A characteristic nucleotide sequence of an okra apple, a nucleic acid molecular probe and a method
By designing characteristic nucleic acid molecular probes LS1F and LS2R and combining them with real-time PCR technology, the problem of detecting the authenticity and content of Leiwan medicinal materials was solved, and rapid and accurate identification and quantitative detection of Leiwan were achieved.
Patent Information
- Application Number
- CN202410093487.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-23
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-01-23
AI Technical Summary
The quality of Leiwan medicinal materials on the market varies greatly, and counterfeit drugs are circulating, which cannot meet market demand. Moreover, existing technology makes it difficult to quickly and accurately detect the authenticity and content of Leiwan and its related products.
Characteristic nucleic acid molecular probes LS1F and LS2R were designed based on the ITS gene sequence of Leiwan (a type of orchid) and combined with real-time quantitative PCR technology to rapidly detect the authenticity and content of Leiwan.
It enables rapid and accurate identification and quantitative detection of thunderball samples, with high specificity, high sensitivity, and a detection limit as low as 0.025 ng/μL, and the detection is completed within 2 hours.
Smart Images

Figure CN117925884B_ABST
Abstract
Description
Technical Field:
[0001] The present invention belongs to the field of molecular detection and identification, and uses molecular technology means to quickly detect the authenticity of edible and medicinal fungi. Specifically, it relates to a characteristic nucleotide sequence, a molecular probe, and a quantitative detection method for detecting the medicinal fungus Polyporus mylittae Cook.et Mass.. Background Art:
[0002] Polyporus mylittae Cook.et Mass., also known as Zhuling, Zhulinzi, Zhulingzhi, and Mulianzi, is a well-known medicinal fungus included in the Chinese Pharmacopoeia. It is widely distributed in Gansu, Sichuan, Yunnan, Guizhou, Guangdong, Fujian and other places in China, mainly growing wild, and is often dug in bamboo forests in summer and autumn. Polyporus mylittae Cook.et Mass. is a large fungus that parasitizes on the roots of bamboo. The sclerotium is oval to ovoid in shape, grayish-brown to brownish-brown when mature, hard in texture after drying, with a blackish-brown outer skin and white inside, with patterns and a bitter taste. It is a specific medicine for expelling worms and has been recorded in the Compendium of Materia Medica since ancient times. As a medicinal fungus, Polyporus mylittae Cook.et Mass. has extremely wide application value from ancient times to the present. According to historical records, Polyporus mylittae Cook.et Mass. is bitter in taste and cold in nature, and is mainly used for killing insects and eliminating accumulation, clearing heat pathogens, expelling toxic qi, treating heartache, and joint pain.
[0003] Modern pharmacological research shows that Polyporus mylittae Cook.et Mass. has good biological activity and various medicinal effects. For example, it has good anti-cancer and anti-tumor effects. A certain dose of Polyporus mylittae Cook.et Mass. protease has a significant killing effect on human gastric cancer cells MC-4; the extract of Polyporus mylittae Cook.et Mass. has a good inhibitory effect on mouse ascites cancer; the polysaccharide extract of Polyporus mylittae Cook.et Mass. can also significantly reduce the blood sugar of drug-induced diabetic mice and has a strong ability to scavenge oxygen free radicals. In recent years, Hexi Pharmaceutical has established the only Polyporus mylittae Cook.et Mass. fund in the country and produced an anti-cancer patented product, "Hexi Polyporus mylittae Cook.et Mass. Tablets", which has played a good role in the treatment of cancer, improved the immunity of patients, and reduced the toxic and side effects of radiotherapy and chemotherapy.
[0004] In taxonomy, it was early believed that Polyporus mylittae Cook.et Mass. belonged to the Basidiomycota, Agaricomycetes, Agaricales, Omphalia, and was the dried sclerotium of Omphalia lapidescens Schroet; however, some scholars also believe that Polyporus mylittae Cook.et Mass. is the sclerotium of Polyporus mylittae Cook.et Mass.. There has always been a controversy over the scientific name of Polyporus mylittae Cook.et Mass., which has restricted the healthy development of the Polyporus mylittae Cook.et Mass. industry. Recently, Zhang Weixin et al. conducted a scientific research on the scientific name of Polyporus mylittae Cook.et Mass. and proposed a new combination name: Gerronema lapidescens (Horan.) Ming Zhang & W.X. Zhang, classifying Polyporus mylittae Cook.et Mass. into the genus Gerronema. In the present invention, according to the name included in the Chinese Pharmacopoeia and the folk traditional habits, the Chinese name "Polyporus mylittae Cook.et Mass." is still used.
[0005] The market supply of Leiwan (a type of medicinal herb) mainly relies on wild resources, resulting in inconsistent product quality. Furthermore, the limited availability of wild Leiwan resources cannot meet market demand, leading to high prices. Consequently, counterfeit Leiwan materials have entered the market, hindering the healthy development of the Leiwan industry. Therefore, developing rapid and quantitative technologies for detecting the authenticity and content of Leiwan and its related products is crucial for the healthy development of the Leiwan industry and has substantial application value for the commercial production and product testing of Leiwan.
[0006] With the widespread use of molecular biotechnology, accurate identification of fungi has been greatly facilitated. ITS sequences (Internal Transcribed Spacer) serve as effective DNA barcodes for fungal identification and can be used as characteristic sequences for species identification. Therefore, we selected the ITS sequence of *Leymus chinensis* as an internal reference gene and designed specific nucleic acid molecular probes for quantitative detection of *Leymus chinensis*. Summary of the Invention:
[0007] The first objective of this invention is to provide a characteristic nucleic acid molecular sequence that can be used for rapid detection of Leiwan fruiting body samples, identification of the authenticity of Leiwan-related products, and detection of Leiwan sample content.
[0008] The present invention provides a quantitative and rapid detection method for the characteristic nucleic acid molecular sequence of *Lycopus lucidus*, characterized in that the nucleic acid sequence is derived from the ITS gene sequence of *Lycopus lucidus* (its nucleotide sequence is shown in SEQ ID NO.1, containing a total of 624 bases). The characteristic nucleotide sequence contains a portion of the bases of the *Lycopus lucidus* ITS (as shown in SEQ ID NO.2, containing a total of 96 bases).
[0009] The second objective of this invention is to provide a nucleic acid molecular probe for amplifying the above-mentioned quantitative rapid detection of the characteristic nucleotide sequence of Leiwan (a type of swollen bone), characterized in that the nucleic acid molecular probe is:
[0010] LS1F:5`-TGGTAGCGGTTGAG-3`;
[0011] LS2R:5`-TACCCTTGCGAGAT-3`.
[0012] The annealing temperatures of the aforementioned nucleic acid molecular probes LS1F and LS2R are similar. These probes do not react with *Amanita muscaria*, *Amanita gyrococephala*, *Amanita muscaria* spp. 1, or *Gymnocladus funnelii*, but exhibit extremely high binding specificity only with *Lycopodium clavatum*. In quantitative real-time PCR, the intensity of the fluorescence signal is used to detect the content of *Lycopodium clavatum* DNA in the substrate, demonstrating high sensitivity. Therefore, using these nucleic acid molecular probes for quantitative real-time PCR amplification, the authenticity of *Lycopodium clavatum* fruiting bodies and related products can be rapidly detected, and their content determined.
[0013] A third objective of this invention is to provide a kit for rapid quantitative identification of *Leiwan*, characterized in that it includes the above-mentioned nucleic acid molecular probes LS1F and LS2R, as well as conventional DNA extraction reagents and real-time PCR reaction reagents.
[0014] The fourth objective of this invention is to provide a method for rapid quantitative detection of Leiwan (a type of granuloma), characterized by using the aforementioned nucleic acid molecular probes LS1F and LS2R as amplification primers, the DNA genome of the sample to be tested as a template, and using real-time fluorescence PCR to rapidly detect Leiwan.
[0015] Based on the ITS gene sequence (SEQ ID NO.1) of *Amanita muscaria*, this invention designed specific nucleic acid molecular probes LS1F and LS2R. Using *Amanita muscaria* genomic DNA as a template, PCR was performed according to conventional quantitative real-time PCR methods (see Example 2). Before 30 cycles, only *Amanita muscaria* could elicit a fluorescent signal, while other *Amanita muscaria* species such as *Amanita kuruwa*, *Amanita gyro*, *Amanita muscaria* species 1, and *Gymnocypris funnelii* showed no Ct value (e.g., *Amanita muscaria* var. *kuruwa* ... Figure 1 This demonstrates that the nucleic acid molecular probes LS1F and LS2R of the present invention have high specificity and can be used for rapid detection of the authenticity of *Lycopodium clavatum* fruiting bodies and related products. Quantitative detection of *Lycopodium clavatum* is based on the standard curve of the *Lycopodium clavatum* ITS gene (e.g., ...). Figure 2 The correlation coefficient was 0.9998, the linear range of Ct values was 17.085-30.717, and the regression equation was y = -3.3.4059x + 21.825. Based on the regression equation, the relative content of *Lycopodium clavatum* in the tested sample can be calculated, achieving quantitative detection of *Lycopodium clavatum* fruiting bodies and related products. This invention uses real-time quantitative PCR technology for detection, with a detection limit as low as 0.025 ng / μL. The method is simple, highly specific, and quick, completing the test within 2 hours. Attached image description:
[0016] Figure 1 The method utilizes nucleic acid molecular probes LS1F and LS2R as primers to perform real-time quantitative PCR amplification of different *Amanita* genus samples using a fluorescence quantitative PCR method, and the curves of the amplification are obtained. Figure 1 As shown, only the *Leiwan* sample reached the fluorescence threshold when the Ct value was around 24 (23.747±0.014), while the other *Laosan* samples did not reach the threshold in the first 30 PCR cycles.
[0017] Figure 2Using DNA from *Lycopodium clavatum* samples of different concentrations as templates, and employing probes LS1F and LS2R as primers, amplification was performed using quantitative real-time PCR. A standard curve for the *Lycopodium clavatum* ITS gene was obtained, with a correlation coefficient of 0.9998, a linear Ct value range of 17.085–30.717, and a regression equation of y = -3.3.4059x + 21.825. The relative content of the tested *Lycopodium clavatum* samples can be calculated based on this regression equation. Detailed implementation method:
[0018] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0019] Example 1:
[0020] Extraction of Leiwan genomic DNA and acquisition of ITS gene sequence
[0021] Approximately 30 mg of dried *Leiwan* specimen was collected, and genomic DNA was extracted using a fungal DNA mini-extraction kit (Guangzhou Magen Co., Ltd.) according to the manufacturer's instructions. The *Leiwan* genomic DNA was amplified using nucleic acid primers ITS1 and ITS4 (ITS1: 5'-TCC GTAGGT GAA CCT GCGG-3', ITS4: 5'-TCC TCC GCT TAT TGA TAT GC-3', both synthesized by BGI Genomics Co., Ltd.), yielding the *Leiwan* ITS gene sequence (SEQ ID NO.1). The specific reaction was as follows: PCR was performed using a 2×PCR mix (DreamTaqtmGreen PCR Master Mix, Fermentas, MA, USA). The reaction volume was 12.5 μL, including 5 μL of 2×PCR mix, 0.25 μL of ITS1 (10 μmol / L), 0.25 μL of ITS4 (10 μmol / L), 0.25 μL of template DNA, and ddH2O was added to bring the volume to 12.5 μL. The PCR reaction program was as follows: 94℃ for 5 min pre-denaturation, 94℃ for 30 s, 55℃ for 30 s, 72℃ for 80 s, 35 cycles, 72℃ for 8 min. The PCR product was sent to BGI for sequencing. The obtained Leiwan ITS gene fragment has the nucleotide sequence shown in SEQ ID NO. 1, containing 624 bases.
[0022] Example 2
[0023] Fluorescent PCR amplification using Leiwan-specific primers
[0024] Based on the *Leiwan* ITS gene (SEQ ID NO.1), a pair of 13-14 nucleotide sequences, namely LS1F:5`-TGGTAGCGGTTGAG-3` and LS2R:5`-TACCCTTGCGAGAT-3`, were designed using primer design software Primer 5.0. The primers were synthesized by BGI Genomics. The amplified sequence, shown in SEQ ID NO.2, consisted of 96 bases. Quantitative real-time PCR was performed using 2xTaq Pro Universals SYBR qPCR Master Mix reagent (Vazyme, catalog number: Q712-02-AA), with genomic DNA from *Leiwan*, *Ulva kuruva*, *Ulva rotundifolia*, *Ulva spp. 1*, and *Entoloma funnelii* as templates. The reaction mixture consisted of a total volume of 12.5 μL: 5.0 μL SYBR qPCR Master Mix, 0.25 μL LS1F (10 μmol / L), 0.25 μL LS2R (10 μmol / L), 0.25 μL template DNA, and ddH2O to a final volume of 12.5 μL. The reaction program was 95℃ for 2 min pre-denaturation, followed by 40 cycles of 95℃ for 15 s, 50℃ for 15 s, and 72℃ for 20 s. The reaction was performed using a quantitative real-time PCR system (Applied Biosystems QuantStudio 6Flex PCR System, Thermo Fisher Scientific). Results are shown below. Figure 1 As shown, *Gnaphalium affine* reached its fluorescence threshold at an average Ct value of 24 (i.e., 23.747 PCR cycles); while other *Gnaphalium affine* species did not reach the threshold in the first 30 PCR cycles. This allows for the specific detection of *Gnaphalium affine*.
[0025] Example 3
[0026] Quantitative detection of DNA content in Leiwan (a type of fungus)
[0027] Using known samples of *Leymus chinensis* genomic DNA at different concentrations as templates, and employing molecular probes LS1F and LS2R as primers, amplification was performed according to the quantitative real-time PCR method described in Example 2. The Ct values of the quantitative real-time PCR of the *Leymus chinensis* ITS gene were obtained (see Table 1), and a standard curve was plotted (see Table 2). Figure 2 The correlation coefficient was 0.9998, the linear range of Ct values was 17.085-30.717, and the regression equation was y = -3.3.4059x + 21.825. The relative content of *Leiwan* in the tested sample can be calculated based on this regression equation. A minimum detection limit test was performed using the above-mentioned quantitative real-time PCR method, and the results showed that the detection limit was as low as 0.025 ng / μL. Quantitative detection of *Leiwan* can be achieved.
[0028] Table 1. Ct values of different concentrations of *Lycopodium clavatum* DNA samples.
[0029]
[0030] SEQ ID NO.1 (624 bases)
[0031] TTTGAGGTCAAATAGTCAAAATTGTCTTGGAAGCAAGACGGTTTGAAGCGGATGATTTA
[0032] TCAGTTCACCGCAACGAGCGTAGATATACTATCACACTCTAGTGAATGAAGCAACCACTA
[0033] ATGCATTTAAAGGGAGCCGACTCGATAAAGCCAGCAAGACACCCCTCACATCCAAAAGC
[0034] CTAACCACTTGAAAAACAGTTAAGATTTTGAGAATTTAATGACACTCAAACAGGCATAC
[0035] TCCTCGGAATACCAAGGAGTGCAAGGTGCGTTCAAAGATTCGATGACTCACTGAATTCT
[0036] GCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGAT
[0037] CCGTTGCTGAAAGTTGTATGTTATTTATCGGTCAAAGACCAACAATATGACATTCATAAG
[0038] ACTATCAAGAGTTTGTATAGACATAGGCTACGAAGTTGAAAGCAAGCAAATGAGTGCAT
[0039] AGCCTTCTATCCAAATACCCTTGCGAGATTTGAGAATTATCATAGCCTACAATAGGTGCAC
[0040] AGTGGAGAGTAGAAAAAGCGATAGAGCGAGCACATACTCCTAAGAGTCAGCTCAACCG
[0041] CTACCATTTCTTCAGTAATGATCCTTCCGC
[0042] SEQ ID NO.2 (96 bases)
[0043] TGGTAGCGGTTGAGCTGACTCTTAGGAGTATGTGCTCGCTCTATCGCTTTTTCTACTCTCC
[0044] ACTGTGCACCTATTGTAGGCTATGATAATTCTCAA.
Claims
1. A nucleic acid molecular probe for identifying Omphalestigma album, characterized by, The nucleic acid molecule probe is: LS1F: 5`-TGGTAGCGGTTGAG-3`; LS2R: 5`-TACCCTTGCGAGAT-3`.
2. A kit for rapid quantitative identification of Leimaru, characterized by, The nucleic acid molecule probe of claim 1.
3. The kit of claim 2, wherein The kit comprises conventional DNA extraction reagents and fluorescent quantitative PCR reaction reagents.
4. A method for detecting orellanine, characterized in that, The nucleic acid molecule probes LS1F and LS2R in claim 1 are used as amplification primers, the DNA genome of the sample to be detected is used as a template, and the fluorescent quantitative PCR method is used to rapidly detect the Ophiocordyceps unilateralis.