A preparation method and application of botulinum toxin type A

By inserting His tag and SUMO tags into Botulinum toxin type A (BoNT/A) and excising and removing them through enzyme cleavage, the problem of multiple intermediate products and immunogenicity risks in the preparation of Botulinum toxin is solved, and efficient peptide purification and safe application are achieved.

CN116813727BActive Publication Date: 2025-06-06SHENZHEN REJUVO BIOTECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310681461.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-08
Publication Date
2025-06-06
Estimated Expiration
2043-06-08

AI Technical Summary

Technical Problem

The prior art has a variety of undesirable intermediate products in the efficient preparation and purification of botulinum toxin, which increases the difficulty of purification and reduces the yield of the product, and has the risk of immunogenicity.

Method used

His tag and SUMO tag were inserted at the N-terminus of Botulinum toxin type A (BoNT/A) by homologous recombination, and the tag was removed by enzymatic cleavage using SUMO protease to activate the BoNT/A protein.

Benefits of technology

It achieves efficient label removal and activation of BoNT/A protein, improves the purification efficiency and safety of the peptide, and reduces the risk of side effects and stimulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116813727B_ABST
    Figure CN116813727B_ABST
Patent Text Reader

Abstract

The present invention provides a method for preparing a recombinant botulinum toxin type A (BoNT / A), wherein a BoNT / A amino acid sequence is designed in a P0DP10 protein database, a His tag and a SUMO tag sequence are inserted into the N-terminus of the BoNT / A amino acid sequence by homologous recombination, and then cleaved between GG-M by a SUMO tag protease, and the results show that there will be no amino acid residues of any tag and SUMO sequence, and the safety is greatly improved. Comparative experiments and animal experiments show that the recombinant botulinum toxin type A polypeptide prepared, purified and activated according to the bacterial centrifugation supernatant is more toxic, so in practical applications, the effective dose is reduced, and thus the side effects and irritation are also significantly reduced, and it has higher safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of polypeptide preparation, in particular to the efficient preparation of botulinum toxin type A and its use in the preparation of medicines. Background Art

[0002] Clostridium botulinum and Clostridium tetani produce highly potent neurotoxins, botulinum toxin (BoNT) and tetanus neurotoxin (TeNT), respectively. These clostridium toxins (CNTs) bind specifically to neuronal cells and interfere with the release of neurotransmitters. Clostridium botulinum secretes seven antigenically distinct serotypes of botulinum toxin (BoNT), named A to G, all of which block synaptic exocytosis of Zn 2+ - endoproteases, which carry out the above blocking by cleaving proteins involved in the formation of the SNARE complex that controls cell membrane fusion.

[0003] In 1989, the United States approved botulinum toxin serotype A (BoNT / A) for use in humans to treat strabismus, blepharospasm and other diseases. It is commercially available as a botulinum toxin A protein preparation, for example, sold under the trade names BOTOX (Allergan) and DYSPORT (Ipsen Ltd.). The efficient preparation and product application of BoNT / A have shown great commercial value in the medical field.

[0004] Each of the naturally occurring Clostridial toxins is translated as a single-chain polypeptide of about 150 kDa, the disulfide loop of which is subsequently cleaved by proteolytic cleavage by a naturally occurring protease (e.g., such as an endogenous Clostridial toxin protease or a naturally occurring protease produced in the environment), and post-translational processing produces a mature two-chain molecule comprising an approximately 50 kDa light chain (LC) and an approximately 100 kDa heavy chain (HC), which are bound together by a single interchain disulfide bond and non-covalent interactions. Between the participating cysteine ​​residues there is a linker region or loop region, the length of which varies greatly between the various serotypes of Clostridial toxins, and the loop is at the latest when the toxin is released from the Clostridium during cell lysis, wherein the ratio of cleaved and uncleaved species varies between serotypes, and the cleavage of the protease (at the loop region and at the end of the heavy chain) is random, thereby generating many undesirable intermediates, thereby increasing the difficulty of purification and reducing the yield of the product. There is a method for expressing and purifying the heavy and light chains of TeTx and BoNTs in E. coli (see Li, et al., Biochemistry 33: 7014-7020 (1994); Zhou, et al., Biochemistry, 34: 15175-15181 (1995). In the absence of L chain, the separated H chain has poor water solubility and is very easy to be hydrolyzed by proteolysis, so it is not practical. Patent US7709228 discloses enzyme cleavage sites that can be modified and proteases that can specifically recognize these sites, but the toxicity of its recombinant product is equivalent to two-fifths of natural TeTx, and the decrease is not very significant. At the same time, existing technicians generally use restriction endonuclease construction methods to construct the target protein into the target region, which will introduce 2-3 amino acid residues, which will cause the risk of immunogenicity. Therefore, there is an urgent need in the field for an efficient and safe preparation method for botulinum neurotoxin to obtain a polypeptide product with high safety and high yield, so that it can be used in medical treatment more safely and effectively. Summary of the invention

[0005] In view of the deficiencies of the prior art, the present invention aims to provide a method for preparing and using botulinum toxin.

[0006] Technical solution of the present invention One of the purposes of the present invention is a recombinant botulinum toxin type A (BoNT / A), whose amino acid sequence is shown in SEQ ID NO 7.

[0007] Preferably, the amino acid sequence of the recombinant botulinum toxin type A (BoNT / A) comprises SEQ ID NO 1, SEQ ID NO 3 and SEQ ID NO 5;

[0008] (a) the Lc region encoding BoNT / A, the sequence of which is shown in SEQ ID NO 2, and the amino acid sequence of which is shown in SEQ ID NO 1;

[0009] (b) encoding a thrombin cleavage site, the sequence of which is shown in SEQ ID NO 4, and the amino acid sequence of which is shown in SEQ ID NO 3;

[0010] (c) The Hc region encoding BoNT / A, the sequence of which is shown in SEQ ID NO 6, and the amino acid sequence of which is shown in SEQ ID NO 5.

[0011] Preferably, the combined tag is inserted into the N-terminus of the amino acid sequence of BoNT / A by homologous recombination, that is, the amino acid sequence of the designed recombinant botulinum toxin type A (BoNT / A) is as shown in SEQ ID NO13.

[0012] Preferably, the combined tag is a His tag and a SUMO tag.

[0013] The second object of the present invention is a method for preparing a recombinant botulinum toxin type A (BoNT / A), characterized by comprising the following steps:

[0014] (1) designing and constructing a recombinant botulinum toxin type A (BoNT / A) having an amino acid sequence as shown in SEQ ID NO 13;

[0015] (2) Design and ligation of BoNT / A expression vector;

[0016] (3) Induced expression of BoNT / A protein and bacterial collection;

[0017] (4) Affinity purification of bacterial supernatant;

[0018] (5) Enzymatic cleavage removes the SUMO tag and activates the BoNT / A protein.

[0019] Preferably, the experimental steps of enzymatically removing the SUMO tag and activating the BoNT / A protein are as follows: after the SUMO tag is enzymatically cleaved, 1 u of thrombin is added according to 1 mg of protein.

[0020] Preferably, the step of inducing expression of the BoNT / A protein is as follows: 600 After the concentration of 1 mM IPTG was reached to 0.6, the cells were induced at 30°C for 12 h.

[0021] Preferably, the bacterial cell collection step is: centrifugation at 4000rpm to collect bacterial sludge, resuspending with 40ml 20mM PB+150mM Nacl, pH 7.2, ultrasonic disruption at 420W ice bath, ultrasonication for 3S, interval of 5S, for 15min; centrifugation at 12000rpm, 4℃ for 20min to collect supernatant again;

[0022] The specific steps of affinity purification of the bacterial supernatant are as follows: the supernatant collected by centrifugation is filtered through a 0.22um filter membrane and then subjected to Ni column affinity enrichment purification, wherein the equilibration buffer is 20mM PB+150mM NaCl, the washing buffer is 20mM PB+150mM NaCl+5mM imidazole, 20mM PB+150mM NaCl+20mM, 20mM PB+150mM NaCl+50mM imidazole, 20mMPB+150mM NaCl+80mM imidazole, the elution buffer is 20mM PB+150mM NaCl+300mM imidazole, and the pH of the reagents is pH 8.0.

[0023] The third object of the present invention is to obtain a recombinant BoNT / A polypeptide prepared by the above method.

[0024] A fourth object of the present invention is to use the recombinant BoNT / A polypeptide prepared by the above method in preparing a drug.

[0025] Beneficial effects:

[0026] The present invention provides a method for preparing a recombinant botulinum toxin type A (BoNT / A), wherein the BoNT / A amino acid sequence is designed in the P0DP10 protein database, a His tag and a SUMO tag sequence are inserted into the design of the N segment of the BoNT / A amino acid sequence by homologous recombination, and then cleaved between GG-M by SUMO protease, without any amino acid residues of the tag and SUMO sequence.

[0027] When the amount of thrombin used is 0u, the target protein does not present two fragments, so that the BoNT / A protein is not activated, that is, an inactive BoNT / A protein is obtained; when the amount of thrombin used is 0.5u, 1u, 2u and 3u respectively, only when 1u, 2u and 3u of thrombin are added according to 1mg of protein, the target protein presents two fragments after thrombin cleavage, and the BoNT / A protein purified from the supernatant is more activated. At the same time, considering that the larger the amount of thrombin used, the more unsafe the risk is, so this scheme preferably adds 1u of thrombin according to 1mg of protein.

[0028] In addition, through comparative experiments, the results showed that when labeled with SUMO tag, the supernatant of bacterial centrifugation was selected for enzymatic cleavage of tag removal and activation of botulinum toxin type A protein polypeptide, which was more efficient in both tag removal and polypeptide activation; due to animal experiment limitations, the recombinant botulinum toxin type A polypeptide prepared, purified and activated by the above supernatant was more toxic, so in actual application, side effects and irritation were significantly reduced, and it had higher safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 :Schematic diagram of SUMO-BoNT / A expression vector

[0030] Figure 2 :Extraction and identification results of pKMD-SUMO blank plasmid

[0031] Figure 3 :Identification results of BoNT / A segmented PCR products

[0032] Figure 4 :Identification results of PCR products of BoNT / A transformants

[0033] Figure 5 :Restriction digestion and identification of SUMO-BoNT / A expression vector

[0034] Figure 6 :Transformation and identification of expression strains

[0035] Figure 7 :BoNT / A target protein supernatant purification results

[0036] Figure 8 :BoNT / A target protein inclusion body purification results

[0037] Fig. 9 : SUMO tag digestion results of target protein

[0038] Fig.10 :Results of thrombin digestion and activation of supernatant target protein

[0039] Fig.11 :Thrombin activation results of target protein DETAILED DESCRIPTION

[0040] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] Example 1: Design and construction of the amino acid sequence of BoNT / A

[0042] (1) designing and constructing the amino acid sequence of BoNT / A, the amino acid sequence of which is shown in SEQ ID NO 7;

[0043] The amino acid sequences of the recombinant botulinum toxin type A (BoNT / A) include SEQ ID NO 1, SEQ ID NO 3 and SEQ ID NO 5.

[0044] (a) The Lc region encoding BoNT / A, the sequence of which is shown in SEQ ID NO 2, and the amino acid sequence of which is shown in SEQ ID NO

[0045] As shown in 1;

[0046] (b) encoding a thrombin cleavage site, the sequence of which is shown in SEQ ID NO 4, and the amino acid sequence of which is shown in SEQ ID NO

[0047] 3 shown;

[0048] (c) the Hc region encoding BoNT / A, the sequence of which is shown in SEQ ID NO: 6, and the amino acid sequence of which is shown in SEQ ID NO:

[0049] 5 shown;

[0050] The BoNT / A protein information comes from the Uniprot website, whose unique protein database number is P0DP10 and the website link is https: / / www.uniprot.org / uniprotkb / P0DPI0 / entry .

[0051] (2) The combined tag is inserted into the N-terminus of the amino acid sequence of BoNT / A by homologous recombination, that is, the amino acid sequence of the designed recombinant botulinum toxin type A (BoNT / A) is shown in SEQ ID NO613.

[0052] The combined tag is a His tag and a SUMO tag.

[0053] Example 2: Design and ligation preparation of BoNT / A expression vector

[0054] (1) Selection of expression vector: A blank plasmid is used as the backbone vector of the BoNT / A expression vector. The obtained amino acids are codon-optimized to obtain a gene codon sequence that can be beneficially expressed in a prokaryotic host. The plasmid construction design software Snapgene is then used to perform theoretical sequence splicing, i.e., vector schematic construction design, to obtain a complete expression vector construction schematic diagram as shown in FIG. Figure 1 shown.

[0055] (2) Preparation of expression vector: First, the blank plasmid was extracted and identified. The identification results were as follows: Figure 2 As shown, the left lane shows that the plasmid was extracted.

[0056] (3) Synthesis and pre-amplification of target fragments: The chemically synthesized BoNT / A nucleotide sequence, i.e., the nucleotide sequence corresponding to SEQ ID NO 1, SEQ ID NO 3, and SEQ ID NO 5 included in the amino acid sequence, was first pre-amplified by PCR segmentation. The primer sequences were synthesized by the company's internal primer department. The upstream primer was: G0268322-1F: TATCGAAGCCCATCGCGAACAGATTGGTGGTATGCCGTTTGTTAATAAGCAGTTTAACTATAAG; the downstream primer was:

[0057] G0268322-1R1: CACCGGAATGGCAATTTCCGGAATGAATTCCAG; the expected amplified fragment length is 2100 bp, and gel electrophoresis identification is as follows Figure 3 Two amplified fragments are shown.

[0058] (4) Self-ligation of the target fragment and its ligation with the vector:

[0059] After the synthesized BoNT / A nucleotide fragments were connected, the reaction system for connecting with the vector was shown in Table 1. The connection principle of homologous recombinase was adopted, and the connection was carried out at a constant temperature of 52° C. for 30 minutes, and then the transformation was carried out.

[0060]

[0061] (5) Transformation of recombinant plasmid:

[0062] (a) Pipette 1-3ul of plasmid with a concentration of about 100ng / ul into 100μl of BL21 competent cells, gently shake and rotate to mix, and place on ice for 3 minutes. If the plasmid concentration is high, add less plasmid; if the plasmid concentration is low, add more plasmid;

[0063] (b) 42°C water bath for 90 seconds without shaking, then placed in an ice bath for about 3 minutes;

[0064] (c) Add 500-800 μl of 37°C pre-warmed LB medium to each tube and shake gently at 200 rpm at 37°C for 40 minutes.

[0065] (5) Verification of recombinant plasmid:

[0066] (a) preparing agar plates containing corresponding resistance;

[0067] (b) Take 100 μl of BL21 bacterial suspension and spread it on an agar plate containing the corresponding resistance. Use a sterile glass spreader to gently spread the bacteria on the surface of the plate and incubate the plate at 37°C for 15 minutes.

[0068] (c) Invert the plate and incubate at 37°C for 12-16 hours until colonies appear;

[0069] (d) Plate bacteria were picked and shaken at 37°C, 250 rpm for 14 h. The bacterial solution was used for PCR identification. The positive clone bacterial solution was sequenced. The upstream primers for sequencing

[0070] TATCGAAGCCCATCGCGAACAGATTGGTGGTATGCCGTTTGTTAATAAGCAGTTTAACTATAAG;

[0071] Sequencing downstream primer: CACCGGAATGGCAATTTCCGGAATGAATTCCAGPCR identification reaction system:

[0072] (e) Identification of BoNT / A transformant PCR products: The expected amplified fragment length of the designed primers was 2100 bp (partial sequence of the target gene). The PCR reaction used a 20 μL system: 0.5 μL of primers, 2 μL of template bacterial solution, 0.5 μL of polymerase buffer, 3 μL of buffer, and 14 μL of ddH2O. Cycling parameters: 96°C pre-denaturation for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 20 s, 23 cycles, and final extension at 72°C for 1 min. Figure 4 As shown, 8 BoNT / A transformants were selected for PCR product identification, and the primers used were G0268322-1F and G0268322-1R1 as described above. Positive transformants were selected and obtained.

[0073] (f) Enzyme digestion identification: After obtaining positive transformants, the pKMD-SUMO-BoNT / A expression plasmid (gene number: G0268322-1) was successfully constructed, and the plasmid structure was identified by enzyme digestion experiment. The enzyme selected was: EcoRI, and it was expected that two fragments of 1851 / 7599 would be obtained. The reaction system is shown in Table 2, and the experimental results are shown in Table 2. Figure 5 ;

[0074] Table 2. Enzyme digestion reaction system

[0075] pKMD-SUMO-BoNT / A Plasmid 5ul EcoR endonuclease 0.25ul 10xBuffer 1.0ul dd water Add to a final volume of 10ul Reaction temperature 37℃,1h

[0076] Example 3: Induced expression of BoNT / A protein and bacterial collection

[0077] Bacteria collection and expansion: Select the BL21 strain that can express the target protein from the identification, inoculate it into 1LTB medium (containing 50ug / ml kana), and expand the culture at 220rpm and 37℃ until OD 600To 0.6-0.8, then add 1mM IPTG at a final concentration and induce culture at 30℃ for 12h, then collect the bacteria by centrifugation at 4000rpm for later use.

[0078] The collected bacterial sludge was resuspended in 40 ml 20 mM PB + 150 mM Nacl, pH 7.2, and ultrasonically broken at 420 W in an ice bath for 3 seconds, 5 seconds at intervals, and continued for 15 minutes; centrifuged at 12000 rpm, 4 ° C for 20 minutes, and the supernatant and precipitate were collected separately for use; the experimental results are shown in Figure 5 .

[0079] Example 4: Affinity purification of bacterial supernatant and precipitated inclusion bodies

[0080] (1) Supernatant purification: The supernatant collected by centrifugation is filtered through a 0.22um filter membrane and then purified by Ni column affinity enrichment. Equilibrium buffer: "20mM PB + 150mM NaCl, pH 8.0"

[0081] Washing buffer: 20mM PB + 150mM NaCl + 5mM imidazole, pH 8.0

[0082] 20mM PB+150mM NaCl+20mM imidazole, pH 8.0

[0083] 20mM PB+150mM NaCl+50mM imidazole, pH 8.0

[0084] 20mM PB+150mM NaCl+80mM imidazole, pH 8.0

[0085] Elution buffer: 20mM PB + 150mM NaCl + 300mM imidazole, pH 8.0 flow through, purify the sample, add loading buffer and boil the sample at 100℃ and then perform SDS-PAGE analysis. The experimental results are as follows Figure 7 shown.

[0086] (2) Purification of inclusion body protein: The precipitate collected by centrifugation was resuspended in 20 mM PB + 150 mM Nacl, pH 7.2, and then purified by Ni column affinity enrichment.

[0087] Equilibration buffer: "20mM PB + 150mM NaCl, pH 8.0"

[0088] Washing buffer: 20mM PB + 150mM NaCl + 5mM imidazole, pH 8.0

[0089] 20mM PB+150mM NaCl+20mM imidazole, pH 8.0

[0090] 20mM PB+150mM NaCl+50mM imidazole, pH 8.0

[0091] 20mM PB+150mM NaCl+80mM imidazole, pH 8.0

[0092] Elution buffer: 20mM PB + 150mM NaCl + 300mM imidazole, pH 8.0 flow through, purify the sample, add loading buffer and boil the sample at 100℃ and then perform SDS-PAGE analysis. The experimental results are as follows Figure 8 shown.

[0093] (3) Enzymatic cleavage to remove SUMO tag and activate BoNT / A protein: After SUMO tag enzymatic cleavage, the SUMO tag is completely cut, and the experimental results are as follows: Fig. 9 As shown. The thrombin digestion of BoNT / A protein is now optimized and processed as follows:

[0094] Thrombin: Shanghai Yuanye Biotechnology Co., Ltd. Product No.: S10117-1ku Thrombin / Thrombin Lot:

[0095] M25HS179066

[0096] Experimental group 1: 0 u of thrombin was added to 1 mg of protein and the protein was digested for 16 hours.

[0097] Experimental group 2: 0.5 u of thrombin was added to 1 mg of protein and the protein was digested for 16 hours.

[0098] Experimental group 3: 1 u of thrombin was added to 1 mg of protein and the protein was digested for 16 hours.

[0099] Experimental group 4: 2 u of thrombin was added to 1 mg of protein and the protein was digested for 16 hours.

[0100] Experimental group 5: 3 u of thrombin was added to 1 mg of protein and the protein was digested for 16 hours.

[0101] Thrombin is obtained through artificial synthesis and does not exist in nature. People usually use thrombin for enzymatic cleavage to cut protein chains. When using thrombin, dosage is a very important factor. Too high a dosage may lead to unsafe problems such as thrombosis or bleeding and environmental pollution.

[0102] from Fig.10It can be seen that the result of thrombin cleavage and activation of the supernatant target protein is: when the amount of thrombin is 0u, the target protein does not present two fragments, so that the BoNT / A protein is not activated, that is, an inactive BoNT / A protein is obtained; when the amount of thrombin is 0.5u, 1u, 2u and 3u respectively, only when 1u, 2u and 3u of thrombin are added according to 1mg of protein, the target protein presents two fragments after thrombin cleavage, and the BoNT / A protein purified from the supernatant is more activated. At the same time, considering that the larger the amount of thrombin used, the more unsafe the risk is, so this scheme preferably adds 1u of thrombin according to 1mg of protein.

[0103] The results of thrombin activation of the supernatant and inclusion body target protein were as follows: 0.5u thrombin was added to 1mg protein and the enzyme digestion was performed for 16 hours. Fig.11 It can be seen.

[0104] Example 5: Comparative verification of the activity and safety of peptides

[0105] (1) Test drug: The test sample is the lyophilized protein powder of the recombinant botulinum toxin type A active polypeptide purified from the supernatant and precipitated inclusion bodies prepared by this method. Take one bottle of the test sample (50 μg) and add 1 ml of sterile water for injection to dissolve it.

[0106] Animals: Kunming mice, SPF grade, 26-30 days old, source: Guangdong Medical Experimental Animal Center; Laboratory Animal Production License: SCXK(Guangdong)2022-0002, Certificate of Conformity: №.44007200115254, purchased on 2023-03-23.

[0107] Laboratory Animal Use Permit: SYXK(Guangdong)2021-0253. Quarantine period: 2023-03-23 ​​to 2023-03-26.

[0108] Instruments: MS8001TS electronic balance (20213248); 902 ultra-low temperature refrigerator (20141115); HYC-390F medical refrigerator (20212898); DW-25L262 medical low temperature storage box (20212917).

[0109] (2) Experimental methods:

[0110] (a) Sample preparation: Take 1 bottle of the sample to be tested (50 μg), add 1 ml of sterile injection water, and dissolve. Dilute 10 times in sequence according to the 10-fold dilution method. 3 , 10 4 , 10 5 , 10 6 .

[0111] (b) Animal injection: dilution 10 3 , 104 , 10 5 , 10 6 There are 4 dilutions in total. Four SPF Kunming mice aged 26-30 days were injected intraperitoneally with 0.1 ml per mouse. The survival and death of mice within 4 days were counted. The toxicity of this product was calculated by statistical methods (Reed-Muench) in units of LD 50 / ml.

[0112] (3) Experimental results: The protein safety data of the recombinant botulinum toxin type A active polypeptides purified from the supernatant and the recombinant botulinum toxin type A active polypeptides derived from the precipitated inclusion bodies are shown in Table 3.

[0113] Table 3. Protein safety data of recombinant botulinum toxin type A active polypeptide

[0114]

[0115]

[0116] LD 50 Distance ratio calculation: Calculated according to the Reed-Muench method: Distance ratio = (number of deaths above 50% - 50%)

[0117] / (% of deaths above 50% -% of deaths below 50%) That is, distance ratio = (100% - 50%) / (100% - 0%)

[0118] =50 / 100=0.5,LD 50 = logarithm of sample dilution above 50% + logarithm of distance ratio × logarithm of dilution factor, i.e., LgLD 50 = -5 + 0.5 × (-1) = -5.5, 1 × 10 5.5 LD 50 It refers to the toxicity unit of the sample under the condition of injection volume of 0.1ml, that is, 1×10 5.5 LD 50 / 0.1ml. The pharmacopoeia takes 0.5ml volume to inject into mice, so 5×10 5.5 LD50 / ml. Pharmacopoeia 3.1 stipulates 1×10 7 LD 50 / mg or more, 1000 / 50=20 times, i.e. 5×10 5.5 LD 50 / ml×20 times=1×10 7.5 LD 50 / mg.

[0119] Therefore, the toxicity of the sample with an injection volume of 0.1 ml of recombinant botulinum toxin type A purified from supernatant is 1×105.5 LD50, while the protein toxicity of the recombinant botulinum toxin type A purified from precipitated inclusion bodies is significantly weaker, that is, in use, the recombinant botulinum toxin type A purified from supernatant can be effective at a lower dose, which is significantly safer than the recombinant botulinum toxin type A purified from precipitated inclusion bodies which require large doses.

[0120] In summary, the present invention has verified through comparative experiments that the recombinant botulinum toxin type A active polypeptide derived from the supernatant can efficiently remove the tag when purified using the SUMO tag, is highly activated after enzyme cleavage, and has significant safety in use while having outstanding potent toxicity.

[0121] The present invention may be summarized in other specific forms that do not violate the spirit or main features of the present invention. Therefore, no matter from which point of view, the above embodiments of the present invention can only be regarded as an explanation of the present invention and cannot limit the present invention. The claims indicate the scope of the present invention, while the above description does not indicate the scope of the present invention. Therefore, any changes within the meaning and scope equivalent to the claims of the present invention should be considered to be included in the claims of the present invention.

Claims

1. A recombinant botulinum toxin type A, Features: Its amino acid sequence is shown in SEQ ID NO 13.

2. A method for preparing a recombinant botulinum toxin type A, It is characterized in that The following steps are involved: (1) Designing and constructing the recombinant botulinum toxin type A described in claim 1; (2) Design and ligation of BoNT / A expression vector; (3) Induced expression of BoNT / A protein and bacterial collection; (4) Affinity purification of bacterial supernatant; (5) Enzymatic cleavage removes the SUMO tag and activates the BoNT / A protein.

3. The method for preparing the recombinant botulinum toxin type A according to claim 2, It is characterized in that The experimental steps of enzymatically removing the SUMO tag and activating the BoNT / A protein are as follows: after the SUMO tag is enzymatically cleaved, 1 u of thrombin is added according to 1 mg of protein.

4. The preparation method according to claim 3, Features: The induction expression steps of the BoNT / A protein are as follows: 600 After the concentration of 0.6, IPTG was added at a final concentration of 1 mM and induced at 30°C for 12 h.

5. The preparation method according to claim 4, Features: The bacterial cell collection steps are as follows: centrifuge at 4000rpm to collect bacterial sludge, resuspend with 40ml 20mM PB+150mM Nacl, pH 7.2, and disrupt with 420W ice bath ultrasound, ultrasound for 3S, interval of 5S, for 15min; centrifuge at 12000rpm, 4℃ for 20min to collect supernatant again; The specific steps of affinity purification of the bacterial supernatant are as follows: the supernatant collected by centrifugation is filtered through a 0.22um filter membrane and then purified by Ni column affinity enrichment, wherein the equilibration buffer is 20mM PB+150mM NaCl, the washing buffer is 20mM PB+150mMNaCl+5mM imidazole, 20mM PB+150mM NaCl+20mM, 20mM PB+150mM NaCl+50mM imidazole, 20mM PB+150mM NaCl+80mM imidazole, the elution buffer is 20mM PB+150mM NaCl+300mM imidazole, and the pH of the reagents is pH 8.0.

Citation Information

Patent Citations

  • Recombinant expression of proteins in a disulfide-bridged, two-chain form

    CN103320459A

  • Recombinant genetically engineered bacterium of A-type botulinum toxin as well as preparation and application thereof

    CN118006523A

  • Mutant of botulinum toxin A and application thereof

    CN118126143A