Recombinant expression system of inert carrier bacteria based on eae gene of Citrobacter rodentium and its application

Abstract

The present invention discloses a novel method based on Citrobacter rodentium ( C. rodentium ) those The present invention relates to a recombinant expression system of an inert carrier bacteria expressing the rodent Citrobacter Intimin protein. those The coding gene was introduced into the inert carrier bacteria S9 to obtain the inert carrier bacteria S9 recombinant bacteria expressing Intimin protein, and the agglutination antigen was prepared and tested. Through the indirect agglutination test, the C. rodentium This method only requires the collection of animal serum samples for agglutination tests, without the need for bacterial isolation and culture or genome extraction, and can accurately and conveniently detect C. rodentium Infect animals.

Description

Technical Field

[0001] The invention belongs to the technical field of immune serum diagnosis and detection, and specifically relates to a recombinant expression system of an inert carrier bacteria based on rodent Citrobacter rodentium eae gene and an application thereof. Background Art

[0002] In the 1970s and 1980s, Citrobacter rodentium (C. rodentium) was first isolated from diarrheal mice. At that time, it was called mouse pathogenic Escherichia coli, which can cause diarrhea and colonic mucosal hyperplasia in mice. Later, the infection of this pathogen was also reported in other rodents such as guinea pigs and Mongolian gerbils, thus expanding its host range from mice to rodents, and this type of pathogen was called rodent Citrobacter rodentium. Although there is no literature report on the ability of C. rodentium to infect other types of hosts, this laboratory test found that C. rodentium can also infect cattle, pigs, chickens and other animals and humans, indicating that C. rodentium may be a zoonotic pathogen. More than 60% of the genes in the C. rodentium genome are identical to those of human enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) and encode similar virulence factor systems, which can lead to attachment and effacing lesions (A / E lesions) after infection. A / E lesions are a characteristic intestinal lesion caused by pathogen infection, which is closely related to the tight adhesion of pathogens. However, since the intestines of small animals have colonization resistance to EPEC and EHEC, there is a lack of suitable animal infection models for in vivo studies of EPEC and EHEC. At the same time, since rodents such as mice are susceptible to C. rodentium, C. rodentium infection has been used as a "golden model" to study the pathogenic mechanisms of A / E pathogens such as EPEC and EHEC, intestinal mucosal immune responses, and host-pathogen interaction mechanisms. In addition, a study found that C. rodentium infection can promote Apc Min- / +The tumor formation process of the spontaneous cancer mouse model indicates that C. rodentium infection may be related to the progression of colon cancer. At present, it is difficult to accurately isolate and identify C. rodentium infection in vivo, especially from the intestine infected with C. rodentium. Considering that C. rodentium can grow on MacConkey selective medium, its colony morphology is similar to that of Escherichia coli, both of which are pink colonies with smooth appearance, neat edges and moist surface. At the same time, its biochemical reaction is also similar to that of Salmonella, which is easy to confuse. The isolated and cultured bacteria usually require further molecular typing for accurate identification. In particular, considering that bacterial isolation and culture require the collection of specific infection samples in the body and corresponding treatment, it takes a long time and the steps are cumbersome, which has limitations in actual detection applications. Immunological detection methods such as ELISA and colloidal gold usually require the use of special commercial detection kits, which are relatively expensive and produce cross-immunological reactions with multiple intestinal pathogens, making it difficult to accurately identify and distinguish.

[0003] Therefore, if a rapid, specific and accurate method for detecting C. rodentium infection can be explored, by introducing the eae coding gene of the rodent Citrobacter rodentium Intimin protein into a certain vector, and then expressing the Intimin protein, the recombinant bacteria expressing the Intimin protein can be obtained as the agglutination antigen, and then the indirect agglutination test can be used to directly and specifically detect the C. rodentium antibodies in human and animal serum, and there will be no need to perform bacterial isolation and culture operations. However, it is currently difficult to express the gene on the surface of the strain. On the one hand, there are difficulties in the selection of vectors. On the other hand, even if a better expression vector can be selected, the selection of the expression strain is also difficult, and it is even more difficult to express it on the surface of the strain. The conventional expression method of tight adhesion protein is through in vitro induced expression, such as the pET-28a expression vector, the eae gene is cloned into Escherichia coli BL21 for induced expression, but the tight adhesion protein expressed by this method appears in the form of cytoplasmic inclusion bodies, and the protein activity needs to be restored and purified, including urea dissolution of the inclusion bodies, Ni 2+ The processes such as nucleophilic chromatography and gradient dialysis renaturation are very complicated. Summary of the invention

[0004] Purpose of the invention: Based on the isolation, identification and cloning of the eae gene of rodent Citrobacter rodentium (C. rodentium), the technical problem to be solved is to obtain an expression cassette, recombinant vector, recombinant cell or recombinant strain (recombinant expression system) containing the (C. rodentium) eae gene.

[0005] In view of the current limitations of accurate in vivo separation and identification of rodent Citrobacter rodentium and immunological detection methods such as ELISA, as well as the problem of carrier selection and surface display expression, the technical problem to be solved by the present invention is to provide a recombinant expression system of an inert carrier bacterium based on the eae gene of rodent Citrobacter rodentium, that is, the eae gene expressing the Intimin protein of rodent Citrobacter rodentium is cloned into the pBR322 expression vector to construct a recombinant expression vector, and the recombinant expression vector is introduced into the inert carrier bacterium S9 to obtain the inert carrier bacterium S9 recombinant bacterium expressing the Intimin protein encoded by the eae gene, and the agglutination antigen is prepared and detected as an agglutination antigen, which provides a simple and convenient method for rapid and accurate detection of rodent Citrobacter rodentium infection in humans and various animals. The present invention does not require steps such as protein purification and renaturation, and the tight adhesion protein can be directly displayed and expressed on the surface of the inert carrier bacterium S9.

[0006] The technical problem that the present invention also aims to solve is to provide a construction method of the recombinant expression system and its application.

[0007] Another technical problem to be solved by the present invention is to provide the application of the recombinant expression system in preparing reagents or kits for indirect agglutination tests.

[0008] The technical problem that the present invention needs to solve is a reagent or a test kit for an indirect agglutination test.

[0009] The final technical problem to be solved by the present invention is to provide a detection reagent for specific antibodies produced by animals infected with Citrobacter rodentium (C. rodentium) to achieve specific detection of antibodies.

[0010] Technical solution: In order to solve the above technical problems, the present invention provides the eae gene of rodent Citrobacter rodentium (C. rodentium), characterized in that the nucleotide sequence of the eae gene is shown in SEQ ID NO.3.

[0011] The present invention also includes an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, which contains the eae gene.

[0012] The invention discloses a recombinant expression system of an inert carrier bacteria based on the eae gene of Citrobacter rodentium. The recombinant expression system is obtained by introducing the eae gene of Citrobacter rodentium into an expression vector to obtain a recombinant expression vector, and then introducing the recombinant expression vector into the inert carrier bacteria S9 by means of electrotransformation.

[0013] Wherein, the expression vector includes pBR322 expression vector.

[0014] The recombinant expression system does not undergo agglutination reaction with the serum of SPF mice, but undergoes agglutination reaction with the serum of mice immunized with the Intimin protein of rodent Citrobacter rodentium (C. rodentium) and the positive serum of mice infected with C. rodentium.

[0015] The recombinant expression system produces a visible agglutination reaction with the positive serum of mice infected with rodent Citrobacter rodentium (C. rodentium), but does not produce a visible agglutination reaction with the serum of rabbits infected with O157:H7 Escherichia coli and the serum of rabbits immunized with O157:H7 Escherichia coli Intimin protein, nor does it produce a visible agglutination reaction with the positive serum of mice, rabbits, pigs and chickens infected with multiple serotypes of Salmonella.

[0016] The present invention also includes a method for constructing the recombinant expression system, comprising the following steps:

[0017] 1) Obtaining the eae gene sequence of Citrobacter rodentium;

[0018] 2) The eae gene of Citrobacter rodentium (C. rodentium) was introduced into the pBR322 expression vector to construct the recombinant plasmid pBR-eae;

[0019] 3) The recombinant plasmid pBR-eae was introduced into the inert carrier bacteria S9 by electroporation to obtain the recombinant bacteria.

[0020] Wherein, the eae gene of Citrobacter rodentium (C. rodentium) in step 1) is obtained by PCR amplification, wherein the upstream and downstream primer sequences of the PCR amplification eae gene are:

[0021] eae-up: 5'- GGATCC ATGATTATTCATGGTTTTTTGCACCGGGACC-3';

[0022] Eae-down: 5' GGATCC CTATTTTACACAAACTGCAAAAGCATTTTTAT-3'.

[0023] Among them, step 3) also includes verifying that the Intimin protein is successfully expressed on the surface of the carrier bacteria S9 by an indirect agglutination test of the obtained recombinant bacteria.

[0024] The present invention also includes the use of the eae gene of rodent Citrobacter rodentium (C. rodentium), the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the recombinant expression system in preparing reagents or kits for indirect agglutination tests or in preparing detection reagents for specific antibodies produced by animals infected with Citrobacter rodentium (C. rodentium).

[0025] The present invention also includes a reagent or kit for an indirect agglutination test, which includes the eae gene of Citrobacter rodentium (C. rodentium), the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the recombinant expression system.

[0026] Beneficial effects: Compared with the prior art, the present invention has the following advantages: the present invention introduces the eae gene encoding the Intimin protein of rodent Citrobacter into the inert carrier bacteria S9 to obtain the inert carrier bacteria S9 recombinant bacteria expressing the Intimin protein, and uses it as an agglutination antigen to prepare and detect agglutination antigens. Through an indirect agglutination test, animals infected with rodent Citrobacter (C. rodentium) can be specifically detected directly. This method only requires the collection of animal serum samples for agglutination tests, and does not require operations such as bacterial isolation and culture or genome extraction, and can accurately and conveniently detect rodent Citrobacter (C. rodentium) infected animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the electrophoresis diagram of PCR amplification and identification of the eae gene of C. rodentium. Lane M is Trans 2K plus II DNA Marker, and lane 1 is the PCR amplification product of the eae gene of C. rodentium strain DBS100.

[0028] Figure 2 This is the electrophoresis diagram of PCR identification of the eae gene of the pBR-eae recombinant plasmid. Lane M is DL1000DNAMarker; Lanes 1 and 2 are PCR identification products of the positive clones of the recombinant plasmid; Lane 3 is the negative control.

[0029] Figure 3 The results of nucleic acid electrophoresis for restriction digestion of pBR-eae recombinant plasmid. Lane M (left) is 10K DNA Marker; Lane M (right) is Trans 2K plus II DNA Marker; Lanes 1 and 3 are linear DNA fragments of pBR-eae digested with BamH I; Lanes 2 and 4 are both recombinant circular plasmids pBR-eae. DETAILED DESCRIPTION

[0030] The rodent Citrobacter rodentium (C. rodentium) strain DBS100 involved in the present invention was purchased from the China Veterinary Microbial Culture Collection Center, and the inert carrier bacteria S9 was preserved by this laboratory (national invention patent: An inert carrier Salmonella and its potential application, ZL201910424369.8).

[0031] Among the samples tested in the present invention, the positive serum of mice infected with the DBS100 strain of C. rodentium (5-week-old C57BL / 6 mice infected by oral administration with 1×10 9 rodentiumDBS100 strain with CFU, repeated oral administration three times to establish infection), serum from mice immunized with the Intimin protein of Citrobacter rodentium (see the Intimin protein expression method for details). [1] ), positive sera of mice, rabbits, pigs and chickens infected with various serotypes of Salmonella were obtained and preserved by artificial infection and immunization experiments in our laboratory; positive sera of rabbits infected with O157:H7 Escherichia coli and sera of rabbits immunized with the Intimin protein of O157:H7 Escherichia coli (the expression method of Intimin protein is shown in Son WG, Graham TA, Gannon VP. Immunological Characterization of Escherichia coli O157:H7 Intiminγ1[J]. Clinical and Dlagnostic Laboratory Immunology, 2002, 9(1):46-53.) were donated by Researcher Zhang Xuehan of Jiangsu Academy of Agricultural Sciences and Professor Tang Fang of Nanjing Agricultural University, respectively.

[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0033] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0034] Example 1 Construction of a recombinant expression vector encoding Intimin from the rodent Citrobacter rodentium eae gene and its functional verification

[0035] According to the eae gene sequence of C. rodentium strain DBS100 published by NCBI (from GenBank accession number: CP038008.1), specific full-length amplification primers were designed. The upstream primer and downstream primer were:

[0036] SEQ ID NO.1:

[0037] eae-F up: 5'- GGATCC ATGATTATTCATGGTTTTTTGCACCGGGACC-3'

[0038] SEQ ID NO.2:

[0039] eae-F down: 5' GGATCC CTATTTTACACAAACTGCAAAAGCATTTTTAT-3'

[0040] The underlines represent the restriction enzyme sites of BamH I and BamH I, respectively, and the size of the amplified product is 2811 bp.

[0041] Specific identification primers were designed on the eae gene, the upstream primer eae-JF: 5'-CATGTTGGGCTATAACGTCT-3' and the downstream primer eae-JR: 5'-ATATCCTGCTTCTTGTACTCC-3', and the amplified product size was 542 bp. The above primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0042] The genome of the rodent Citrobacter rodentium strain DBS100 was used as a template, and the upstream and downstream primers eae-F / R were used for PCR amplification. The amplification system was: P505 DNA Polymerase, enzyme concentration 1U / μL (Nanjing Novozyme Biotechnology Co., Ltd.) 1μL, 2×Phata Max Buffer 5μL, dNTP mixture 1μL, upstream and downstream primers (10mM) 2μL each, DBS100 strain genome 1.5μL, ultrapure water 17.5μL. After the above system was mixed evenly, PCR amplification was performed using a thermal cycler (Bio-Red). The program was as follows: pre-denaturation at 95℃ for 3min, denaturation at 95℃ for 15s, annealing at 55.9℃ for 15s, and extension at 72℃ for 2min, for a total of 35 cycles, and further extension at 72℃ for 5min. After the amplification was completed, the temperature was lowered to 12℃. The PCR amplification product was detected by agarose gel electrophoresis, and the results were as follows: Figure 1 As shown, a DNA product of 2811 bp was amplified from the rodent Citrobacter rodentium DBS100 strain, and the PCR amplification product of the eae gene of the rodent Citrobacter rodentium DBS100 strain was recovered using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The eae gene sequence of rodent Citrobacter rodentium DBS100 is: SEQ ID NO.3:

[0043]

[0044]

[0045] The pBR322 plasmid was recovered, and the eae gene PCR amplification product of C. rodentium DBS100 and the pBR322 plasmid were digested with BamH I restriction endonuclease (NEB), and then the linear DNA fragments were connected in a 16°C metal bath overnight with T4 DNA ligase (NEB). The next day, the ligation product was transformed into DH-5α competent cells, and resistant colonies were screened by coating solid culture medium containing 100 μg / mL ampicillin. The positive clones on the plate were picked and inoculated into LB liquid culture medium containing 100 μg / mL ampicillin for growth. After the plasmid was recovered, PCR amplification was performed using the eae gene identification primers. The results are as follows: Figure 2 As shown, the PCR amplification product of the positive clone was 542 bp, which was consistent with the expected fragment size.

[0046] The recombinant plasmid was digested with BamH I and then tested by agarose gel electrophoresis. Figure 3 As shown, the BamH I digestion product of the recombinant plasmid pBR-eae carrying the eae gene is a 4215 bp linear pBR322 vector and a 2811 bp eae linear DNA fragment, which is consistent with the expected fragment size and was verified by DNA sequencing (Nanjing Qingke Biotechnology Co., Ltd.).

[0047] The recombinant plasmid pBR-eae was introduced into the inert carrier bacteria S9 by electroporation to obtain the recombinant bacteria. The method was as follows: 2 μL of the recombinant plasmid was added to 100 μL of competent cells, mixed and injected into the electroporation cup. The electroporation parameters were set to A9r mode, voltage 2.2 kV, and resistance 200 ohms. After the electroporation, the electroporation cup was washed with LB medium and thoroughly mixed with the mixed solution. Cultured at 37°C for 1 hour, centrifuged at 4000r for 5 minutes, the supernatant was discarded, the remaining bacterial liquid was coated on the LB plate, and then inverted and cultured at 37°C overnight. The next day, positive clones were screened by LB plates containing Amp resistance, and the recombinant bacteria were identified after correct identification. The recombinant bacteria were grown in LB liquid culture medium containing 100 μg / mL ampicillin for 14 hours, centrifuged at 4000rpm for 5 minutes, and the supernatant was discarded. It was resuspended with an equal volume of sterile saline, and the bacterial suspension was prepared after continuous centrifugation and washing twice (final concentration 5×10 9CFU / mL) is the recombinant bacteria of inert carrier bacteria S9 expressing Intimin protein (detection of agglutination antigen). The detection agglutination antigen was subjected to indirect agglutination test with SPF mouse serum and positive serum of mice infected with rodent Citrobacter rodentium (C. rodentium) DBS100, and the inert carrier bacteria S9 was used as a negative control. The results are shown in Table 1. Neither the recombinant strain expressing Intimin protein S9 nor the inert carrier bacteria S9 had agglutination reaction with SPF mouse serum; the recombinant strain expressing Intimin protein S9 could produce visible agglutination reaction with the serum of mice immunized with Intimin protein of rodent Citrobacter rodentium (C. rodentium) DBS100 and the positive serum of mice infected with rodent Citrobacter rodentium (C. rodentium) DBS100, but the inert carrier bacteria S9 did not have agglutination reaction with the above two sera. This indicates that the Intimin protein encoded by the eae gene of rodent Citrobacter rodentium was successfully expressed on the surface of the inert carrier bacteria S9.

[0048] Table 1 Functional verification of S9 recombinant strain expressing Intimin protein

[0049]

[0050] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0051] Example 2 Specificity and sensitivity of intimin agglutination antibody detection of S9 recombinant strain expressing intimin protein

[0052] Based on the functional verification and clarification of the Intimin protein S9 recombinant strain encoded by the eae gene of Citrobacter rodentium, the specificity and sensitivity of the Intimin agglutination antibody detection of the recombinant bacteria were further tested. The specific implementation procedures are as follows: the two bacterial suspensions of the control system inert carrier bacteria S9 and the recombinant strain expressing the Intimin protein S9 were respectively tested with serum antibodies from different background sources using agglutination tests to verify the specificity of the agglutination test antibody detection system. The tested sera included: 10 positive sera from mice infected with Citrobacter rodentium (C. rodentium) DBS100, 10 10 parts of mouse sera immunized with the Intimin protein of rodent Citrobacter rodentium (C. rodentium) DBS100, 10 parts of rabbit positive sera infected with Escherichia coli O157:H7, 10 parts of rabbit sera immunized with the Intimin protein of Escherichia coli O157:H7, 10 parts of mouse positive sera infected with Salmonella typhimurium, 10 parts of rabbit positive sera infected with Salmonella enteritidis, 10 parts of rabbit positive sera infected with Salmonella typhimurium, 10 parts of pig positive sera infected with Salmonella choleraesuis, 10 parts of chicken positive sera infected with Salmonella pullorum, 10 parts of chicken positive sera infected with gallinaceous typhoid, and 10 parts of chicken positive sera infected with Salmonella enteritidis. The test results are shown in Table 2. All the tested sera did not produce visible agglutination reactions with the inert carrier bacteria S9; 10 positive sera from mice infected with rodent Citrobacter rodentium (C. rodentium) DBS100 and 10 sera from mice immunized with the Intimin protein of rodent Citrobacter rodentium (C. rodentium) DBS100 could produce visible agglutination reactions with the recombinant strain expressing the Intimin protein S9, while 10 sera from rabbits infected with O157:H7 Escherichia coli or immunized with the Intimin protein did not produce visible agglutination reactions with the recombinant strain expressing the Intimin protein S9; positive sera from mice, rabbits, pigs, and chickens infected with multiple serotypes of Salmonella did not produce agglutination reactions with the recombinant strain expressing the Intimin protein S9.

[0053] Table 2 Specificity of agglutination antibody detection of the recombinant strain S9 expressing Intimin protein (S9+CR eae)

[0054]

[0055]

[0056] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0057] Table 3 Sensitivity of the agglutination antibody detection system of the recombinant strain expressing Intimin protein S9 (qualitative)

[0058]

[0059] Table 4 Sensitivity of the agglutination antibody detection system expressing the Intimin protein S9 recombinant strain (quantitative)

[0060]

[0061] C. rodentium DBS100 was used to artificially infect C57BL / 6 mice. It was found that specific antibodies to C. rodentium DBS100 could be detected in the serum of infected mice as early as the 8th day after infection. The test results are shown in Table 3. The positive serum of mice infected with C. rodentium DBS100 was diluted 2n times: 10 μL of sterile saline was added to each well of the 96-well plate, and then 10 μL of serum was drawn and added to the first well of each column. After being fully mixed with sterile saline, 10 μL of diluted serum was added to the next well, and this cycle was repeated until the serum was diluted to 2n times. 6 The serum of each dilution was subjected to agglutination test with the inert carrier bacteria S9 and the recombinant strain expressing the Intimin protein S9, respectively. The last dilution at which agglutinated particles appeared was taken as the titer of the serum agglutination antibody. The results are shown in Table 4. In the serum of mice on the 15th day after infection, when the serum stock solution was diluted 64 times, the recombinant strain expressing the Intimin protein S9 could still agglutinate with the positive serum of mice infected with rodent Citrobacter rodentium DBS100, and the agglutination result could be determined within 2 minutes.

Claims

1. Based on Citrobacter rodentium ( C. rodentium )of eae The recombinant expression system of an inert carrier bacteria of a gene is characterized in that: The recombinant expression system is eae The gene is introduced into the expression vector to obtain a recombinant expression vector, and then the recombinant expression vector is introduced into the inert carrier bacteria S9 by electrotransformation. eae The nucleotide sequence of the gene is shown in SEQ ID NO.3, and the deposit number of the S9 is CGMCC No.17340.

2. The recombinant expression system according to claim 1, characterized in that The recombinant expression system did not agglutinate with SPF mouse serum, but did agglutinate with rodent Citrobacter rodentium ( C. rodentium ) and the serum of mice immunized with the Intimin protein of rodents ( C. rodentium ) positive sera from infected mice produced agglutination reactions.

3. The recombinant expression system according to claim 2, characterized in that The recombinant expression system is combined with Citrobacter rodentium ( C. rodentium ) produced visible agglutination reaction with the positive sera of mice infected with O157:H7 Escherichia coli, but did not produce visible agglutination reaction with the positive sera of rabbits infected with O157:H7 Escherichia coli and the sera of rabbits immunized with O157:H7 Escherichia coli Intimin protein, nor did it produce visible agglutination reaction with the positive sera of mice, rabbits, pigs and chickens infected with multiple serotypes of Salmonella.

4. The method for constructing a recombinant expression system according to any one of claims 1 to 3, characterized in that: The following steps are involved: 1) Citrobacter rodentium ( C. rodentium )of eae Obtaining a gene sequence, the sequence is shown in SEQ ID NO.3; 2) Citrobacter rodentium ( C. rodentium )of eae The gene is introduced into the expression vector to construct a recombinant plasmid; 3) The recombinant plasmid was introduced into the inert carrier bacteria S9 by electroporation to obtain the recombinant bacteria, and the deposit number of S9 is CGMCC No.17340.

5. The method for constructing a recombinant expression system according to claim 4, characterized in that: Citrobacter rodentium eae The gene was obtained by PCR amplification. eae The upstream and downstream primer sequences of the gene are: eae -up:5’- GGATCC ATGATTATTCATGGTTTTTGCACCGGGACC -3’; eae -down:5’- GGATCC CTATTTTACACAAACTGCAAAAGCATTTTTAT- 3’。 6. The method for constructing a recombinant expression system according to claim 4, characterized in that: Step 3) also includes verifying that the obtained recombinant bacteria are successfully expressed on the surface of the carrier bacteria S9 by an indirect agglutination test. The deposit number of S9 is CGMCC No.17340.

7. Use of the recombinant expression system according to any one of claims 1 to 3 in preparing a reagent or a kit for an indirect agglutination test of Citrobacter rodentium or in preparing Citrobacter rodentium ( C. rodentium ) is used as a detection reagent for specific antibodies produced by infected animals, the eae The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

8. A reagent or kit for an indirect agglutination test, characterized in that: It comprises the recombinant expression system according to any one of claims 1 to 3.

Images