A cadmium-resistant gene AbMT derived from Agaricus blazei and its application

Abstract

The present invention relates to a cadmium-resistant gene derived from Agaricus blazei <h2 style=";text-align:left;direction:ltr">AbMT The cadmium-resistant gene <h2 style=";text-align:left;direction:ltr"> AbMT The sequence of cadmium resistance gene is shown in SEQ ID NO.1 or SEQ ID NO.3. <h2 style=";text-align:left;direction:ltr"> AbMT The expression vector was constructed by using the sequence of the gene and transformed into yeast cells, and it was found that the gene can significantly improve the cadmium resistance of yeast. The invention is of great significance for studying the cadmium resistance of fungi and breeding new varieties of cadmium-resistant Agaricus blazei.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and environmental protection, and specifically relates to a cadmium-resistant gene AbMT derived from Agaricus blazei and an application thereof. Background Art

[0002] Agaricus blazei has high food and medicinal value and development prospects, but it has a strong ability to enrich cadmium (Cd), which can enrich Cd in the cultivation raw materials into mycelium and fruiting bodies, endangering food safety and people's health, and seriously restricting the sustainable development of the Agaricus blazei industry. Therefore, it is necessary and important to explore a gene that can regulate cadmium migration.

[0003] The present invention compares the transcriptome data of Agaricus blazei under cadmium stress, finds the key candidate gene AbMT for cadmium tolerance difference, clones the full length of the gene through bioinformatics analysis, constructs an expression vector and transforms it into yeast cells, and finds that the gene can significantly improve the cadmium tolerance of yeast. The invention is of great significance for studying the cadmium tolerance of fungi and the breeding of new varieties of Agaricus blazei to tolerate cadmium. Summary of the invention

[0004] The purpose of the present invention is to provide a cadmium-resistant gene AbMT derived from Agaricus blazei and application thereof.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] A cadmium-resistant gene AbMT derived from Agaricus blazei. The sequence of the cadmium-resistant gene AbMT is shown as SEQ ID NO.1 or SEQ ID NO.3, and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.4.

[0007] An expression vector containing the cadmium-resistant gene AbMT.

[0008] The invention discloses an application of the cadmium-resistant gene AbMT in improving the cadmium resistance of fungi, wherein the fungi are yeast and Agaricus blazei.

[0009] Application of cadmium-resistant gene AbMT in breeding of new cadmium-resistant Agaricus blazei varieties.

[0010] The significant advantages of the present invention are:

[0011] The AbMT gene of the invention can significantly improve the cadmium resistance of fungi, provide a basis for artificially controlling the expression of cadmium resistance-related genes, and play an important role in the cultivation of fungi with enhanced cadmium resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 : Differential expression of AbMT gene in Agaricus blazei strain J77 and Agaricus blazei strain J1.

[0013] Figure 2 : Results of full-length cloning of AbMT gene ORF. Lane 1, J77; Lane 2, J1; Lane M, Marker DL2000.

[0014] Figure 3 :Screening and identification of positive transformants.

[0015] Figure 4 : Cadmium tolerance of transgenic strains. DETAILED DESCRIPTION

[0016] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0017] Example 1

[0018] The applicant of the present invention found in previous studies that Agaricus blazei strain J77 is a low Cd accumulation strain, while Agaricus blazei strain J1 is a high Cd accumulation strain. The expression levels of AbMT gene in J77 and J1 under cadmium stress were significantly different ( Figure 1 ), thus it is speculated that the AbMT gene is related to cadmium accumulation and tolerance of Agaricus blazei.

[0019] 1. AbMT gene cloning

[0020] 1.1 Mycelium culture

[0021] (1) The formula of PDA enriched medium is as follows: 230 g potato, 20 g sucrose, 2 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate, 10 mg vitamin B1, add distilled water to make up to 1 L, put it in an autoclave at 120°C for 20 min, cool it to room temperature and set aside.

[0022] (2) Mycelium samples: The in vitro cultures of Agaricus blazei strain J77 and Agaricus blazei strain J1 were inoculated into PDA-enriched liquid culture medium, respectively. After static culture at 25°C for 20 days, the mycelium was collected, rapidly frozen with liquid nitrogen, and stored in a -80°C refrigerator for later use.

[0023] 1.2 RNA extraction and first-strand cDNA synthesis

[0024] Mycelial RNA was extracted using the Trizol method:

[0025] (1) The sample was ground with liquid nitrogen and 1 mL of Trizol was added. The mixture was left at room temperature for 5 min.

[0026] (2) Add 200 μL of chloroform (trichloromethane) to every 1 mL of Trizol-lysed sample;

[0027] (3) Cover the tube tightly, shake it vigorously up and down for 15 seconds, and leave it at room temperature for 3 minutes;

[0028] (4) Centrifuge at 12,000 g for 15 min at 4°C;

[0029] (5) After centrifugation, the liquid in the tube will be separated into layers. Transfer the top layer of colorless liquid (about 50% of the total volume) to a new RNase-free EP tube;

[0030] (6) Add 500 μL of 100% isopropanol to the new upper layer. Incubate at room temperature for 10 min and centrifuge at 12,000 g for 10 min at 4°C.

[0031] (7) After centrifugation, the RNA will precipitate at the bottom of the tube handle. Carefully remove the supernatant, add 75% ethanol (75% ethanol is prepared with DEPC water), invert eight times, and centrifuge at 7500g for 5 min at 4°C.

[0032] (8) After removing the ethanol, open the lid and place at room temperature for 5 to 10 minutes to obtain the purified RNA. Store at -80°C until needed.

[0033] cDNA synthesis: The first strand of cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit from Fermentas. The specific steps were carried out according to the kit instructions.

[0034] 1.3 Full-length amplification of AbMT gene ORF sequence

[0035] (1) Based on the AbMT gene sequence obtained by transcriptome sequencing, two specific primers B501F1 (5'-CTTTATTCATCAATCGAC-3') and B501R1 (5'-CACTAGTCCCCGCGCTGT-3') were designed using Primer Premier 5.0 software. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The full-length ORF sequence of the AbMT gene of the Agaricus blazei strain was amplified using the two specific primers.

[0036] (2) PCR amplification of target gene. The amplification system was 50 μL: 15.0 μL PCR-Grade Water, 25.0 μL 2×Ex taqBuffer (takara), 1.0 μL dNTP Mix (10 mM), 1.0 μL Ex taq (takara), 5.0 μL cDNA first strand, 1.5 μL primer F (10X), 1.5 μL primer R (10X). The amplification reaction conditions were: 94°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C final extension for 10 min.

[0037] (3) The PCR product was electrophoresed on 1.0% agarose gel at 120V for 30 min, the target band was quickly cut out under ultraviolet light, and the target band was recovered using the OMEGA gel recovery kit.

[0038] (4) The purified PCR product was connected to the cloning vector pMD-18-T according to the system in the table below at 16°C for 30 minutes (Solution I is provided in conjunction with the pMDTM18-T Vector Cloning Kit).

[0039] Table 1 Cloning vector connection system

[0040]

[0041] (5) Take E. coli DH5α competent cells and place them in an ice box to melt. Gently mix the ligation product with 100 μL of melted DH5α competent cells, and then place them in an ice bath for 30 minutes. Add 100 μL of melted DH5α competent cells to the gel recovery solution as a negative control. After the ice bath, heat at 42°C for 90 seconds, quickly place them in an ice box and let them stand for 2 minutes. Add 890 μL of ordinary LB liquid culture medium and culture at 37°C and 160 rpm / min for 50 minutes. After the culture is completed, use a pipette to take 200 μL of the culture solution until it contains 100 mg﹒ L -1 Amp on the LB plate, use a sterile glass coating rod to spread; after the coating is completed, invert and culture at 37℃ for 12h; after culture, use a sterile inoculation needle to pick a single colony and place it on a plate containing 100mg﹒ L -1 Amp in LB liquid medium, and then expanded culture at 37°C, 225 rpm / min for 7 h.

[0042] (6) Perform bacterial culture PCR according to the ORF amplification system and conditions, and the PCR products are subjected to 1% agarose gel electrophoresis ( Figure 2 ), and selected the positive clones and sent them to Shanghai Biotechnology Co., Ltd. for sequencing. The sequencing results are as follows:

[0043] The full-length sequence of AbMT gene ORF of J77 (SEQ ID NO.1):

[0044] CTTTATTCATCAATCGACA ATG CCGGCTACTATGTGCGCTTCCAAATGTGGTGATGCATGTGCATGCATTAGTGATTGTCGATGCAGTTTGAACAGCAACATGGCTGTTCCGACGAATAAGGCTAACTGTGGCATGTCATCTTGTCACTGCGGCGATGGTTGCGCATGTAAACCTGGGGAATGCAGGTGCAAT TAA ACAGCGCGGGGACTAGTG

[0045] The full-length sequence of AbMT gene ORF of J1 (SEQ ID NO.2):

[0046] CTTTATTCATCAATCGACA ATG CCGGCTACTATGTGCGCTTCCAAATGTGGTGATGCATGTGCATGCATTAGTGATTGTCGATGCAGTTTGAACAGCAAGATGGCTGTTCCGACGAATAAGGCTAACTGTGGCATGTCATCTTGCCACTGCGGCGATGGTTGCGCATGTAAACCTGGGGAATGCAGGTGCAAT TAA ACAGCGCGGGGACTAGTG

[0047] It can be seen that the total length of the AbMT gene ORF of J77 and J1, including the start codon and the stop codon, is 177 bp, encoding 58 amino acids. The ORFs of J77 and J1 are only different in two bases, the C at the 81st bp and the T at the 126th bp in the ORF of J77 correspond to G and C in J1, respectively.

[0048] 2. AbMT gene transformation into yeast and cadmium resistance analysis

[0049] 2.1 Construction of eukaryotic expression vector

[0050] (1) Based on the full-length sequence of the AbMT gene ORF of J77, the sequence was optimized in combination with the yeast codon preference. The optimized sequence (SEQ ID NO.3) is:

[0051] ATGCCAGCTACCATGTGTGCCTCTAAATGTGGTGACGCCTGTGCCTGTATCTCTGACTGTAGATGCTCGCTGAACTCGAACATGGCTGTGCCAACTAACAAGGCCAACTGCGGTATGTCGTCTTGTCACTGTGGTGATGGTTGCGCTTGTAAGCCAGGTGAGTGTAGATGTAAC. The optimized sequence was connected to the His tag sequence and inserted into the pUC19 Vector to obtain the pUC 19-His-AbMT plasmid.

[0052] (2) The pUC19-His-AbMT plasmid was transformed into Escherichia coli DH5α. After transformation, positive clones were selected for identification and sequencing. After the results were correct, the plasmid was extracted. The plasmid extraction was carried out according to the operating instructions of the OMEGA Plasmid Extraction Kit Plasmid Mini Kit I.

[0053] (3) According to the restriction enzyme digestion system in Table 2, the plasmid pPIC3.5K and the extracted plasmid pUC19-His-AbMT were double-digested with BamH I and Not I, respectively.

[0054] Table 2 Double enzyme digestion system

[0055]

[0056] (4) The digested products were purified and recovered, and ligated at 16°C overnight. The ligation system is shown in Table 3.

[0057] Table 3 Connection system between target fragment and pPIC3.5K

[0058]

[0059] (5) The ligation product is transformed into Escherichia coli DH5α to obtain recombinant Escherichia coli.

[0060] (6) The recombinant E. coli was inoculated into 3 mL of LB liquid medium (Amp concentration was 1 mg mL -1 , Kan concentration is 50ug﹒ mL -1 ) and cultured at 37°C overnight; the next day, inoculated into 300 mL of liquid LB medium (Amp concentration was 1 mg﹒mL -1 , Kan concentration is 50ug﹒ mL -1 ), and then culture at 37°C overnight before taking out the bacterial solution.

[0061] (7) Extract plasmids by referring to the steps of Changzhou Tiandirenhe Plasmid DNA Large Scale Extraction Kit.

[0062] (8) The extracted recombinant plasmid was linearized with SacI. The enzyme digestion system (100 μL) included: 36 μL ultrapure water, 50 μL recombinant plasmid, 10 μL buffer, and 4 μL SacI enzyme. The enzyme digestion was carried out in a 37°C water bath overnight.

[0063] (9) Perform linear recovery.

[0064] 2.2 Expression vector transformation into Pichia pastoris

[0065] The linearized plasmid was electroporated into Pichia pastoris GS115 competent cells, and the electroporation parameters were: voltage 1500V, time 5ms, OD600 value of GS115 competent cells was 0.8. pPIC3.5K empty vector was used as control.

[0066] 2.3 Screening of positive transformants

[0067] RDB plates were coated and G418 screening was performed (G418 concentration was 1 mg mL -1 ), cultured for 4 days, single colonies were picked for culture, and the bacterial liquid of single colonies was identified by PCR using specific primers ( Figure 3 ), and obtain the genetically engineered Pichia pastoris GS115-AbMT transformed with the exogenous gene AbMT. The specific primer sequences are as follows:

[0068] F: 5'-TCAGGGATCCGCCACCATGGACATGCCAGCTACC-3',

[0069] R: 5'-CGTAGCGGCGCGTTACTTGTACAGCTCGTCCAT-3'.

[0070] The PCR reaction procedure is as follows:

[0071]

[0072] 2.4 AbMT gene function study

[0073] The genetically engineered strain of Pichia pastoris GS115-AbMT was subjected to Cd stress and found that within 12 hours of stress, low concentrations of Cd 2+ (0~6mg﹒L -1 ) stress, GS115-AbMT did not show Cd tolerance advantage, but high concentration of Cd 2+ (6~12mg﹒L -1 ) stress, the growth of GS115-AbMT strain was stronger than that of GS115 transformed with pPIC3.5K; after 12 hours of stress, both at low concentrations of Cd 2+ Stress or high concentration of Cd 2+Under stress, GS115-AbMT showed stronger Cd tolerance than GS115 transfected with pPIC3.5K ( Figure 4 ).

[0074] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A cadmium-resistant gene from Agaricus blazei AbMT , characterized in that: The cadmium resistance gene AbMT The sequence is shown as SEQ ID NO.1 or SEQ ID NO.

3.

2. A gene containing the cadmium resistance gene according to claim 1 AbMT expression vector.

3. The cadmium-resistant gene according to claim 1 AbMT Application in improving cadmium resistance of fungi, characterized by: The fungi are yeast and Agaricus blazei.

4. The cadmium-resistant gene according to claim 1 AbMT Application in the breeding of new cadmium-resistant Agaricus blazei varieties.

Images