at least one probe; and performing a highly sensitive TaqMan real-time quantitative PCR reaction.
[0035] The nucleic acids to be tested in this invention preferably include nucleic acids from all organisms from which DNA or RNA can be extracted, and more preferably include viruses, fungi, bacteria, parasites, etc. This invention designs specific primers targeting the conserved structural domains of the desired pathogenic microorganisms, and designs multiple probes between two primers, with each probe modified with a fluorescent group and a quenching group.
[0036] The number of probes designed in this invention is preferably no less than two, and each probe is modified with the same fluorescent group, which only needs to correspond to the channel used in subsequent detection. The fluorescent groups are preferably selected from FAM, ROX, CY5, CY3, HEX, TET, Phos, TAMRA, VIC, etc., and the quenching groups are preferably selected from TAMRA, BHQ1, BHQ2, Phos, Dabcyl, MGB, Eclipse, etc., depending on the combination of fluorescent and quenching groups. The number of probes in this invention can be increased if the amplified sequence is longer, theoretically up to an unlimited number, and the higher the number of probes, the higher the sensitivity.
[0037] In this invention, to further improve the sensitivity of TaqMan real-time quantitative PCR detection, the nucleic acid of the sample to be tested can be enriched by ultrafiltration. This invention does not have any particular limitation on the method of ultrafiltration enrichment, and enrichment can be carried out by conventional means in the art.
[0038] This invention provides a highly sensitive TaqMan real-time quantitative PCR kit for detecting nucleic acids, comprising specific primers designed according to the nucleic acid to be tested and at least one probe, and / or reagents for ultrafiltration enrichment of nucleic acids;
[0039] The probe is designed between the upstream and downstream primers of the specific primer.
[0040] The design methods for the specific primers and probes described in this invention are preferably the same as those described above, and will not be repeated here. This invention does not specifically limit the type of nucleic acid to be tested; it can be a DNA virus, an RNA virus, a pathogenic microorganism, or other extractable nucleic acids.
[0041] This invention provides a set of primers and probes for the specific detection of African swine fever virus, including primer ASFV-UF with nucleotide sequences as shown in SEQ ID No. 1 and primer ASFV-UR with SEQ ID No. 2;
[0042] It also includes at least one of the following probes: nucleotide sequences such as ASFV-Probe-109-R as shown in SEQ ID No. 3, ASFV-Probe-40-F as shown in SEQ ID No. 4, ASFV-Probe-118-F as shown in SEQ ID No. 5, and ASFV-Probe-190-R as shown in SEQ ID No. 6.
[0043] Table 1 Primer and probe sequences of the present invention
[0044] Primer name Primer sequence (5'-3') SEQ ID No. ASFV-B646L-F CCCAGGRGATAAAATGACTG 7 ASFV-B646L-R CACTRGTTCCCTCCACCGATA 8 ASFV-B646L-Probe1 FAM-TCCTGGCCRACCAAGTGCTT-BHQ1 9 ASFV-U-F GACATGTTGTTAACGCCATTATGCAG 1 ASFV-U-R GTGGAAGGGTATGTAAGAGCTGCAGA 2 ASFV-Probe-109-R FAM-CAGATATAGATGAACATGCGTCTGGAAGAGC-BHQ1 3 ASFV-Probe-40-F FAM-ACTCACCACGCAGAGATAAGCTTTCAGGA-BHQ1 4 ASFV-Probe-118-F FAM-CCCGTTACGTATCCGATCACATTACCTATT-BHQ1 5 ASFV-Probe-190-R FAM-CGATAAGATTGATACCATGAGCAGTTACGGAA-BHQ1 6
[0045] In Table 1, SEQ ID No. 7 to SEQ ID No. 9 are the sequences and probes suggested by WOAH, and SEQ ID No. 1 to SEQ ID No. 6 are the probe and primer sets designed in this invention.
[0046] This invention also provides a highly sensitive TaqMan real-time quantitative PCR method for detecting African swine fever virus, comprising the following steps: constructing a reaction system using the nucleic acid of the sample to be tested and the above-mentioned primer and probe set, performing a TaqMan real-time quantitative PCR amplification reaction, and detecting an amplification curve to prove that the sample to be tested contains African swine fever virus;
[0047] The TaqMan real-time PCR amplification reaction program includes: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, 40 cycles.
[0048] The multi-probe strategy described in this invention preferably includes dual-probe, triple-probe, and quadruple-probe configurations. The TaqMan quantitative PCR amplification reaction system for the multi-probe configuration, in 20 μL volumes, preferably includes: 10 μL TaqMan qPCR Mix, 0.4 μL each of ASFV-UF and ASFV-UR, 2 μL of the nucleic acid sample to be tested, 0.2 μL of each probe, and the remainder ddH2O. The concentrations of ASFV-UF and ASFV-UR are preferably both 10 μmol / L, and the concentration of each probe is preferably 15 μmol / L.
[0049] This invention also provides a method for detecting African swine fever virus by nucleic acid enrichment combined with high-sensitivity TaqMan real-time fluorescence quantitative PCR, comprising the following steps: ultrafiltration enrichment of viral nucleic acid in the test sample containing viral nucleic acid to obtain a template;
[0050] Using the template and the primer and probe set described above to construct a reaction system, a TaqMan real-time PCR amplification reaction was performed. The amplification curve detected proved that the sample to be tested contained African swine fever virus.
[0051] The TaqMan real-time PCR amplification reaction program includes: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, 40 cycles.
[0052] The method described in this invention is preferably the same as described above, and will not be repeated here.
[0053] The present invention also provides a highly sensitive TaqMan real-time quantitative PCR kit for detecting African swine fever virus, comprising the above-mentioned primer and probe set, and / or reagents for ultrafiltration enrichment of nucleic acids.
[0054] The primer and probe set in the kit described in this invention is preferably the same as described above, and will not be repeated here. Furthermore, the kit may contain reagents for ultrafiltration enrichment of nucleic acids, and the detection sensitivity is proportionally improved after ultrafiltration enrichment. This invention does not specifically limit the ultrafiltration enrichment reagents; preferably, the ultrafiltration method described by Zhao Lin et al. is used for nucleic acid enrichment (Zhao Lin, Zhou Wenting, Cao Jingyuan et al., Comparison of ultrafiltration and PEG concentration methods for hepatitis A virus in simulated water samples, *Chinese Journal of Experimental and Clinical Virology*, 2016, Vol. 1, DOI:10.3760 / cma.j.issn.1003-9279.2016.01.019).
[0055] The present invention also provides a set of primers and probes for the specific detection of pine wood nematode, including nucleotide sequences such as Bx-F shown in SEQ ID No. 11 and Bx-R shown in SEQ ID No. 12;
[0056] And includes at least one of the following probes: nucleotide sequences such as Bx-Probe-1 shown in SEQ ID No. 13 and Bx-Probe-2 shown in SEQ ID No. 14.
[0057] Table 2. Specific sequences, primers, and probes for Pine Wood Nematode.
[0058]
[0059] The present invention also provides a method for specifically detecting pine wood nematode using the primer and probe set, comprising the following steps: performing nucleic acid enrichment on a test sample containing nucleic acid by ultrafiltration or without ultrafiltration to obtain a template;
[0060] Using the template and the primer and probe sets shown in Table 2, a reaction system was constructed, and TaqMan real-time quantitative PCR amplification was performed. The detected amplification curve confirmed the presence of pine wood nematodes in the sample. The TaqMan real-time quantitative PCR detection system of this invention is 20 μL, containing 10 μL TaqMan qPCR Mix, 2 μL template, 0.4 μL each of F and R primers, 0.2 μL each of probes, and ddH2O to a final volume of 20 μL. The PCR amplification program was: 95℃ pre-denaturation for 3 min; 95℃ for 10 s, 60℃ for 30 s, for a total of 45 cycles. The fluorescence detection channel was either SYBR or FAM.
[0061] This invention provides a set of primers and probes specifically for detecting SARS-CoV-2, specifically a set of primers and probes designed for ORF1ab and / or N;
[0062] The primer and probe set designed for ORF1ab includes ORF1ab-20-F shown in SEQ ID No. 21 and ORF1ab-20-R shown in SEQ ID No. 22; it also includes at least one of the following probes: nucleotide sequences such as ORF1ab-20-Probe-F1 shown in SEQ ID No. 23, ORF1ab-20-Probe-F2 shown in SEQ ID No. 24, and ORF1ab-20-Probe-R1 shown in SEQ ID No. 26;
[0063] The primer-probe set designed for N includes N-29-F shown in SEQ ID No. 27 and N-29-R shown in SEQ ID No. 28; it also includes at least one of the following probes: nucleotide sequences such as N-29-Probe-F shown in SEQ ID No. 29 and N-29-Probe-R shown in SEQ ID No. 30.
[0064] Table 3 Primer and probe sequences used for SARS-CoV-2 detection
[0065]
[0066]
[0067] The preferred detection method of TaqMan real-time quantitative PCR described in this invention is the same as described above. When detecting SARS-CoV-2, the detection system is 20 μL, containing 10 μL of TaqMan qPCRMix, 2 μL of template (provided by Huzhou CDC), 0.4 μL each of F and R primers, 0.2 μL each of probes, and ddH2O to bring the total to 20 μL. The PCR amplification program is: 95℃ pre-denaturation for 3 min; 95℃ for 10 s, 60℃ for 30 s, for a total of 40 cycles. The fluorescence detection channel is either SYBR or FAM.
[0068] To further illustrate the present invention, the following detailed description of a highly sensitive TaqMan real-time quantitative PCR method for detecting ASFV, in conjunction with embodiments, is provided by the present invention, but should not be construed as limiting the scope of protection of the present invention.
[0069] Unless otherwise specified, the reagents and materials used in the embodiments of this invention are all conventional commercially available products in the art and can be purchased from reagent stores.
[0070] 1. Instruments and reagents
[0071] The nucleic acid electrophoresis system (DYY-8C) and nucleic acid gel imaging system (GenoSens 1880) were purchased from Bio-Rad, USA. The real-time quantitative PCR system (CFX 96touch) and digital PCR system (QX200 Droplet Digital PCR) were purchased from Bio-Rad, USA. The NanoDrop One ultra-micro spectrophotometer was purchased from Thermo Fisher Scientific. Viral nucleic acid extraction kit (TKR-9766) was purchased from Takara Bio Inc., plasmid miniprep kit (DP103-02) was purchased from Tiangen Biotech (Beijing) Co., Ltd., high-fidelity enzyme (P505-d1) was purchased from Nanjing Novizan Biotechnology Co., Ltd., routine DNA marker (GeneRuler 100bp Plus DNA Ladder, 91270326) was purchased from Thermo Fisher Scientific, regular agarose (BY-R0100) was purchased from Shanghai Baijing Biotechnology Co., Ltd., 2×Taq Plus Master Mix (P213-03) and TaqMan qPCRMix 2×Premix Ex Taq (Probe qPCR, 027E2211KA) were purchased from TaKaRa, and qPCR 96-well plates and membranes were purchased from Hangzhou Weituo Biotechnology Co., Ltd.
[0072] 2. Viral genome and plasmids
[0073] The plasmid pUC57-B646L was synthesized by Zhejiang Shangya Biotechnology Co., Ltd. based on the B646L gene sequence of African swine fever virus genotype II strain in GenBank. The plasmid template was then amplified and extracted. Nucleic acids from porcine circovirus 2 (PCV2), porcine circovirus 3 (PCV3), porcine circovirus 4 (PCV4), porcine epidemic diarrhea virus (PEDV), porcine delta coronavirus (PDCoV), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), and porcine pseudorabies virus (PRV) were all preserved by the Key Laboratory of Animal Virology, Ministry of Agriculture and Rural Affairs, Zhejiang University.
[0074] Example 1
[0075] I. Experimental Design
[0076] 1. Primer and probe design and screening
[0077] Refer to the universal primer and probe sequences recommended by WOAH for TaqMan real-time PCR detection of African swine fever virus (Table 1), and also consider the specific location in the B646L gene ( Figure 1 Primer and probe sequences were designed and synthesized by Zhejiang Shangya Biotechnology Co., Ltd.
[0078] Using 0.5 μL of pUC57-B646L plasmid as a template, 10 μL of 2×Phanta Flash Master Mix and 0.5 μL each of forward and reverse primers were added, and ddH2O was added to a final volume of 20 μL. The reaction program was as follows: 95℃ for 5 min; 98℃ for 15 s, 60℃ for 15 s, 72℃ for 20 s, for a total of 30 cycles; and 72℃ for 5 min. The reaction products were identified by 1.5% agarose gel electrophoresis and sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing.
[0079] 2. Establishment and optimization of TaqMan real-time quantitative PCR detection systems with different probe numbers
[0080] The experimental group was divided into four groups:
[0081] ① Four-probe TaqMan real-time PCR reaction system: 10 μL TaqMan qPCRMix, 0.4 μL each of primer F ASFV-UF and primer R ASFV-UR, 2 μL template, 0.2 μL each of probes ASFV-Probe-109-R, ASFV-Probe-40-F, ASFV-Probe-118-F, and ASFV-Probe-190-R, 6.4 μL ddH2O, and a total reaction volume of 20 μL.
[0082] ②The three-probe, two-probe, and single-probe systems are based on the four-probe system, with the number of probes reduced and the remaining volume made up with ddH2O. Each group has 3 replicates.
[0083] The TaqMan real-time PCR amplification reaction conditions were: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, for 40 cycles.
[0084] Meanwhile, the three-probe system was optimized: the concentrations of upstream and downstream primers and probes were diluted to 1 μmol / L, 5 μmol / L, 10 μmol / L and 15 μmol / L, respectively, and the annealing temperature was around 55-64℃. The detection system with the highest detection sensitivity was selected using the matrix method for subsequent experiments.
[0085] 3. Establishment of standard curve and enrichment experiment
[0086] The copy number of plasmid pUC57-B646L was determined by digital PCR, and then serially diluted 10-fold with ddH2O to obtain 5×10⁻⁶ copies. 0 copies / μL to 5×10 6 A series of gradients of copies / μL were prepared, with 2μL of each dilution used as template for real-time PCR. Amplification was performed according to the optimal system for TaqMan three-probe PCR detection. The copy number of each reaction corresponded to the cycle threshold (Ct value) of the corresponding dilution, and standard curves for ASFV-B646L were established accordingly.
[0087] Nucleic acid enrichment was performed using ultrafiltration (Zhao Lin, Zhou Wenting, Cao Jingyuan, et al., Comparison of ultrafiltration and PEG concentration methods for hepatitis A virus in simulated water samples, *Chinese Journal of Experimental and Clinical Virology*, 2016, Vol. 1, DOI: 10.3760 / cma.j.issn.1003-9279.2016.01.019). Specifically, the positive template was diluted with ddH2O to 300 mL of sample containing 0.001 copies per μL. 900 μL of sample was aliquoted and labeled NC. The sample was then divided into three groups for enrichment at 100-fold, 500-fold, and 1000-fold, respectively. Specific method: Take 5 ultrafiltration tubes. Add 15 mL of sample solution to one tube and centrifuge at 4000×g for 40 min. The expected yield is 150 μL of a 100-fold enriched sample, labeled C-100. Add 15 mL of sample solution to another ultrafiltration tube and centrifuge at 4000×g for 40 min. Discard the lower layer of liquid, add another 15 mL of sample solution to the upper layer, and centrifuge at 4000×g for 40 min. Repeat this process 4 times, for a total of 5 centrifugations, to obtain 150 μL of a 500-fold enriched sample. This sample is labeled C-500. Add 15 mL of sample solution to each of the remaining three ultrafiltration tubes, centrifuge at 4000×g for 40 min, discard the lower layer, add another 15 mL of solution to the upper layer tube, centrifuge twice, and repeat for a total of three centrifugations per ultrafiltration tube. Discard the lower layer from each of the three tubes, collect the upper layer in one tube, add another 15 mL of sample solution, and centrifuge at 4000×g for 40 min. The expected result is 150 μL of a 1000-fold enriched sample, labeled C-1000.
[0088] 4. Sensitivity test
[0089] Use ddH2O to reduce the initial concentration to 5 × 10⁻⁶. 6 pUC57-B646L standard plasmid copies / μL were serially diluted 10-fold from 5×10⁻⁶ to 10×10⁻⁶. 6 Dilute to 5×10 copies / μL. -2 Copies / μL, 2μL of each dilution sample was used as template for PCR reaction. Amplification was carried out according to the appropriate primer, probe concentration and reaction system determined by the above experiment, so as to detect the lowest detection limit of the three-probe real-time PCR method.
[0090] Simultaneously, the enriched samples underwent sensitivity testing. The experiment was divided into a control group without template and experimental groups with different template concentrations. The templates added to the experimental groups were: unenriched sample NC, enriched sample C-100 (100-fold enrichment), enriched sample C-500 (500-fold enrichment), enriched sample C-1000 (1000-fold enrichment), and a positive sample as a positive control. Each group had three replicates. Amplification was performed according to the TaqMan three-probe PCR detection system. The detection limit and sensitivity of the high-sensitivity TaqMan real-time PCR detection system for African swine fever virus in water were analyzed based on the qPCR results.
[0091] 5. Specificity test
[0092] Using PCV2, PCV3, PCV4, PEDV, PDCoV, CSFV, PRRSV, genotype I PRV, and genotype II PRV nucleic acids as templates, pUC57-B646L as a positive control, and ddH2O as a negative control, the specificity of this assay was evaluated using the aforementioned TaqMan three-probe PCR detection system.
[0093] 6. Repeatability test
[0094] According to the TaqMan three-probe PCR detection system described above, three different concentrations of standard plasmids were randomly used as templates. Each concentration was tested three times in a single round of qPCR, and the standard deviation and coefficient of variation (CV) of the intra-group repeatability and inter-group repeatability Ct values were calculated.
[0095] 7. Clinical sample testing
[0096] Viral nucleic acid was extracted from clinically collected samples suspected of ASFV infection. The samples were then tested using the established TaqMan three-probe PCR detection system and the single-probe detection system with the highest sensitivity. The positive sample concordance rate was verified using the WOAH recommended detection system. The results were analyzed to verify the feasibility of the method.
[0097] II. Results and Discussion
[0098] 1. Effect of different probe numbers on the sensitivity / Ct value of TaqMan real-time quantitative PCR detection
[0099] The experimental results are shown in Table 4. The Ct values for different probe combinations vary. The average Ct value for a single probe is 25.26, for a dual probe it is 23.97, for a triple probe it is 23.37, and for a quad probe it is 23.31. Although the Ct values for dual probes are not identical, their average Ct value is 1.29 lower than that of a single probe. Similarly, the average Ct value for a triple probe is 0.6 lower than that of a dual probe and 1.89 lower than the average value of a single probe, which is basically consistent with the theoretical values. However, when the number of probes increases to four, the Ct value is 23.31, which is 1.95, 0.66, and 0.06 lower than the average Ct values for single and dual probes, respectively, indicating that the quad probe has the highest detection sensitivity. In summary, compared with the single probe detection system, the triple probe detection system can advance the Ct value by about 1.89, meaning the detection sensitivity is approximately three times higher. From a cost-effectiveness perspective, the triple probe detection system should be used for subsequent detection.
[0100] Table 4. Effect of different probe numbers on the sensitivity / Ct value of Taqman real-time quantitative PCR detection.
[0101]
[0102]
[0103] 2. Optimization of the real-time PCR reaction system and reaction conditions
[0104] Based on the primer concentration matrix method and temperature gradient exploration, the highest amplification efficiency was achieved when the upstream and downstream primer concentrations were 10 μmol / L, the probe concentration was 15 μmol / L, and the annealing temperature was 62.5℃. The final three-probe TaqMan quantitative PCR reaction system was as follows: 10 μL TaqMan qPCR Mix, 0.4 μL each of primer F (ASFV-UF) and primer R (ASFV-UR), 2 μL template, 0.2 μL each of probes ASFV-Probe-109-R, ASFV-Probe-40-F, and ASFV-Probe-118-F, 6.6 μL ddH2O, and a total reaction volume of 20 μL. The PCR amplification conditions were: 95℃ for 5 min; 95℃ for 10 s, 62.5℃ for 30 s, for 40 cycles.
[0105] Using four self-designed probes and primers, fluorescence quantitative PCR amplification was performed according to the determined optimal reaction system and amplification reaction conditions, and amplification curves with representative probe numbers were selected.
[0106] 3. Establishment of the standard curve
[0107] With 5×10 0 copies / μL to 5×10 6Using pUC57-B646L standard plasmid (copies / μL) as templates, standard curves were plotted based on the cycle threshold (Ct value) and corresponding copy number log value for each dilution concentration. Figure 2 The standard curve of the three-probe system is as follows: Figure 3 As shown, Y = -3.6285X + 33.605 (Y: Ct value, X: logarithmic copy number of plasmid), and the correlation coefficient Rt is given. 2 =0.9995. According to the standard curve, each reaction at dilution (5 × 10⁻⁶) 0 copies / μL~5×10 6 The linear relationship is good within the range of copies / μL.
[0108] 4. Sensitivity test
[0109] The initial concentration was 5 × 10 6 pUC57-B646L standard plasmid (copies / μL) was used as the initial plasmid for 10-fold serial dilutions, from 5 × 10⁻⁶ copies / μL. 6 Dilute to 5×10 copies / μL. -2 Copies / μL, 2μL for each dilution, are used as templates for the real-time PCR reaction. Amplification is performed under optimal reaction conditions and in the reaction system to determine the minimum detection limit of the three-probe real-time PCR method.
[0110] The results are as follows Figure 4 As shown, this system can detect 5 × 10⁻⁶. -1 copies / μL-5×10 0 copies / μL, of which 5×10 0 The copies / μL data is stable, 5×10 -1 Although copies / μL can detect a positive result, the stability is slightly poor.
[0111] After enriching the viral simulated nucleic acid in the water, the concentration factor differed slightly from the expected factor. It was anticipated that one centrifugation of 15 ml of solution would yield 150 μL of concentrate. In practice, samples with a concentrate volume less than 150 μL were supplemented to 150 μL using ddH2O. The detection results are shown in Table 5. The initial sample concentration was 0.001 copies per μL. After 100-fold enrichment, the positivity of the sample could not be detected. After 500-fold concentration, a positive result could be detected, but the data was not stable. After 1000-fold concentration, a stable positive result could be detected using the highly sensitive TaqMan qPCR detection system.
[0112] Table 5. TaqMan qPCR detection results of ASFV enrichment experiments in water bodies.
[0113]
[0114] 5. Sample Judgment Criteria
[0115] According to the sensitivity test of three-probe real-time PCR, the PCR results are judged. (1) If the positive control has a typical amplification curve in the FAM channel and the Ct value is ≤39, and the negative control has no amplification curve and no Ct value in the FAM channel, the test result is considered valid; otherwise, the test is considered invalid. (2) If the sample to be tested has a typical amplification curve in the FAM channel and the Ct value is ≤39, it is judged to be positive for ASFV nucleic acid; if 39 < Ct value ≤40, it is judged to be suspected positive, and it is recommended to repeat the test. If the test result is still Ct value ≤40, it can be judged to be positive; if there is no amplification curve and no Ct value, it is judged to be negative.
[0116] 6. Specificity test
[0117] Using 100 ng / μL of PCV2, PCV3, PCV4, PEDV, PDCoV, CSFV, PRRSV, and PRV-related viral nucleic acids as templates, pUC57-B646L standard plasmid as a positive control, and ddH2O as a negative control, the three-probe fluorescence quantitative PCR method established in this experiment was used for detection.
[0118] The results are as follows Figure 5 As shown, only the reaction channel using pUC57-B646L as a template detected fluorescence signal, while no fluorescence signal was detected in the reaction channels using PCV2, PCV3, PCV4, PEDV, PDCoV, CSFV, PRRSV, and PRV as templates. This indicates that the established three-probe fluorescent quantitative PCR method has high specificity and does not cross-react with other common swine viruses.
[0119] 7. Repeatability test
[0120] Following the optimized conditions of the three-probe real-time quantitative PCR method, three different dilutions (1×10⁻⁶) were randomly selected. 6 1×10 4 1×10 2 Using standard plasmids at a concentration of (copies / μL) as templates, each dilution was tested three times in parallel under the same conditions to perform intragroup repeatability tests. The results are shown in Table 6, with coefficients of variation of 0.57%, 0.38%, and 0.39%, respectively.
[0121] Each dilution concentration was tested three times under the same conditions at different time points to perform intergroup repeatability tests. The results showed that the coefficients of variation were 0.53%, 0.37%, and 0.43%, respectively.
[0122] Table 6. Reproducibility of the Three-Probe Real-Time Quantitative PCR Method
[0123]
[0124]
[0125] 8. Clinical sample testing
[0126] Clinically collected blood samples were tested using the established three-probe and single-probe real-time quantitative PCR methods and the detection system recommended by WOAH (SEQ ID No. 7 to SEQ ID No. 9 in Table 1). The pUC57-B646L standard plasmid was used as a positive control and ddH2O was used as a negative control.
[0127] The results are shown in Table 7. Among the 173 clinical samples, the three-probe real-time quantitative PCR method detected 137 negative samples and 36 positive samples, with a positive rate of 20.81%; the single-probe real-time quantitative PCR method detected 143 negative samples and 30 positive samples, with a positive rate of 17.34%. Of the 36 positive samples, 16.67% (6 samples) were detected positive by the three-probe real-time quantitative PCR method but not by the single-probe real-time quantitative PCR method; 11.11% (4 samples) had a ΔCt value <1, indicating that the sensitivity enhancement of the three probes was less than 2 times; 36.11% (13 samples) had a ΔCt value <2, indicating that the sensitivity enhancement of the three probes was between 2 and 4 times; 25% (9 samples) had a ΔCt value <3, indicating that the sensitivity enhancement of the three probes was between 4 and 8 times; and 8.33% (3 samples) had a ΔCt value >3, indicating that the sensitivity enhancement of the three probes was greater than 8 times. Excluding the 6 samples that tested negative with the single probes, the remaining 30 samples tested positive with the single probes. The average Ct value of the three probes was 2.11 lower than that of the single probes, indicating that the three-probe method can significantly improve the detection sensitivity of ASFV in clinical testing.
[0128] At the same time, 137 negative samples and 36 positive samples were detected according to the WOAH recommended method, and the concordance rate with the three-probe real-time fluorescence quantitative PCR system was 100%.
[0129] Table 7. ΔCt for single-probe and three-probe systems
[0130]
[0131]
[0132] Example 2
[0133] Detection of pine wood nematode using the multi-probe strategy of the present invention
[0134] 1. Primer and probe design
[0135] Primers and probes as shown in Table 2 were designed using the specific sequence Bursaphelenchus xylophilus (SEQ ID No. 10).
[0136] 2. Template preparation
[0137] 2.1 Sample processing
[0138] (1) Insect suspension sample
[0139] Add 1 mL of the well-mixed insect suspension to a 1.5 mL centrifuge tube, centrifuge at 10000 g for 2 minutes, and discard the supernatant. Then add 100 μL of DNA rapid extraction solution A (extraction kit purchased from Zhejiang EasyBio Biotechnology Co., Ltd.), vortex to mix, and proceed to the next experiment.
[0140] (2) Diseased wood samples
[0141] Add 10 mg of sawdust from the infected wood (drilled with an electric drill) to a 1.5 mL centrifuge tube, along with 200–300 μL of DNA rapid extraction buffer A (extraction kit purchased from Zhejiang EasyBio Biotechnology Co., Ltd.). Vortex thoroughly to mix, let stand for 10 minutes, centrifuge at 10,000 g for 2 minutes, and transfer all supernatant to a new centrifuge tube.
[0142] Place the sample in a 1.5ml centrifuge tube (if there are a small amount of suspended sawdust on the surface of the liquid, insert the tube below the surface of the sawdust to draw up the liquid) and proceed to the next step of the experiment.
[0143] 2.2 Extraction of nucleic acid from pine wood nematode
[0144] Use a handheld homogenizer to thoroughly grind the sample prepared in the previous step, vortex to mix, incubate at 90-100℃ for 10 minutes, and transfer 50μl-100μL of supernatant into a new 1.5mL centrifuge tube. Then add an equal volume of DNA rapid extraction solution B (extraction kit purchased from Zhejiang EasyBest Biotechnology Co., Ltd.) to the tube, vortex to mix, and the resulting solution is the nucleic acid to be tested, which will be used as the DNA template for subsequent PCR reactions.
[0145] 3. Comparison of TaqMan real-time quantitative PCR detection systems with different probe numbers
[0146] The TaqMan real-time quantitative PCR detection system consisted of 20 μL, including 10 μL TaqMan qPCR Mix, 2 μL template, 0.4 μL each of F and R primers, 0.2 μL each of probes, and ddH2O to a final volume of 20 μL. The PCR amplification program was: 95℃ pre-denaturation for 3 min; 95℃ for 10 s, 60℃ for 30 s, for a total of 45 cycles. The fluorescence detection channel was either SYBR or FAM. A pine wilt disease detection kit (purchased from Zhejiang EasyBio Biotechnology Co., Ltd.) was used as a control.
[0147] The Ct values are shown in Table 8. The Ct values of the single probe and the control kit are comparable. However, when using the dual probe for detection, the Ct value decreases by an average of 1.03 compared to the single probe, indicating that the detection sensitivity is improved by an average of 2.04 times. Compared with the control kit, the detection sensitivity of the dual probe is also improved by 1.98 times, indicating that the dual probe method can effectively improve the detection sensitivity.
[0148] Table 8. Ct values of pine wood nematode detected by Taqman quantitative PCR with different probe numbers.
[0149] Control kit Bx-Probe-1 Bx-Probe-2 Dual Probe Template 1 37.88 37.93 37.95 36.90 Template 2 37.72 37.82 37.77 36.75 Template 3 31.32 31.40 31.36 30.32 Positive 18.30 18.35 18.33 17.35 Negative — — — —
[0150] Example 3
[0151] To investigate the effect of different combinations of luminescent and quenching groups on the probe, this invention also replaced the luminescent groups in SEQ ID No. 13 and SEQ ID No. 14 in Table 2 with ROX and the quenching group with BHQ2. Taqman quantitative PCR experiments with different numbers of probes were conducted to detect pine wood nematode. The PCR system and amplification system were the same as those used for FAM and BHQ1 labeled probes, and the fluorescence detection channel was the ROX channel.
[0152] The results showed that the Ct value of the single probe was comparable to that of the control kit. However, when using the dual probe, the Ct value decreased by an average of 1.12 compared to the single probe, indicating an average increase in detection sensitivity of 2.17 times. Compared to the control kit, the detection sensitivity of the dual probe was increased by 2.05 times, indicating that the dual probe method based on the ROX fluorescent group can also effectively improve detection sensitivity.
[0153] Example 4
[0154] The detection probes for the N gene and ORF1ab gene of SARS-CoV-2 were optimized using a multi-probe strategy in order to obtain a detection system with higher sensitivity and lower false negative rate.
[0155] 1. Primer and probe design and screening
[0156] Design and synthesize the primers and probes shown in Table 3.
[0157] 2. Results of TaqMan real-time quantitative PCR detection with different probe numbers
[0158] The TaqMan real-time quantitative PCR detection system consisted of 20 μL, including 10 μL TaqMan qPCR Mix, 2 μL template (provided by Huzhou CDC), 0.4 μL each of F and R primers, 0.2 μL each of probes, and ddH2O to a final volume of 20 μL. The PCR amplification program was: 95℃ pre-denaturation for 3 min; 95℃ for 10 s, 60℃ for 30 s, for a total of 40 cycles. The fluorescence detection channel was either SYBR or FAM. The sequence published by the CDC was used as a control.
[0159] As shown in Table 9, the single-probe detection Ct values of each of the three probes are close to those of the CDC control, while the average Ct value of the dual-probe method is 1.2 smaller than that of the CDC control, and the average Ct value of the triple-probe method is 1.77 smaller than that of the CDC control. That is, the detection sensitivity of the dual-probe method is 2.3 times higher than that of the CDC recommended method, and the detection sensitivity of the triple-probe method is 3.4 times higher than that of the CDC recommended method.
[0160] Meanwhile, when the probes for the two N genes were used for single-probe detection, their Ct values were close to those of the CDC control, while the Ct values of the dual-probe probes were 1.13 lower than those of the CDC control. Compared with the control primer / probe sequences provided by the CDC, the detection sensitivity was improved by 2.2 times.
[0161] Table 9. Ct values of SARS-CoV-2 ORF1ab and N genes detected by Taqman quantitative PCR with different numbers of probes.
[0162]
[0163]
[0164] Example 5
[0165] Except for the fluorescent group and quencher group, which are different from those in Example 4, and the fluorescence detection channel, all other operations are the same as in Example 4:
[0166] Specifically, the fluorescent groups in SEQ ID No. 23 to SEQ ID No. 25 in Table 3 were replaced with Texas Red, the quenching group was replaced with BHQ2, and the fluorescence detection channel was replaced with the Texas Red channel. The results showed that the single-probe detection Ct values of each of the three probes were close to the CDC control, while the average Ct value of the dual-probe method was 1.06 lower than the CDC control, and the Ct value of the triple-probe method was 1.61 lower than the CDC control. This means that the detection sensitivity of the dual-probe method was 2.08 times higher than the CDC recommended method, and the detection sensitivity of the triple-probe method was 3.05 times higher than the CDC recommended method. This indicates that dual-probe and multi-probe methods based on the Texas Red luminescent group can effectively improve detection sensitivity.
[0167] The fluorescent groups in SEQ ID No. 28 and SEQ ID No. 29 in Table 3 were replaced with HEX, and the quencher group was BHQ1. TaqMan quantitative PCR experiments with different numbers of probes were conducted to detect the SARS-CoV-2N gene. The PCR and amplification systems were the same as those used for FAM and BHQ1-labeled probes, and the fluorescence detection channel was the HEX channel. The results showed that the Ct value of single-probe detection was close to that of the CDC control, while the Ct value of the dual-probe method was 1.21 lower than the CDC control. Compared with the control primer / probe sequence provided by the CDC, the detection sensitivity was improved by 2.31 times. This indicates that the dual-probe method based on the HEX fluorescent group can also effectively improve detection sensitivity.
[0168] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A set of primer probe sets for specifically detecting African swine fever virus, characterized in that, The primer set consists of primer ASFV-U-F with nucleotide sequence as shown in SEQ ID No. 1 and primer ASFV-U-R with nucleotide sequence as shown in SEQ ID No. 2; The probe set consists of ASFV-Probe-109-R with nucleotide sequence as shown in SEQ ID No. 3, ASFV-Probe-40-F with nucleotide sequence as shown in SEQ ID No. 4 and ASFV-Probe-118-F with nucleotide sequence as shown in SEQ ID No.
5.
2. A method for detecting African swine fever virus by high-sensitivity TaqMan real-time fluorescent quantitative PCR, characterized in that, The method comprises the following steps: The nucleic acid of the sample to be tested is used to construct a reaction system with the primer probe set according to claim 1, and a TaqMan fluorescent quantitative PCR amplification reaction is performed, and the amplification curve can be detected to prove that the sample to be tested contains African swine fever virus; The program of the TaqMan fluorescent quantitative PCR amplification reaction comprises: 95℃ 5min; 95℃ 10s, 60℃ 30s, 40 cycles.
3. A method for detecting African swine fever virus by nucleic acid enrichment combined with high-sensitivity TaqMan real-time fluorescent quantitative PCR, characterized in that, The method comprises the following steps: The nucleic acid of the sample to be tested is used to construct a reaction system with the primer probe set according to claim 1, and a TaqMan fluorescent quantitative PCR amplification reaction is performed, and the amplification curve can be detected to prove that the sample to be tested contains African swine fever virus; The program of the TaqMan fluorescent quantitative PCR amplification reaction comprises: 95℃ 5min; 95℃ 10s, 60℃ 30s, 40 cycles. The reagent comprises the primer probe set according to claim 1 and the ultrafiltration enriched nucleic acid.
4. A kit for detecting African swine fever virus with high sensitivity by TaqMan real-time fluorescent quantitative PCR, characterized in that,
Citation Information
Patent Citations
African swine fever TaqMan real-time fluorescence quantitative PCR detection primers and kit
CN110735006A
Locked nucleic acid probe fluorescent quantitative PCR detection composition, detection method and detection kit for African swine fever virus
CN110777221A