Enterovirus vector and uses thereof
By optimizing the transmembrane region design of enterovirus vectors and introducing Furin recognition regions or T2A cleavage sites, exogenous membrane proteins and secretory proteins were successfully expressed, solving the problem of enterovirus vectors in expressing signal peptide proteins and expanding their application in vaccines and antiviral drugs.
Patent Information
- Application Number
- CN202211571355.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-08
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2042-12-08
AI Technical Summary
Existing enterovirus vectors have difficulty stably expressing exogenous proteins carrying signal peptides, especially membrane proteins and secretory proteins, which limits their application in vaccine and antiviral drug development.
By optimizing the transmembrane region design of enterovirus vectors and introducing Furin recognition regions or T2A cleavage sites, enterovirus vectors capable of expressing exogenous membrane proteins and secreted proteins were constructed, including the EV71replicon vector and the CA16 infectious clone, using Gluc luciferase as a reporter gene.
This study achieved stable expression of exogenous membrane and secretory proteins in enterovirus vectors, broadening their application in vaccines and antiviral drugs, improving genetic stability, and providing an efficient research tool.
Smart Images

Figure CN116804210B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to an enterovirus vector and its application, belonging to the field of biomedical technology. Background Technology
[0002] Enteroviruses belong to the family Picornaviridae, specifically the family Single-stranded Positive-sense RNAviridae. The genus comprises 15 species, namely Enterovirus A-I and Rhinovirus A-C. Common enteroviruses include Enterovirus A71 (EVA71), Coxsackievirus A10 (CVA10), Human rhinovirus A1 (HRVA1), and Poliovirus (PV). The viral genome is approximately 7.5 kb in length and consists of a 5' Untranslated Region (5'UTR), a coding region, and a 3' Untranslated Region (3'UTR). After infecting a cell, the virus releases its genomic RNA into the cytoplasm for replication and translation. The viral genome contains a reading frame. First, translation occurs in the cytoplasm to form a polyprotein comprising both structural and non-structural proteins. Subsequently, virally encoded proteases 2A and 3C cleave the polyprotein to form four mature structural proteins—VP1, VP2, VP3, and VP4—and seven non-structural proteins—2A, 2B, 2C, 3A, 3B, 3C, and 3D. Enterovirus genome replication occurs within the replication complex (RO) located in the cytoplasm. Mature replication-related proteins enter the RO helper RNA for replication, while structural proteins encapsulate the viral RNA to form icosahedral mature viral particles, which are then released extracellularly.
[0003] Enterovirus infection can trigger a systemic mucosal immune response, making it a highly promising viral vector. Enterovirus genome-based vector research falls into two main categories based on vector structure: one uses the full-length viral genome as a vector, directly inserting the foreign gene into the viral reading frame. These vectors can self-replicate and produce mature viral particles while expressing the foreign protein; the other uses replicones (sequences lacking part or all of the structural protein genome) as vectors, placing the foreign protein sequence within the viral structural protein coding region. These vectors can self-replicate, but lack the viral structural protein to produce mature viral particles when expressing the foreign protein. Since the enterovirus life cycle is entirely within the cytoplasm, enterovirus genome-based vectors, while capable of expressing exogenous cytoplasmic proteins, struggle to express exogenous proteins carrying signal peptides, such as membrane proteins and secretory proteins. For example, according to literature, PVreplicon vectors cannot directly express influenza virus hemagglutinin (HA); only when the vector is designed as a bicistronic vector can HA protein be successfully expressed. However, studies have also shown that the genomes of these bicistronic enteroviruses are unstable and are completely lost after only a few passages. Therefore, unmodified enterovirus vectors are unable to express various immunogens that are mainly glycoproteins (membrane proteins or secretory proteins with signal peptides), limiting the development and application of enterovirus vectors.
[0004] Gluc luciferase is a novel luciferase isolated from large marine copepods. The luminescence intensity of the reaction catalyzing the oxidation of the substrate coelenterate by Gluc is stronger than that of firefly luciferase (Fluc). Unlike traditional Fluc, Gluc contains a secreted signal peptide, making it a naturally occurring secreted protein. This makes it particularly suitable as a vector for vector-based research, serving as a reporter gene carrying the signal peptide.
[0005] This invention uses Glucoside as a reporter gene and optimizes the transmembrane region sequence of exogenous proteins to enable enteroviral vectors to successfully express exogenous membrane proteins. Furthermore, based on the transmembrane region design, the addition of Furin recognition and T2A cleavage sites successfully expressed exogenous secreted proteins. In addition, this invention also marks the first successful preparation of an infectious CA16 clone carrying a membrane protein reporter gene and the rescue of the CA16-memHiBiT reporter virus. These designs enable enteroviral vectors to overcome their inherent limitations and express exogenous proteins with subcellular localization, thus broadening the application scope of enteroviral vectors. Summary of the Invention
[0006] The purpose of this invention is to solve the technical problem of how to stably express exogenous proteins carrying signal peptides in enterovirus vectors.
[0007] The present invention provides an enterovirus vector with the EV71 replicon as the backbone, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0008] This invention provides an application of an enterovirus vector in the preparation of vaccines and antiviral drugs.
[0009] This invention provides an enterovirus vector capable of expressing other membrane proteins, wherein the enterovirus vector comprises at least an EV71 replicon with the nucleotide sequence shown in SEQ ID No. 1 and a transmembrane region fragment; the transmembrane region fragment comprises at least PDGFRβTM with the nucleotide sequence shown in SEQ ID No. 3, SpikeTM with the nucleotide sequence shown in SEQ ID No. 4, CD28TM with the nucleotide sequence shown in SEQ ID No. 5, PDGFRβ+SpikeTM with the nucleotide sequence shown in SEQ ID No. 6, or Linker+TM+Linker with the nucleotide sequence shown in SEQ ID No. 7.
[0010] This invention provides the application of an enterovirus vector capable of expressing other membrane proteins in the preparation of vaccines and antiviral drugs.
[0011] The present invention provides an enterovirus vector capable of expressing secretory proteins, the enterovirus vector comprising the above-mentioned enterovirus vector capable of expressing other membrane proteins and a cleavage site fragment; the cleavage site fragment includes at least a Furin recognition region of the nucleotide sequence shown in SEQ ID NO.8, an mFurin recognition region of the nucleotide sequence shown in SEQ ID NO.9, or a T2A of the nucleotide sequence shown in SEQ ID NO.10.
[0012] This invention provides the application of an enterovirus vector capable of expressing secretory proteins in the preparation of vaccines and antiviral drugs.
[0013] This invention provides a method for constructing an infectious CA16 clone carrying a membrane-display reporter gene. Using pSVA-CA16 as a template, the memHiBiT membrane-display reporter gene is introduced, and through seamless recombination cloning, a sequenced pSVA-CA16-memHiBiT infectious clone is obtained. The nucleotide sequence of the CA16-memHiBiT is shown in SEQ ID NO.11. The memHiBi membrane-display reporter gene fragment is inserted between the 5'UTR and the P1 fragment.
[0014] This invention provides an application of an infectious CA16 clone carrying a membrane-display reporter gene in screening antiviral drugs.
[0015] This invention provides a method for constructing an enterovirus vector capable of expressing other membrane proteins. Using a vector constructed with the genome of a serotype enterovirus as a backbone as a template, different transmembrane region fragments are amplified by PCR. Then, through seamless cloning, clones with different transmembrane region fragments are constructed. Clones that are verified by sequencing are screened, and plasmids are extracted and preserved. The transmembrane region fragments include at least the nucleotide sequence PDGFRβTM shown in SEQ ID NO.3, SpikeTM shown in SEQ ID NO.4, CD28TM shown in SEQ ID NO.5, PDGFRβ+SpikeTM shown in SEQ ID NO.6, or Linker+TM+Linker shown in SEQ ID NO.7.
[0016] This invention provides a method for constructing an enterovirus vector capable of expressing secretory proteins, comprising the following steps:
[0017] Step 1: Using vector one, constructed with the genome of a serotype virus in the Enterovirus genus as a backbone, as a template, different transmembrane fragments are amplified by PCR. Then, through seamless cloning, vector two with different transmembrane fragments is constructed. Clones that are verified by sequencing are screened, and plasmids are extracted and preserved. The transmembrane fragments include at least the nucleotide sequence PDGFRβTM shown in SEQ ID NO.3, the nucleotide sequence SpikeTM shown in SEQ ID NO.4, the nucleotide sequence CD28TM shown in SEQ ID NO.5, the nucleotide sequence PDGFRβ+SpikeTM shown in SEQ ID NO.6, or the nucleotide sequence Linker+TM+Linker shown in SEQ ID NO.7.
[0018] Step 2: Using the vector 2 obtained in Step 1 as a template, seamless cloning technology is used to introduce cleavage site fragments respectively; thereby constructing an enterovirus vector 3 that can express secretory proteins; the cleavage site fragments include at least the Furin recognition region of the nucleotide sequence shown in SEQ ID NO. 8, the mFurin recognition region of the nucleotide sequence shown in SEQ ID NO. 9, or the T2A of the nucleotide sequence shown in SEQ ID NO. 10.
[0019] Compared with the prior art, the present invention has the following beneficial effects:
[0020] 1. The EV71replicon vector in this invention is constructed based on PL451 as a backbone. The luciferase reporter gene is inserted between the 5'UTR of the replicon and the P2 gene, which is beneficial to the efficient expression of the exogenous gene.
[0021] 2. Based on the life cycle characteristics of enteroviruses, this invention designs a transmembrane region applicable to all enterovirus vectors. Exogenous proteins carrying this transmembrane region can be translated normally without affecting the replication and translation of the enterovirus itself.
[0022] 3. Based on the transmembrane region design, the introduction of the Furin recognition region or the T2A sequence can enable enterovirus vectors to express secretory proteins; in addition, the combination of T2A and the Furin recognition region can further improve the efficiency of secretion.
[0023] 4. This invention overcomes the limitations of traditional enterovirus vectors by utilizing an optimized transmembrane region design and the introduction of T2A and Furin sites to achieve the expression of exogenous membrane-displaying and secretory proteins by enteroviruses. Common immunogenic proteins are mostly glycoproteins; the design of this invention allows enterovirus vectors to be applied to various fields such as vaccine development and tumor immunotherapy.
[0024] 5. This invention utilizes the novel transmembrane region design described above to construct an infectious CA16 clone carrying a membrane-display reporter gene: pSVA-CA16-memHiBiT. After transfecting cells with RNA transcribed from this clone in vitro, CA16-memHiBiT viral particles carrying the memHiBiT luciferase reporter gene are produced. Cell infection experiments have verified the activity of the reporter gene carried by this recombinant virus and confirmed that the virus can also induce cytopathic effects in cultured cell lines. This indicates that the recombinant virus possesses similar growth characteristics and other virological features to its parent virus. Furthermore, this novel infectious CA16 clone can serve as a powerful tool for basic and applied research related to the CA16 virus.
[0025] 6. This invention verifies, through luciferase activity assay, that the CA16-memHiBiT virus rescued by the CA16 infectious clone carrying the memHiBiT luciferase reporter gene constructed in this invention can be stably passaged in Vero cells for more than 20 times in vitro without a decrease in luciferase activity. In existing reports, viruses rescued by enterovirus infectious clones carrying exogenous genes can only be stably passaged in cells for a maximum of 5 times. The CA16-memHiBiT virus rescued by this invention has high genetic stability. Stable CA16-memHiBiT virus will provide a more efficient and user-friendly tool for subsequent viral mechanism research and antiviral drug screening. Attached Figure Description
[0026] Figure 1 A schematic diagram of the optimized transmembrane region scheme in the EV71replicon carrier;
[0027] Figure A shows a schematic diagram of the transmembrane region optimization scheme; Figure B shows the luciferase activity of cells transfected with 71rep-Gluc-TM carrying different transmembrane regions.
[0028] Figure 2 A schematic diagram illustrating the expression of secreted proteins using the EV71replicon vector;
[0029] Figure A shows the design diagram of the secretory protein; Figure B shows the percentage of luciferase expressed in the cytoplasm, membrane surface, and supernatant after transfection with 71rep-Gluc-TM, 71rep-Gluc-Furin-TM, and 71rep-Gluc-mFurin-TM; Figure C shows the percentage of luciferase expressed in the cytoplasm, membrane surface, and supernatant after transfection with 71rep-Gluc-T2A-TM and 71rep-Gluc-T2A-Furin-TM.
[0030] Figure 3 A schematic diagram illustrating the preparation of the infectious clone of pSVA-CA16-memHiBiT and the passage stability of the rescued CA16-memHiBiT virus.
[0031] in,
[0032] Figure A shows the design of the infectious clone pSVA-CA16-memHiBiT;
[0033] Figure B shows the cytopathic effects caused by CA16 and CA16-memHiBiT transfection into cells.
[0034] Figure C shows the viral genome copy number and luciferase results at different time points after CA16 and CA16-memHiBiT transfection of cells.
[0035] Figure D shows the luciferase activity of different generations of CA16-memHiBiT virus after continuous passage. Detailed Implementation
[0036] To make the present invention more apparent and understandable, preferred embodiments are described in detail below with reference to the accompanying drawings:
[0037] The purpose of this invention is to provide an enterovirus vector with the EV71 replicon as its backbone, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0038] This invention provides an application of an enterovirus vector in the preparation of vaccines and antiviral drugs.
[0039] This invention provides an enterovirus vector capable of expressing other membrane proteins, wherein the enterovirus vector comprises at least an EV71 replicon with the nucleotide sequence shown in SEQ ID No. 1 and a transmembrane region fragment; the transmembrane region fragment comprises at least PDGFRβTM with the nucleotide sequence shown in SEQ ID No. 3, SpikeTM with the nucleotide sequence shown in SEQ ID No. 4, CD28TM with the nucleotide sequence shown in SEQ ID No. 5, PDGFRβ+SpikeTM with the nucleotide sequence shown in SEQ ID No. 6, or Linker+TM+Linker with the nucleotide sequence shown in SEQ ID No. 7.
[0040] This invention provides the application of an enterovirus vector capable of expressing other membrane proteins in the preparation of vaccines and antiviral drugs.
[0041] The present invention provides an enterovirus vector capable of expressing secretory proteins, the enterovirus vector comprising the above-mentioned enterovirus vector capable of expressing other membrane proteins and a cleavage site fragment; the cleavage site fragment includes at least a Furin recognition region of the nucleotide sequence shown in SEQ ID NO.8, an mFurin recognition region of the nucleotide sequence shown in SEQ ID NO.9, or a T2A of the nucleotide sequence shown in SEQ ID NO.10.
[0042] This invention provides the application of an enterovirus vector capable of expressing secretory proteins in the preparation of vaccines and antiviral drugs.
[0043] This invention provides a method for constructing an infectious CA16 clone carrying a membrane-display reporter gene. Using pSVA-CA16 as a template, the memHiBiT membrane-display reporter gene is introduced, and through seamless recombination cloning, a sequenced pSVA-CA16-memHiBiT infectious clone is obtained. The nucleotide sequence of the CA16-memHiBiT is shown in SEQ ID NO.11. The memHiBi membrane-display reporter gene fragment is inserted between the 5'UTR and the P1 fragment.
[0044] This invention provides an application of an infectious CA16 clone carrying a membrane-display reporter gene in screening antiviral drugs.
[0045] This invention provides a method for constructing an enterovirus vector capable of expressing other membrane proteins. Using a vector constructed with the genome of a serotype enterovirus as a backbone as a template, different transmembrane region fragments are amplified by PCR. Then, through seamless cloning, clones with different transmembrane region fragments are constructed. Clones that are verified by sequencing are screened, and plasmids are extracted and preserved. The transmembrane region fragments include at least the nucleotide sequence PDGFRβTM shown in SEQ ID NO.3, SpikeTM shown in SEQ ID NO.4, CD28TM shown in SEQ ID NO.5, PDGFRβ+SpikeTM shown in SEQ ID NO.6, or Linker+TM+Linker shown in SEQ ID NO.7.
[0046] This invention provides a method for constructing an enterovirus vector capable of expressing secretory proteins, comprising the following steps:
[0047] Step 1: Using vector one, constructed with the genome of a serotype virus in the Enterovirus genus as a backbone, as a template, different transmembrane fragments are amplified by PCR. Then, through seamless cloning, vector two with different transmembrane fragments is constructed. Clones that are verified by sequencing are screened, and plasmids are extracted and preserved. The transmembrane fragments include at least the nucleotide sequence PDGFRβTM shown in SEQ ID NO.3, the nucleotide sequence SpikeTM shown in SEQ ID NO.4, the nucleotide sequence CD28TM shown in SEQ ID NO.5, the nucleotide sequence PDGFRβ+SpikeTM shown in SEQ ID NO.6, or the nucleotide sequence Linker+TM+Linker shown in SEQ ID NO.7.
[0048] Step 2: Using the vector 2 obtained in Step 1 as a template, seamless cloning technology is used to introduce cleavage site fragments respectively; thereby constructing an enterovirus vector 3 that can express secretory proteins; the cleavage site fragments include at least the Furin recognition region of the nucleotide sequence shown in SEQ ID NO. 8, the mFurin recognition region of the nucleotide sequence shown in SEQ ID NO. 9, or the T2A of the nucleotide sequence shown in SEQ ID NO. 10.
[0049] The purpose of this invention is to overcome the shortcomings of existing enterovirus vectors and propose a series of novel enterovirus vector design ideas and potential applications. These new enterovirus vector designs enable the expression of exogenous membrane proteins and secreted proteins. Furthermore, this invention also constructed an infectious CA16-memHiBiT clone and successfully rescued a reporter virus. This invention can provide important tools and reference ideas for basic and applied research on enterovirus-based vectors and other similar enteroviruses.
[0050] The objective of this invention can be achieved through the following technical solutions:
[0051] An optimized transmembrane region scheme for the EV71replicon vector, wherein the nucleotide sequence of the EV71replicon vector is shown in SEQ ID NO.1, the nucleotide sequence of PDGFRβTM is shown in SEQ ID NO.3, the nucleotide sequence of SpikeTM is shown in SEQ ID NO.4, the nucleotide sequence of CD28TM is shown in SEQ ID NO.5, the nucleotide sequence of PDGFRβ+SpikeTM is shown in SEQ ID NO.6, and the nucleotide sequence of Linker+TM+Linker is shown in SEQ ID NO.7.
[0052] The EV71replicon vector can express secreted proteins.
[0053] CA16 infectious clones can carry membrane-display reporter genes.
[0054] An optimization scheme for the transmembrane region in the EV71replicon carrier, the steps of which are as follows:
[0055] S1: PL451-71rep-Gluc clone construction;
[0056] S2: Construction of PL451-71rep-Gluc-TM clones with different transmembrane regions;
[0057] S3: In vitro transcription;
[0058] S4: Detection of Gluc luciferase expression.
[0059] In step S1, the amplified Gluc gene fragment and PL451-71rep vector fragment were extracted using a kit. The obtained cDNA was verified by agarose gel electrophoresis. Fragments of the correct size were recovered from the gel and their concentrations were determined. The Gluc and PL451-71rep fragments were recombined to construct the PL451-71rep-Gluc clone.
[0060] In step S2, the PL451-71rep-Gluc clone prepared in step S1 is used as a template to amplify the transmembrane regions of PDGFRβTM, SpikeTM, CD28TM, PDGFRβ+SpikeTM, and Linker+TM+Linker, respectively. Using seamless cloning technology, a PL451-71rep-Gluc-TM clone with the correct sequence and different transmembrane regions is constructed.
[0061] In step S2, the PL451-71rep-Gluc-TM clone containing different transmembrane regions was amplified by PCR. The obtained cDNA was verified by agarose gel electrophoresis. Fragments of the correct size were recovered from the gel and their concentration was determined to prepare in vitro transcription templates. 71rep-Gluc-TM mRNA was prepared using the T7 in vitro transcription kit. The mRNA purified by LiCl was verified by agarose gel electrophoresis. Verified mRNA was aliquoted and stored at -80℃.
[0062] In step S4, RD cells were seeded into 96-well plates and cultured overnight. After transfection with 71rep-Gluc-TM mRNA containing different transmembrane regions, luciferase activity was detected using a luciferase assay kit.
[0063] The EV71replicon vector can be used to design the expression of secretory proteins, and the steps are as follows:
[0064] S1: PL451-71rep-Gluc-Furin-TM clone construction;
[0065] S2: PL451-71rep-Gluc-mFurin-TM clone construction;
[0066] S3: PL451-71rep-Gluc-T2A-TM clone construction;
[0067] S4: PL451-71rep-Gluc-T2A-Furin-TM clone construction;
[0068] S5: In vitro transcription;
[0069] S6: Detection of Gluc luciferase expression.
[0070] In step S1, using PL451-71rep-Gluc-TM as a template, PCR primers introduce Furin recognition sites into the template. The correctly sized fragment is recovered from the gel and its concentration is determined. The clone with the correct sequencing is the PL451-71rep-Gluc-Furin-TM clone.
[0071] In step S2, the PL451-71rep-Gluc-Furin-TM clone prepared in step S1 is used as a template. Point mutation primers are used to mutate the Furin site in the template to mFurin. The correctly sized fragment is recovered from the gel and its concentration is determined. The clone that is correctly sequenced is the PL451-71rep-Gluc-mFurin-TM clone.
[0072] Using the PL451-71rep-Gluc-Furin-TM clone prepared in step S2 as a template, PCR primers were used to introduce T2A into the template, while the Furin recognition site was deleted. The correctly sized fragment was recovered from the gel and its concentration was determined. The clone that was correctly sequenced was the PL451-71rep-Gluc-T2A-TM clone.
[0073] In step S4, the PL451-71rep-Gluc-Furin-TM clone prepared in step S2 is used as a template. PCR primers are used to introduce the T2A sequence into the template. The correctly sized fragment is recovered by gel extraction and the concentration is determined. The clone with the correct sequencing is the PL451-71rep-Gluc-T2A-Furin-TM clone.
[0074] In step S5, the clones prepared in steps S1, S2, S3, and S4 are amplified by PCR. The obtained cDNA is verified by agarose gel electrophoresis. Fragments of the correct size are recovered from the gel and their concentration is determined to prepare in vitro transcription templates. mRNA is prepared using the T7 in vitro transcription kit. The mRNA purified by LiCl is verified by agarose gel electrophoresis. Verified mRNA is aliquoted and stored at -80℃.
[0075] In step S6, RD cells were seeded into 96-well plates and cultured overnight. After transfection with mRNA, luciferase activity was detected using a luciferase assay kit.
[0076] A method for constructing an infectious CA16 clone carrying a membrane-display reporter gene, comprising the following steps:
[0077] S1: pSVA-CA16-memHiBiT clone construction;
[0078] S2: Rescue of CA16-memHiBiT virus and viral growth characteristics;
[0079] S3: Passage and genetic stability verification of CA16-memHiBiT virus;
[0080] In step S1, using the laboratory-preserved infectious clone pSVA-CA16 as a template, PCR primers were used to amplify the pSVA-CA16 vector fragment. Using the laboratory-preserved pCDNA-memHiBiT clone as a template, PCR primers were used to amplify the memHiBiT insert fragment. The obtained cDNA was verified by agarose gel electrophoresis. Fragments of the correct size were recovered from the gel and their concentrations were determined. The memHiBiT and pSVA-CA16 fragments were recombined to construct the pSVA-CA16-memHiBiT infectious clone.
[0081] In step S2, the pSVA-CA16-memHiBiT infectious clone prepared in step S1 and the laboratory-preserved pSVA-CA16 infectious clone were amplified by PCR. The obtained cDNA was verified by agarose gel electrophoresis. Fragments of the correct size were recovered from the gel and their concentration was determined to prepare in vitro transcription templates. mRNA was prepared using a T7 in vitro transcription kit. The mRNA purified by LiCl was verified by agarose gel electrophoresis. The verified mRNA was aliquoted and stored at -80℃.
[0082] In step S3, CA16 and CA16-memHiBiT mRNA were transfected into Vero cells, and RNA extraction and q-PCR quantification were performed after cells were harvested at different time points.
[0083] In step S4, after transfecting Vero cells with CA16-memHiBiT mRNA, the cells were passaged every 48 hours, and the viral supernatant of each passage was collected. Then, the viral supernatants from different passages were used to infect Vero cells in 96-well plates, and the luciferase activity was detected using a luciferase assay kit.
[0084] Example
[0085] In the following examples, the nucleotide sequences are shown below:
[0086] The nucleotide sequence of EV71replicon is shown in SEQ ID NO.1.
[0087] The nucleotide sequence of Gluc is shown in SEQ ID NO.2.
[0088] The nucleic acid sequence of PDGFRβTM is shown in SEQ ID NO.3.
[0089] The nucleic acid sequence of Spike™ is shown in SEQ ID NO.4.
[0090] The nucleic acid sequence of CD28TM is shown in SEQ ID NO.5.
[0091] The nucleic acid sequence of PDGFRβ+SpikeTM is shown in SEQ ID NO.6.
[0092] The nucleic acid sequence of Linker+TM+Linker is shown in SEQ ID NO.7.
[0093] The nucleic acid sequence of the Furin recognition region is shown in SEQ ID NO.8.
[0094] The nucleic acid sequence of the mFurin recognition region is shown in SEQ ID NO.9.
[0095] The nucleic acid sequence of T2A is shown in SEQ ID NO.10.
[0096] The nucleic acid sequence of CA16-memHiBiT is shown in SEQ ID NO.11.
[0097] in:
[0098] The nucleotide sequence of EV71replicon is shown in SEQ ID NO.1:
[0099]
[0100] The nucleotide sequence of Gluc, the sequence is as shown in SEQ ID NO.2:
[0101] ATGGGAGTCAAAGTTCTGTTTGCCCTGATCTGCATCGCTGTGGCCGAGGCCAAGCCCACCGAGAACAACGAAGACTTCAACATCGTGGCCGTGGCCAGCAACTTCGCGACCACGGATCTCGATGCTGACCGCGGGAAGTTGCCCGGCGAGAAGCTGCCGCTGGAGGTGCTCAAAGAGCTTGAAGCCAATGCCCGGAAAGCTGGCTGCACCAGGGGCTGTCTGATCTGCCTGTCCCACATCAAGTGCACGCCCAAGATGAAGAAGTTCATCCCAGGACGCTGCCACACCTACGAAGGCGACAAAGAGTCCGCACAGGGCGGCATAGGCGAGGCGATCGATGACATTCCTGAGATTCCTGGGTTCAAGGACTTGGAGCCCATTGAGCAGTTCATCGCACAGGTCGATCTGTGTGTGGACTGCACAACTGGCTGCCTCAAAGGGCTTGCCAACGTGCAGTGTTCTGACCTGCTCAAGAAGTGGCTGCCGCAACGCTGTGCGACCTTTGCCAGCAAGATCCAGGGCCAGGTGGACAAGATCAAGGGGGCCGGTGATGAC
[0102] The nucleic acid sequence of PDGFRβTM, the sequence is as shown in SEQ ID NO.3:
[0103] GCTGTGGGCCAGGACACGCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTCCCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCACGT
[0104] The nucleic acid sequence of SpikeTM, the sequence is as shown in SEQ ID NO.4:
[0105] GACGTGGATCTGGGCGACATCAGCGGCATCAATGCCTCCGTGGTGAACATCCAGAAGGAGATCGACAGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGATCTGCAGGAGCTGGGCAAGTATGAGCAGTACATCAAGTGGCCCTGGTATATCTGGCTGGGCTTCATCGCCGGCCTGATCGCTATCGTGATGGTGACCATCATGCTGTGCTGTATGACATCCTGCTGTTCTTGCCTGAAGGGCTGCTGTAGCTGTGGCTCCTGCTGTAAGTTTGATGAGGACGATTCCGAGCCAGTGCTGAAGGGCGTGAAGCTGCACTACACC
[0106] The nucleic acid sequence of CD28TM is as shown in SEQ ID NO.5:
[0107] ATCGAGGTGATGTACCCTCCCCCTTACCTGGACAACGAGAAGAGCAACGGCACCATCATCCACGTGAAGGGCAAGCACCTGTGCCCTAGCCCCCTGTTCCCCGGACCTAGCAAGCCCTTTTGGGTGCTGGTGGTGGTGGGCGGCGTGCTGGCCTGTTACTCCCTGCTGGTGACCGTGGCCTTCATTATCTTCTGGGTGAGGAGCAAGAGGAGCAGGCTGCTGCACAGCGACTACATGAACATGACACCCAGGAGACCTGGCCCCACCAGAAAGCACTACCAGCCCTATGCCCCCCCCAGAGACTTTGCCGCCTACAGAAGC
[0108] The nucleic acid sequence of PDGFRβ+SpikeTM is as shown in SEQ ID NO.6:
[0109] GACGTGGATCTGGGCGACATCAGCGGCATCAATGCCTCCGTGGTGAACATCCAGAAGGAGATCGACAGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGATCTGCAGGAGCTGGGCAAGTATGAGCAGTACATCGCTGTGGGCCAGGACACGCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTCCCTTATCATCCTCATCATGCT TTGGCAGAAGAAGCCACGTCTGTGCTGTATGACATCCTGCTGTTCTTGCCTGAAGGGCTGCTGTAGCTGTGGCTCCTGCTGTAAGTTTGATGAGGACGATTCCGAGCCAGTGCTGAAGGGCGTGAAGCTGCACTACACC
[0110] Nucleic acid sequence of Linker+TM+Linker, the sequence is shown in SEQ ID NO.7:
[0111] GAATTCGGAGGCAGTGGAGGAGGTAGTAATGGAGGCGGTAGTGGAGGCGGAGGTAGTAGAGGAGGAGGAGGCAGTGGAGGAGGTAGTAATGGAGGCGGAAGTGGAGGCGGAGGTAGTAGAGGAGGAGGAGGCAGTGGAGGAGGTAGTAATGCTGTGGGCCAGGACACGCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTCCCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCACGTGGAGGCGGTAGTGGAGGCGGAGGTAGTAGAGGAGGAGGAGGCAGTGGAGGAGGTAGTAATGGAGGCGGAAGTGGAGGCGGAGGTAGTAGAGGAGGAGGAGGCAGTGGAGGAGGTAGTAATGGTACC
[0112] Nucleic acid sequence of Furin, the sequence is shown in SEQ ID NO.8:
[0113] CGCCGAAAGAGA
[0114] The nucleic acid sequence of mFurin is shown in SEQ ID NO.9:
[0115] GCCCGAAAGGCT
[0116] The nucleic acid sequence of T2A is shown in SEQ ID NO.10:
[0117] GAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCA
[0118] The nucleic acid sequence of CA16-memHiBiT is shown in SEQ ID NO.11:
[0119]
[0120] Example 1
[0121] The steps of an optimization scheme for the transmembrane region in an EV71replicon carrier are as follows:
[0122] 1. Construct the PL451-71rep-Gluc clone:
[0123] Using the PL451-71rep vector as a template, primers were used to amplify the PL451-71rep fragment; using pcDNA-Gluc as a template, primers were used to amplify the Gluc fragment. The amplified fragments were subjected to 0.7% (w / v) agarose gel electrophoresis. Based on the DNA marker bands, the PL451-71rep and Gluc amplification products of the correct size were cut, and the DNA fragments were recovered and purified using the Tiangen Enhanced Gel Extraction Kit.
[0124] The purified PL451-71rep and Gluc fragments were recombined using a two-fragment recombination kit (purchased from Shanghai Yisheng Biotechnology Co., Ltd.). The recombinant products were transformed into Trans2-Blue E. coli competent cells. After picking single clones, the correct clones were preliminarily identified by PCR. The cells were expanded by shaking, and the plasmid was extracted and sequenced for verification. The correctly sequenced plasmid was the PL451-71rep-Gluc clone.
[0125] The upstream amplification primers for PL451-71rep have the sequence shown in SEQ ID NO.12:
[0126] 5'-CTCAATACAGTCAAACGCCACCATGGGAGTCAAAG-3';
[0127] The downstream amplification primers for PL451-71rep have the sequences shown in SEQ ID NO.13:
[0128] 5'-GTGGGTGATCGCGTCATCACCGGCCCCCCTT-3';
[0129] The upstream amplification primers for Gluc are shown in SEQ ID NO.14:
[0130] 5'-GATGACGCGATCACCACTCTTGGAAAGTTCG-3';
[0131] The downstream amplification primers for Gluc are shown in SEQ ID NO.15:
[0132] 5'-GTTTGACTGTATTGAGAGTTAATATAAAGTTGAGGGTG-3';
[0133] The recombination reaction system was as follows: PL451-71rep: 1 μl, Gluc: 1 μl, support: 2 μl, water: 6 μl; 2×Hieff MultiSEnzymePremix: 10μl, 50℃, 30min.
[0134] 2. Optimization of the transmembrane region in PL451-71rep-Gluc clones:
[0135] Using PL451-71rep-Gluc from step 1 as a template, primers were used to amplify PL451-71rep-Gluc. Simultaneously, primers were used to amplify the transmembrane regions of PDGFRβTM, SpikeTM, CD28TM, PDGFRβ+SpikeTM, and Linker+TM+Linker. The amplified fragments were subjected to 0.7% (w / v) agarose gel electrophoresis. Based on the DNA marker bands, the correctly sized PL451-71rep-Gluc, PDGFRβTM, SpikeTM, CD28TM, PDGFRβ+SpikeTM, and Linker+TM+Linker transmembrane regions were cut. The amplified products were then recovered and purified using the Tiangen Enhanced Gel Extraction Kit.
[0136] The purified PL451-71rep-Gluc was recombinated with PDGFRβTM, SpikeTM, CD28TM, PDGFRβ+SpikeTM, and Linker+TM+Linker transmembrane fragments using a two-fragment recombination kit (purchased from Shanghai Yisheng Biotechnology Co., Ltd.). The recombination products were transformed into Trans2-Blue E. coli competent cells. Single clones were picked, and the correct clones were preliminarily identified by PCR. The cells were then expanded by shaking, and plasmids were extracted and sequenced for verification. The correctly sequenced plasmids were PL451-71rep-Gluc-PDGFRβTM, PL451-71rep-Gluc-SpikeTM, PL451-71rep-Gluc-CD28TM, PL451-71rep-Gluc-PDGFRβ+SpikeTM, and PL451-71rep-Linker+TM+Linker clones (e.g., ...). Figure 1 (Figure A in the middle)
[0137] The upstream amplification primers for PL451-71rep-Gluc have the sequence shown in SEQ ID NO.16:
[0138] 5'-GCCACGTGCGATCACCACTCTTGGAAAGTTCG-3';
[0139] The downstream amplification primers for PL451-71rep-Gluc have the sequence shown in SEQ ID NO.17:
[0140] 5'-CCCACAGCGTCATCACCGGCCCCCTT-3';
[0141] The upstream amplification primers for PDGFRβTM have the sequence shown in SEQ ID NO.18:
[0142] 5'-GTGATGACCGCTGTGGGCCAGGACAC-3';
[0143] The downstream amplification primers for PDGFRβTM have the sequence shown in SEQ ID NO.19:
[0144] 5'-GTGATCGCACGTGGCTTCTTCTGCCAAAG-3';
[0145] The upstream amplification primers for Spike™ are shown in SEQ ID NO.20:
[0146] 5'-TGTGATGACGGAGGCGGATCAGGTGGC-3';
[0147] The downstream amplification primers for Spike™ are shown in SEQ ID NO.21:
[0148] 5'-CAAGAGTGGTGATCGCGGTGTAGTGCAGCTTCACGC-3';
[0149] The upstream amplification primers for CD28TM have the sequence shown in SEQ ID NO.22:
[0150] 5'-GCCGGTGATGACATCGAGGTGATGTACCCTCCC-3';
[0151] The downstream amplification primers for CD28TM are shown in SEQ ID NO.23:
[0152] 5'-GTGATCGCGCTTCTGTAGGCGGCAAAGTC-3';
[0153] The upstream amplification primers for PDGFRβ+SpikeTM have the sequence shown in SEQ ID NO.24:
[0154] 5'-GTGATGACGACGTGGATCTGGGCGACA-3';
[0155] The downstream amplification primers for PDGFRβ+SpikeTM have the sequence shown in SEQ ID NO.25:
[0156] 5'-CAAGAGTGGTGATCGCGGTGTAGTGCAGCTTCACGC-3';
[0157] The upstream amplification primers for Linker+TM+Linker have the sequence shown in SEQ ID NO.26:
[0158] 5'-GGTGATGACGAATTCGGAGGCAGTGGAGG-3';
[0159] The downstream amplification primers for Linker+TM+Linker have the sequences shown in SEQ ID NO.27:
[0160] 5'-GTGGTGATCGCGGTACCATTACTACCTCCTCCACTGC-3';
[0161] 3. In vitro transcription:
[0162] Using plasmids PL451-71rep-Gluc-PDGFRβTM, PL451-71rep-Gluc-SpikeTM, PL451-71rep-Gluc-CD28TM, PL451-71rep-Gluc-PDGFRβ+SpikeTM, and PL451-71rep-Linker+TM+Linker as templates, full-length DNA templates were amplified by PCR. After gel recovery, proteinase K treatment, and DNA product purification, mRNA was obtained by T7 in vitro transcription. After purification by LiCl precipitation, the quality of mRNA was detected by 0.7% (w / v) agarose gel electrophoresis. After the bands were correct, the mRNA was aliquoted and stored at -80℃.
[0163] The sequence of the upstream primer for full-length amplification is shown in SEQ ID NO.28:
[0164] 5'-GTGCCACCTGACCGTCTAAGAAAC-3';
[0165] The downstream primers for full-length amplification are shown in SEQ ID NO.29:
[0166] 5'-TTTTTTTTTTTTTTTTTTTTTTTCTGCTATTCTGGTTATAACAAATTTACCCCC-3';
[0167] T7 in vitro transcription reaction system: template: 8 μl, A: 1.5 μl, G: 1.5 μl, C: 1.5 μl, U: 1.5 μl, buffer: 2 μl, T7 Enzyme: 1 μl; RNase-free ddH2O: 3 μl, 37℃, 2 h.
[0168] 4. Detection of Glucose luciferase expression:
[0169] 2.5*10 4 RD cells were seeded into 96-well plates and cultured overnight at 37°C. RD cells were then transfected with 71rep-Gluc-TM mRNA carrying different transmembrane regions. After 24 hours of further culture, 20 μl of lysis buffer was added to each well, and the cells were incubated at room temperature for 5 minutes. Then, 20 μl of substrate was added, and fluorescence values were immediately detected. The fluorescence values produced after transfection of cells with PL451-71rep-Gluc-TM carrying different transmembrane regions were compared to reflect the expression of exogenous proteins in the vector (e.g., ...). Figure 1 (Figure B in the middle)
[0170] Example 2:
[0171] Design of EV71replicon vector for expressing secretory proteins
[0172] The steps are as follows:
[0173] 1. PL451-71rep-Gluc-Furin-TM clone construction:
[0174] Using PL451-71rep-Gluc-Linker+TM+Linker as a template, PCR primers were used to directly introduce Furin sites into the template. The amplified fragments were subjected to 0.7% (w / v) agarose gel electrophoresis. Based on the DNA marker bands, the amplified products of the correct size were cut and the DNA fragments were recovered and purified using the Tiangen Enhanced Gel Extraction Kit.
[0175] The purified DNA fragments were treated with DMT enzyme (purchased from Shanghai Yisheng Biotechnology Co., Ltd.). The product after DMT treatment was transformed into Trans2-Blue E. coli competent cells. After picking single clones, the clones that were preliminarily identified by PCR were expanded and cultured. The plasmid was extracted and sequenced for verification. The correctly sequenced plasmid was PL451-71rep-Furin-TM clone. Figure 2 (Figure A in the middle)
[0176] The upstream amplification primers for PL451-71rep-Gluc-Linker+TM+Linker have the sequence shown in SEQ ID NO.30:
[0177] 5'-CGCCGAAAGAGAGGCTCCGGCGAGGGCAGGGGAAGTCTTCTAAC-3';
[0178] The downstream amplification primers for PL451-71rep-Gluc-Linker+TM+Linker have the sequence shown in SEQ ID NO.31:
[0179] 5'-CTCTTCTTTCGGCGATTACTACCGCCACCACTACC-3';
[0180] 2. PL451-71rep-Gluc-mFurin-TM clone construction:
[0181] Using PL451-71rep-Gluc-mFurin-TM as a template, mFurin sites were directly introduced into the template using point mutation PCR primers. The amplified fragments were subjected to 0.7% (w / v) agarose gel electrophoresis. Based on the DNA marker bands, the amplified products of the correct size were cut and the DNA fragments were recovered and purified using the Tiangen Enhanced Gel Extraction Kit.
[0182] The purified DNA fragments were treated with DMT enzyme (purchased from Shanghai Yisheng Biotechnology Co., Ltd.). The product after DMT enzyme treatment was transferred into Trans2-Blue E. coli competent cells. After picking single clones, the clones that were preliminarily identified by PCR were expanded and cultured. The plasmid was extracted and sequenced for verification. The correctly sequenced plasmid was PL451-71rep-mFurin-TM clone.
[0183] The upstream amplification primers for PL451-71rep-Gluc-mFurin-TM have the sequence shown in SEQ ID NO.32:
[0184] 5'-CGAAAGGCTGGTTCTGGCGACGTGGATCTGGGCGACAT-3';
[0185] The downstream amplification primers for PL451-71rep-Gluc-mFurin-TM have the sequence shown in SEQ ID NO.33:
[0186] 5'-CAGAACCAGCCTTTCGGGCATTACTACCGCCACCACTACCG-3';
[0187] 3. PL451-71rep-Gluc-T2A-TM clone construction:
[0188] Using PL451-71rep-Gluc-Furin-TM as a template, PCR primers were used to directly delete the Furin site in the template while introducing the T2A site. The amplified fragments were subjected to 0.7% (w / v) agarose gel electrophoresis. Based on the DNA marker bands, the amplified products of the correct size were cut and the DNA fragments were recovered and purified using the Tiangen Enhanced Gel Extraction Kit.
[0189] The purified DNA fragments were treated with DMT enzyme (purchased from Shanghai Yisheng Biotechnology Co., Ltd.). The product after DMT enzyme treatment was transferred into Trans2-Blue E. coli competent cells. After picking single clones, the clones that were preliminarily identified by PCR were expanded and cultured. The plasmid was extracted and sequenced for verification. The correctly sequenced plasmid was PL451-71rep-T2A-TM clone.
[0190] The upstream amplification primers for the template have the sequence shown in SEQ ID NO.34:
[0191] 5'-CTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCAGACGTGGATCTGGGCGA-3';
[0192] The downstream amplification primers for the template have the sequences shown in SEQ ID NO.35:
[0193] 5'-CGTCCCCGCATGTTAGAAGACTTCCCCTGCCCTCGCCGGAGCCGTCATCAC-3';
[0194] 4. PL451-71rep-Gluc-T2A-Furin-TM Cloning Construction
[0195] Using PL451-71rep-Gluc-Furin-TM as a template, PCR primers were used to directly introduce the T2A site into the template. The amplified fragments were subjected to 0.7% (w / v) agarose gel electrophoresis. Based on the DNA marker bands, the amplified products of the correct size were cut and the DNA fragments were recovered and purified using the Tiangen Enhanced Gel Extraction Kit.
[0196] The purified DNA fragments were treated with DMT enzyme (purchased from Shanghai Yisheng Biotechnology Co., Ltd.). The product after DMT enzyme treatment was transferred into Trans2-Blue E. coli competent cells. After picking single clones, the clones that were preliminarily identified by PCR were expanded and cultured. The plasmid was extracted and sequenced for verification. The correctly sequenced plasmid was PL451-71rep-T2A-Furin-TM clone.
[0197] The upstream amplification primers for the template have the sequence shown in SEQ ID NO.36:
[0198] 5'-GTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCAGACGTGGATCTGGGCGAC-3';
[0199] The downstream amplification primers for the template have the sequence shown in SEQ ID NO.37:
[0200] 5'-CGCATGTTAGAAGACTTCCCCTGCCCTCGCCGGAGCCTCTCTTTCGG-3';
[0201] 5. In vitro transcription
[0202] Using plasmids PL451-71rep-Gluc-Furin-TM, PL451-71rep-Gluc-mFurin-TM, PL451-71rep-Gluc-T2A-TM, and PL451-71rep-Gluc-T2A-Furin-TM as templates, full-length DNA templates were amplified by PCR. After gel recovery, proteinase K treatment, and DNA product purification, mRNA was obtained by T7 in vitro transcription. After purification by LiCl precipitation, the quality of mRNA was detected by 0.7% (w / v) agarose gel electrophoresis. After the bands were correct, the mRNA was aliquoted and stored at -80℃.
[0203] The upstream primer for full-length amplification has the sequence shown in SEQ ID NO.28.
[0204] The downstream primer for full-length amplification has the sequence shown in SEQ ID NO.29.
[0205] 6. Detection of Glucose luciferase expression
[0206] 2.5*10 4RD cells were seeded into 96-well plates and cultured overnight at 37°C. 71rep-Gluc-Furin-TM, 71rep-Gluc-mFurin-TM, 71rep-Gluc-T2A-TM, and 71rep-Gluc-T2A-Furin-TM mRNA were transfected into the RD cells, with six replicates per sample (A, B, C, D, E, F). After 24 h of further culture, 20 μl of supernatant was collected from wells A, B, and C, and 20 μl of substrate was added. Fluorescence was immediately detected. Then, the supernatant from wells A, B, and C was completely removed, the cells were washed once with PBS, and 20 μl of substrate was added immediately for fluorescence detection. Finally, the supernatant from wells D, E, and F was removed, the cells were washed once with PBS, 20 μl of lysis buffer was added, and the cells were incubated at room temperature for 5 min. 20 μl of substrate was then added for fluorescence detection. The expression of exogenous proteins in the vector was reflected by comparing the fluorescence values generated after cells were transfected with PL451-71rep-Gluc-TM carrying different transmembrane regions. Figure 2 (Figures B and C in the middle).
[0207] Example 3:
[0208] A method for constructing an infectious CA16 clone carrying a membrane-display reporter gene, comprising the following steps:
[0209] 1. Construction of an infectious clone of CA16-memHiBiT:
[0210] Using the laboratory-preserved infectious clone pSVA-CA16 as a template, the pSVA-CA16 vector fragment was amplified by PCR primers. Using the laboratory-preserved pCDNA-memHiBiT clone as a template, the memHiBiT insert fragment was amplified by PCR primers. The amplified fragments were subjected to 0.7% (w / v) agarose gel electrophoresis. Based on the DNA marker bands, the amplified products of the correct size were cut and the DNA fragments were recovered and purified using the Tiangen Enhanced Gel Extraction Kit.
[0211] After recombination of the purified DNA fragment pSVA-CA16 and memHiBiT, the product was transformed into Trans2-Blue E. coli competent cells. Single clones were picked, and clones that were preliminarily identified by PCR were expanded and cultured. Plasmids were extracted and sequenced for verification. The correctly sequenced plasmid was an infectious clone of pSVA-CA16-memHiBiT. Figure 3 (Figure A in the middle)
[0212] The upstream amplification primers for pSVA-CA16 are shown in SEQ ID NO.38:
[0213] 5'-CTACACCGCCATTACTACCCTTGGGTCAC-3';
[0214] The downstream amplification primers for pSVA-CA16 are shown in SEQ ID NO.39:
[0215] 5'-GGGATCCATTTCTTACAGTTGAGGAGCAATATGTAATCAAG-3';
[0216] The upstream amplification primers for memHiBiT are shown in SEQ ID NO.40:
[0217] 5'-GTAAGAAATGGGATCCCAGAACTCCTTTCTCCACAAGCGC-3';
[0218] The downstream amplification primers for memHiBiT are shown in SEQ ID NO.41:
[0219] 5'-GTAGTAATGGCGGTGTAGTGCAGCTTCACGC-3';
[0220] 2. Rescue and growth characteristics of CA16-memHiBiT virus:
[0221] Using pSVA-CA16-memHiBiT plasmid as a template, full-length DNA template was amplified by PCR. After gel recovery, proteinase K treatment, and DNA product purification, mRNA was obtained by T7 in vitro transcription. After purification by LiCl precipitation, the quality of mRNA was detected by 0.7% (w / v) agarose gel electrophoresis. After the bands were correct, the mRNA was aliquoted and stored at -80℃.
[0222] In a 12-well plate, each well is inoculated with 2.5 x 10⁻⁶ seeds 5 Vero cells were cultured overnight at 37°C. 1 μg of CA16-memHiBiT mRNA was transfected into Vero cells, while CA16 mRNA was transfected as a control group. Each sample was tested in triplicate. Cytopathic effects were observed after transfection. Figure 3 (Figure B in the image); Cells were harvested at 12h, 24h, 36h, and 48h, and RNA was extracted from the samples. Viral gene copy number was quantitatively detected using one-step RT-PCR, and viral growth curves were analyzed. Simultaneously, Vero cells were infected with the supernatant of CA16-memHiBiT samples at 12h, 24h, 36h, and 48h, and luciferase activity was measured 24h later. Viral growth characteristics were analyzed based on the quantitative and luciferase results. Figure 3 (Figure C in the middle)
[0223] The full-length upstream amplification primers for CA16-memHiBiT are shown in SEQ ID NO.42:
[0224] 5'-GCGTATCACGAGGCCCTTTC-3';
[0225] The full-length downstream amplification primers for CA16-memHiBiT are shown in SEQ ID NO.43:
[0226] 5'-TTTTTTTTTTTTTTTTTTTTTTTCTGCTATTCTGGTTATAACAAATTTACCCCC-3';
[0227] The reaction system for TR-PCR was as follows: Oligo(dT)23VN (10μM): 1μl, RNA: 3μl, RNase-free ddH2O: 4μl, 65℃, 5min;
[0228] The above mixture: 8 μl, 2×RTbuffer: 10 μl, Enzyme: 2 μl; 50℃, 45 min; 85℃, 5 min.
[0229] 3. Passage and genetic stability verification of CA16-memHiBiT virus:
[0230] Vero cells were transfected with CA16-memHiBiT mRNA using Lipo3000 transfection reagent. The transfected Vero cells were then cultured, and the cytopathic effect was observed. Once more than 80% of the cells showed cytopathic effects, the cells were subjected to two freeze-thaw cycles at -80°C, centrifuged at 4000g, and the viral supernatant was collected as the P0 generation. The P0 generation viral solution was used to infect Vero cells again. When cytopathic effects exceeded 80%, the viral solution was collected as the P1 generation virus. This process was repeated until the P20 generation. The harvested viral solution was stored at -80°C.
[0231] 2.5*10 4 Vero cells were seeded into 96-well plates and cultured overnight at 37°C. The cells were then infected with different passages of CA16-memHiBiT virus. After culturing for 24 hours, 20 μl of lysis buffer was added to each well, and the cells were incubated at room temperature for 5 minutes. Then, 20 μl of substrate was added, and fluorescence values were immediately detected. The stability of the virus was reflected by comparing the fluorescence values produced after infection with different passages of CA16-memHiBiT virus. Figure 3 -D).
[0232] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. An enterovirus vector capable of expressing exogenous membrane proteins, characterized in that, The enterovirus vector comprises at least an EV71 replicon and a transmembrane fragment with the nucleotide sequence shown in SEQ ID No. 1; the transmembrane fragment comprises at least PDGFRβTM with the nucleotide sequence shown in SEQ ID No. 3, SpikeTM with the nucleotide sequence shown in SEQ ID No. 4, CD28TM with the nucleotide sequence shown in SEQ ID No. 5, PDGFRβ+SpikeTM with the nucleotide sequence shown in SEQ ID No. 6, or Linker+TM+Linker with the nucleotide sequence shown in SEQ ID No.
7.
2. The application of the enterovirus vector expressing exogenous membrane proteins according to claim 1 in the preparation of vaccines and antiviral drugs.
3. An enterovirus vector capable of expressing secretory proteins, characterized in that, The enterovirus vector comprises the enterovirus vector as described in claim 1 and a cleavage site fragment; the cleavage site fragment comprises at least a Furin recognition region of the nucleotide sequence shown in SEQ ID NO. 8, an mFurin recognition region of the nucleotide sequence shown in SEQ ID NO. 9, or a T2A of the nucleotide sequence shown in SEQ ID NO.
10.
4. The application of the enterovirus vector expressing secretory proteins according to claim 3 in the preparation of vaccines and antiviral drugs.
5. A method for constructing an enterovirus vector capable of expressing exogenous membrane proteins, characterized in that, Using vectors constructed with the genomes of enterovirus serotypes as a backbone as templates, different transmembrane fragments were amplified by PCR, and then clones with different transmembrane fragments were constructed through seamless cloning. Clones that were verified by sequencing were screened and plasmids were extracted and preserved. The transmembrane fragments included at least PDGFRβTM as shown in SEQ ID NO.3, SpikeTM as shown in SEQ ID NO.4, CD28TM as shown in SEQ ID NO.5, PDGFRβ+ SpikeTM as shown in SEQ ID NO.6, or Linker+TM+Linker as shown in SEQ ID NO.
7.
6. A method for constructing an enterovirus vector capable of expressing secreted proteins, characterized in that, Includes the following steps: Step 1: Using vector one, constructed with the genome of a serotype virus in the Enterovirus genus as a backbone, as a template, different transmembrane fragments are amplified by PCR. Then, through seamless cloning, vector two with different transmembrane fragments is constructed. Clones that are verified by sequencing are screened, and plasmids are extracted and preserved. The transmembrane fragments include at least PDGFRβTM with the nucleotide sequence shown in SEQ ID NO.3, SpikeTM with the nucleotide sequence shown in SEQ ID NO.4, CD28TM with the nucleotide sequence shown in SEQ ID NO.5, PDGFRβ+ SpikeTM with the nucleotide sequence shown in SEQ ID NO.6, or Linker+TM+ Linker with the nucleotide sequence shown in SEQ ID NO.
7. Step 2: Using the vector 2 obtained in Step 1 as a template, seamless cloning technology is used to introduce cleavage site fragments respectively; thereby constructing an enterovirus vector 3 that can express secretory proteins; the cleavage site fragments include at least the Furin recognition region of the nucleotide sequence shown in SEQ ID NO.8, the mFurin recognition region of the nucleotide sequence shown in SEQ ID NO.9, or the T2A of the nucleotide sequence shown in SEQ ID NO.10.
Citation Information
Patent Citations
Mammalian cell-based immunoglobulin display libraries
WO2008070367A2
Therapeutic agents
WO2017021701A1