RNA inhibitor for inhibiting APOC3 gene expression and its application
By designing an RNA inhibitor that specifically interferes with the APOC3 gene and using the liver-specific receptor ASGPR for targeted delivery, the problems of insufficient efficiency and sustainability of APOC3 gene expression inhibition in existing technologies were solved, and effective treatment of related diseases was achieved.
Patent Information
- Application Number
- CN202310655563.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-17
- Filing Date
- 2023-06-05
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2043-06-05
AI Technical Summary
Existing RNA inhibitors are insufficiently efficient and persistent in inhibiting APOC3 gene expression, making it difficult to effectively treat APOC3-related diseases such as hypertriglyceridemia and familial chylomicronemia.
An RNA inhibitor that specifically interferes with the APOC3 gene is designed. The sense and antisense chains formed by specific base pairing are combined with a vector structure and targeted delivery is performed using the liver-specific receptor ASGPR to improve the inhibition efficiency and duration.
It effectively inhibits the expression of APOC3 protein, reduces harmful lipoprotein indicators, and increases "good" cholesterol levels, providing hope for the treatment of hypertriglyceridemia, severe hypertriglyceridemia and familial chylomicronemia.
Smart Images

Figure CN116814621B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and particularly relates to an RNA inhibitor for inhibiting APOC3 gene expression and an application thereof. Background Art
[0002] RNA inhibitors
[0003] RNA inhibitors (RNA interference) were discovered in 1998 by Andrew Z. Fire and others while conducting antisense RNA inhibition experiments in Caenorhabditis elegans. This process was named RNA inhibitors. This discovery was named one of the top ten scientific advances of 2001 by Science magazine and ranked first among the top ten scientific advances of 2002. Since then, siRNAs, which work by RNA inhibitors, have garnered widespread attention as potential gene therapy drugs. In 2006, Andrew Z. Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of the mechanism of RNA inhibitors. RNA inhibitors are triggered by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. During RNA inhibitors, an endonuclease called Dicer cuts or "dices" long dsRNA into smaller fragments of 21 to 25 nucleotides. These small fragments, called small interfering RNA (siRNA), have their antisense strands (Guide strands) loaded onto the Argonaute protein (AGO2). AGO2 loading occurs in the RISC-loading complex, a ternary complex composed of Argonaute protein, Dicer, and dsRNA binding protein (TRBP for short). During the loading process, the positive strand (Passenger strand) is cleaved and expelled by AGO2. AGO2 then uses the antisense strand to bind to mRNA containing a completely complementary sequence and then catalyzes the cleavage of these mRNAs, causing the mRNA to split and lose its role as a translation template, thereby preventing the synthesis of related proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex loaded with the antisense strand is recycled for another round of cleavage.
[0004] According to statistics, over 80% of disease-related proteins in the human body cannot be targeted by currently available small-molecule drugs or biopharmaceuticals, making them undruggable. Gene therapy, which aims to treat diseases through gene expression or silencing, is considered by the industry to be the third generation of therapeutics, following small-molecule and biopharmaceutical drugs. This approach treats diseases at the genetic level, unhindered by the constraints of undruggable proteins. As the most mainstream type of gene therapy, RNA inhibitor technology targets diseases at the mRNA level, offering higher efficacy than small-molecule and biopharmaceutical drugs that target proteins. Using RNA inhibitor technology, highly specific and potent siRNA sense and antisense strands can be designed based on specific gene sequences. These single-stranded sequences are then synthesized through solid-phase synthesis. The sense and antisense strands are then combined in a specific annealing buffer according to base pairing principles to form siRNA. Finally, siRNA is delivered to the target site in the body via a delivery system, where it degrades the target mRNA, disrupting its function as a translation template and thereby preventing the synthesis of the associated protein.
[0005] siRNA delivery system
[0006] siRNA is unstable in blood and tissues and easily degraded by nucleases. To improve siRNA stability, modifications can be made to the sense and / or antisense strands of the siRNA. However, these chemical modifications provide only limited protection from nuclease degradation and may ultimately affect siRNA activity. Therefore, a suitable delivery system is needed to ensure the safe and efficient passage of siRNA across the cell membrane. Due to its large molecular weight, high negative charge, and high water solubility, siRNA cannot successfully cross the cell membrane and enter the cell on its own.
[0007] Liposomes, with their basic structure consisting of a hydrophilic core and a phospholipid bilayer, possess a phospholipid bilayer similar to biological membranes and possess high biocompatibility. This is why liposomes once became the most popular and widely used siRNA delivery vehicle. Liposome-mediated siRNA delivery primarily involves encapsulating siRNA within liposomes, protecting it from nuclease degradation and improving its efficiency across cell membrane barriers, thereby promoting cellular uptake. Examples include anionic liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic lipids. While some progress has been made, liposomes themselves are prone to inflammatory responses, necessitating the use of multiple antihistamines and hormones, such as cilitidine and dexamethasone, prior to administration to mitigate potential acute inflammatory reactions. Therefore, liposomes are not suitable for all therapeutic areas in actual clinical practice, especially for the treatment of chronic diseases, where the potential for cumulative toxicity from long-term use is a potential safety concern. Therefore, a safer and more effective delivery system for siRNA is needed.
[0008] The asialoglycoprotein receptor (ASGPR) in the liver is a receptor specifically expressed on hepatocytes and is a highly efficient endocytic receptor. Because galactose residues are exposed at the penultimate end of various glycoproteins after enzymatic or acidic hydrolysis of sialic acid in the body, ASGPR specifically binds to galactosyl groups, hence its name, the galactose-specific receptor. Monosaccharides and polysaccharides such as galactose, galactosamine, and N-acetylgalactosamine all have a high affinity for ASGPR. The primary physiological function of ASGPR is to mediate the clearance of substances such as asialoglycoproteins and lipoproteins from the blood, and it is closely associated with the development and progression of liver diseases such as viral hepatitis, cirrhosis, and liver cancer. The discovery of this characteristic of ASGPR has played a significant role in the diagnosis and treatment of liver diseases (Ashwell G, Harford J, Carbohydrate-specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Liver-derived disease therapeutic drugs containing galactose or galactosamine and their derivatives in their structures can specifically bind to ASGPR, thereby having active liver targeting and requiring no other carrier system for delivery.
[0009] APOC3 and cardiovascular and cerebrovascular diseases
[0010] APOC3 (apolipoprotein C-III) is the gene encoding apolipoprotein C3. It is approximately 3.1 kb in length and is an 8.8 kD glycoprotein composed of 79 amino acid residues. It is primarily synthesized in the liver. APOC3 inhibits the activity of lipoprotein lipase and hepatic lipase, interfering with ApoE-mediated binding of triglyceride (TG)-rich lipoproteins to hepatic lipase, affecting lipid metabolism and potentially leading to hypertriglyceridemia. Numerous association studies have shown that the Sst I cleavage site polymorphism in the APOC3 gene is associated with hypertriglyceridemia, and therefore may also be associated with other cardiovascular diseases caused by hypertriglyceridemia.
[0011] APOC3 plays a key role in the metabolism of triglyceride-rich lipoproteins. In normal fasting plasma, it is primarily bound to high-density lipoprotein cholesterol (HDL-c) (approximately 70%). However, in patients with hypertriglyceridemia, plasma APOC3 levels are significantly elevated, with the primary concentration (approximately 86%) being bound to very low-density lipoprotein (VLDL).
[0012] Domestic and international studies have shown that elevated plasma APOC3 levels can cause hypertriglyceridemia, and that plasma APOC3 levels are positively correlated with plasma triglycerides and very-low-density lipoprotein triglyceride levels. Numerous studies have reported a correlation between APOC3 gene function and cardiovascular and cerebrovascular diseases such as coronary atherosclerosis, type 2 diabetes, and cerebral infarction.
[0013] Familial hyperchylomicronemia (FCS), also known as lipoprotein lipase deficiency, is a rare autosomal recessive genetic disorder, also known as primary hyperlipoproteinemia type I, that requires long-term dietary fat restriction. Prior to November 2012, there was no effective treatment for FCS. FCS is characterized by elevated triglycerides and recurrent pancreatitis. In November 2012, the European Commission (EC) approved Glybera, the first gene therapy drug in the Western world. However, Glybera is prohibitively expensive, with an estimated cost of €1.25 million (approximately $1.6 million) per patient. There is an urgent need for a specific treatment for FCS. APOC3 is a key regulator of lipid metabolism. Loss-of-function mutations in APOC3 inhibit the clearance of triglyceride-rich lipoprotein particles by hepatocytes, leading to elevated triglyceride and very low-density lipoprotein cholesterol (VLDL) levels in the blood and decreased HDL-c levels. By silencing APOC3 expression, harmful lipoprotein markers (i.e., triglycerides and very low-density lipoprotein (VLDL) levels) are reduced while levels of "good" cholesterol (HDL-c) are increased. APOC3 small interfering inhibitors are being developed for the treatment of hypertriglyceridemia (HTG), severe hypertriglyceridemia (sHTG), and familial chylomicronemia syndrome (FCS), offering new hope for the treatment of chylomicronemia.
[0014] Existing technology can use RNA interference technology to inhibit APOC3 gene expression, but the inhibition efficiency and sustainability still need to be improved. The market needs an RNA inhibitor with higher inhibition efficiency and longer-lasting effect. Summary of the Invention
[0015] To address the above-mentioned issues, the present invention provides an RNA inhibitor or a pharmaceutically acceptable salt thereof for inhibiting APOC3 gene expression. This RNA inhibitor specifically interferes with APOC3 gene mRNA, disrupting its function as a translation template and preventing APOC3 protein expression, thereby preventing and / or treating diseases mediated by the APOC3 gene. The RNA inhibitor of the present invention exhibits excellent APOC3 protein expression inhibition with a long-lasting effect, and possesses high medical value.
[0016] In one aspect, the present invention provides an RNA inhibitor for inhibiting APOC3 gene expression or a pharmaceutically acceptable salt thereof, wherein the RNA inhibitor is formed by base pairing of a sense strand and an antisense strand, each independently having a chain length of 15-30 nucleotides, wherein the chain lengths are each independently preferably 19-23 nucleotides, and there is at least 80% base complementarity between the sense strand and the antisense strand.
[0017] In some embodiments, preferably, the antisense strand is selected from a) the following sequences, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides: 5'uugguggcgugcuucauguaatt 3' (SEQ ID NO.212), 5'uaacccugcaugaagcugagatt 3' (SEQ ID NO.216), 5'uuaacggugcuccaguagucutt 3' (SEQ ID NO.224), 5'cagagaacuuguccuuaacggtt3' (SEQ ID NO.225), 5'uauugaggucucaggcagccatt 3' (SEQ ID NO.241), 5'ugaaguuggucugaccucaggtt 3' (SEQ ID NO.256), 5'gcacugagaauacugucccuuuu 3' (SEQ ID NO.257). IDNO.256),5'gcacugagaauacugucccuu3'(SEQ ID NO.459),5'acacugagaauacugucccua 3'(SEQ ID NO.461),5'ugaauacugucccuuuuaagc 3'(SEQ ID NO.465),5'cugagaauacugucccuuuua 3'(SEQ ID NO.471), 5'acugagaauacugucccuuua 3' (SEQ ID NO.472), 5'uaauacugucccuuuuaagcaa 3' (SEQ ID NO.438), 5'ugaggucucaggcagccacgg3' (SEQ ID NO.600), 5'uggauaggcagguggacuugg3' (SEQ ID NO.620),5'caggauggauaggcaggugga3'(SEQ ID NO.624), 5'gagcacugagaauacuguccc3' (SEQ ID NO.668), 5'acacugagaauacugucgcuc3' (SEQ ID NO.687), 5'acacugagaauacugucgcuu3' (SEQ ID NO.700), 5'ucacugagaauacugucccuu 3' (SEQ ID NO.519);
[0018] Wherein, g = guanylate, a = adenylate, u = uridylate, c = cytidylate, t = thymidylate.
[0019] It should be noted that at least 15 consecutive nucleotides independently represent 15, 16, 17, 18, 19, 20, 21, etc. consecutive nucleotides. A difference of less than 3 nucleotides independently represents 1, 2, or 3 different nucleotides. It should be noted that the sense and antisense strands exemplified below are not limited to the combinations shown in the examples herein to form RNA inhibitors. As long as they can complement each other to form a double strand, the sense and antisense strands can be combined in any manner, without being limited by the examples.
[0020] In some embodiments, more preferably, the sense strand and the antisense strand are selected from a) the following sequences, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides; the sequence combinations of the sense strand and the antisense strand are as follows:
[0021]
[0022] Wherein, g = guanylate, a = adenylate, u = uridylate, c = cytidylate, t = thymidylate.
[0023] In the RNA inhibitor of the present invention, one or more nucleotides on the sense strand and / or antisense strand may be modified to form modified nucleotides.
[0024] Preferably, in the RNA inhibitor described in the present invention, the sense strand and / or the antisense strand contains at least one 2'-modified nucleotide, and the 2'-modified nucleotide includes: 2'-O-methyl nucleotide, 2'-deoxy-2'-fluoro nucleotide, 2'-deoxy nucleotide, 2'-methoxyethyl nucleotide, 2'-amino nucleotide or 2'-alkyl nucleotide.
[0025] More preferably, in the RNA inhibitor of the present invention, the sense strand and / or the antisense strand comprises at least one 2'-O-methyl nucleotide or 2'-deoxy-2'-fluoro nucleotide.
[0026] Preferably, in the RNA inhibitor of the present invention, the phosphate bonds between three adjacent nucleotides at at least one of the ends of the sense strand and / or the antisense strand may be thiolated.
[0027] In the above technical solution, preferably, the sense strand and the antisense strand are selected from a) the following sequences, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides:
[0028]
[0029]
[0030] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate, Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidylate, fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidylate, and T = thymidylate.
[0031] In the technical solution, preferably, the RNA inhibitor or a pharmaceutically acceptable salt thereof further contains a carrier structure, and the RNA inhibitor is represented by Formula Ia, Ib or Ic:
[0032]
[0033]
[0034] in,
[0035] The vector structure includes 5'MVIP and 3'MVIP;
[0036] 5'MVIP consists of a transfer point R1, a connecting chain D, a linker B, a side chain L, and a liver-targeting specific ligand X. It is connected to the 5' end of the sense chain or the 5' end of the antisense chain through the transfer point R1. Its structure is shown in Formula I:
[0037] (XL) n -BDR I -
[0038] I
[0039] 3'MVIP consists of a transfer point R2, a connecting chain D, a linker B, a side chain L, and a liver-targeting specific ligand X. It is connected to the 3' end of the sense chain or the 3' end of the antisense chain through the transfer point R2. Its structure is shown in Formula II:
[0040] (XL) m -BD-R2-
[0041] II
[0042] in,
[0043] n and m are each independently any integer from 0 to 4, preferably an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, more preferably 4;
[0044] As an embodiment, the transition point R1 is a heterocyclic or carbocyclic structure containing N, S or O as shown below:
[0045]
[0046] Alternatively, R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6;
[0047] As an embodiment, the transition point R2 is a heterocyclic or carbocyclic structure containing N, S or O as shown below:
[0048]
[0049] Alternatively, the transfer point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4;
[0050] The liver-targeting specific ligand X is the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP, and is selected from monosaccharides and their derivatives, preferably from N-acetylgalactosamine and its derivatives, and more preferably from the following structures:
[0051]
[0052] Wherein, as an embodiment, W is selected from -OH, -NHCOOH and -NHCO(CH2) q One or two of CH3, wherein q is an integer from 0 to 4;
[0053] As an embodiment, the branch chain L is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from one or more of the following structures:
[0054]
[0055]
[0056] wherein r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, wherein the alkyl group is, for example, a C1-C5 alkyl group;
[0057] As an embodiment, linker B is the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP, and is selected from the following structures:
[0058]
[0059] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is any integer from 0 to 4;
[0060] As an embodiment, the connecting chain D is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from the following structures:
[0061]
[0062]
[0063] wherein each p is independently any integer from 1 to 20; s is any integer from 2 to 13; Z1 and Z2 are the same or different substituent groups;
[0064] It should be noted that the above structures are not exhaustive. As long as the vector is connected to the sequence of the present invention, regardless of whether the delivery method is disclosed or undisclosed, and the target is any receptor or any structure, it is within the scope of protection of the present invention.
[0065] Published delivery methods include: coupled carrier delivery methods, including cholesterol coupling, antibody coupling, folic acid coupling, and GalNac coupling, and lipid encapsulation delivery methods, including lipid nanoparticles (LNPs), polymeric nanoparticles, and extracellular vesicles.
[0066] Further preferably, in the RNA inhibitor or pharmaceutically acceptable salt thereof according to the present invention, the carrier structure at the 5' end of the sense chain is 5'MVIP17, the carrier structure at the 3' end of the sense chain is 3'MVIP17, and the combination of the sense chain 5'MVIP and the antisense chain 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, 5'MVIP17 / 3'MVIP01 or 5'MVIP09 / 3'MVIP09, or the combination of the sense chain 5'MVIP and the antisense chain 3'MVIP is 5'MVIP01 / 3'MVIP09, 5'MVIP09 / 3'MVIP01 or 5'MVIP01 / 3'MVIP01.
[0067] More preferably, in the RNA inhibitor or pharmaceutically acceptable salt thereof according to the present invention, the RNA inhibitor is selected from Ky-12-DS23001, Ky-12-DS25001, Ky-12-DS25401, Ky-12-DS29701, Ky-12-DS29801, Ky-12-DS31701, Ky-12-DS31702, Ky-12-DS31703, Ky-12-DS31704, Ky-12-DS31705, Ky-12-DS31706, Ky-12-DS31707, Ky-12-DS31708, Ky-12-DS31709, Ky-12-DS31711 , Ky-12-DS31712, Ky-12-DS31713, Ky-12-DS33001, Ky-12-DS33006, Kylo-12-DS1071, Kylo-12-DS1081, Kylo-12-DS1131, Kylo-12-DS1141, Kylo-12-D S1241, Kylo-12-DS1311, Kylo-12-DS1321, Kylo-12-DS5911, Kylo-12-DS2911, Kylo-12-DS2611, Kylo-12-DS2311, Kylo-12-DS3111 and Kylo-12-DS5411.
[0068] On the other hand, the present invention also provides the use of the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating and / or preventing diseases associated with elevated APOC3 levels. Diseases associated with elevated APOC3 levels include hepatocellular diseases, including inflammatory, cardiovascular and cerebrovascular, and metabolic diseases, wherein the cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, aortic valve stenosis, hypertriglyceridemia (HTG), severe hypertriglyceridemia (sHTG), or familial chylomicronemia syndrome (FCS).
[0069] In another aspect, the present invention provides a pharmaceutical composition comprising the aforementioned RNA inhibitor for inhibiting APOC3 gene expression or a pharmaceutically acceptable salt thereof and optional pharmaceutically acceptable excipients, wherein the pharmaceutically acceptable excipients may be pharmaceutically acceptable excipients, carriers and / or diluents. The pharmaceutical composition is in the form of an oral agent, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.
[0070] In another aspect, the present invention also provides a method for treating and / or preventing a disease, condition, or syndrome associated with elevated APOC3 levels, comprising administering to a subject in need thereof a therapeutically effective amount of an RNA inhibitor that inhibits APOC3 gene expression, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof and optional pharmaceutically acceptable excipients. The administration route (dosage route) to the subject includes oral administration, intravenous injection, subcutaneous or intramuscular injection, rectal or intraperitoneal administration, and nebulized inhalation. Those skilled in the art will readily appreciate other aspects and advantages of the present application from the detailed description below. The detailed description below only shows and describes exemplary embodiments of the present application. As those skilled in the art will appreciate, the disclosure of the present application enables those skilled in the art to modify the disclosed embodiments without departing from the spirit and scope of the invention to which the present application relates. Accordingly, the drawings and descriptions in the specification of the present application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS
[0071] The specific features of the inventions of this application are set forth in the appended claims. The features and advantages of the inventions of this application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:
[0072] Figure 1 This is a schematic diagram of the average hAPOC3 level in the serum of hAPOC3 Tg mice after RNA inhibitor intervention in Example 9 of the present application;
[0073] Figure 2 This is a schematic diagram of the inhibitory effect of the RNA inhibitor on APOC3 mRNA levels after intervention in Example 10 of the present application;
[0074] Figure 3 This is a schematic diagram of the inhibitory effect of the RNA inhibitor on the APOC3 mRNA level in HepG2 cells after intervention in Example 11 of the present application;
[0075] Figure 4 This is a schematic diagram of the inhibitory effect of the RNA inhibitor on APOC3 mRNA levels in PHH cells after intervention in Example 12 of the present application;
[0076] Figure 5 This is a schematic diagram of the average hAPOC3 level in the serum of hAPOC3 Tg mice after RNA inhibitor intervention in Example 13 of the present application;
[0077] Figure 6 This is a schematic diagram of the average TG levels in the serum of hAPOC3 Tg mice after RNA inhibitor intervention in Example 13 of the present application;
[0078] Figure 7 This is a schematic diagram of the hAPOC3 inhibitory effect in hAPOC3 Tg mouse serum after RNA inhibitor intervention in Example 14 of the present application;
[0079] Figure 8 This is a schematic diagram of the effect of reducing TC in the serum of hAPOC3 Tg mice after intervention with the RNA inhibitor in Example 14 of the present application;
[0080] Figure 9 This is a schematic diagram of the effect of reducing TG in the serum of hAPOC3 Tg mice after intervention with RNA inhibitors in Example 14 of the present application;
[0081] Figure 10 This is a schematic diagram of the effect of reducing LDL-c in the serum of hAPOC3 Tg mice after intervention with the RNA inhibitor in Example 14 of the present application;
[0082] Figure 11 This is a schematic diagram of the inhibitory effect of APOC3 in the serum of high-fat cynomolgus monkeys after intervention with the RNA inhibitor in Example 15 of the present application;
[0083] Figure 12 This is a schematic diagram of the effect of reducing TG in the serum of high-fat cynomolgus monkeys after intervention with RNA inhibitors in Example 15 of the present application;
[0084] Figure 13 This is a schematic diagram of changes in HDL-c levels in the serum of high-fat cynomolgus monkeys after intervention with the RNA inhibitor in Example 15 of the present application;
[0085] Figure 14 This is a schematic diagram of the effect of reducing LDL-c in the serum of high-fat cynomolgus monkeys after intervention with the RNA inhibitor in Example 15 of the present application;
[0086] Figure 15 This is a schematic diagram of the effect of reducing TC in the serum of high-fat cynomolgus monkeys after intervention with RNA inhibitors in Example 15 of the present application. DETAILED DESCRIPTION
[0087] The following describes the embodiments of the present invention through specific embodiments. People skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.
[0088] Definition of terms
[0089] In this application, examples of APOC3 mRNA sequences are readily available from public databases such as GenBank, UniProt, and OMIM. The term "APOC3" encompasses human APOC3, cynomolgus macaque APOC3, rhesus macaque APOC3, mouse APOC3, rat (Rattus norvegicus) APOC3, rabbit (Oryctolagus) APOC3, and the like; any organism that actually possesses an APOC3 gene is within the scope of the present invention. The human APOC3 mRNA sequence can be found, for example, in GenBank NM_000040.3. Cynomolgus monkey APOC3, its amino acids and its complete coding sequence can be found, for example, in GenBank Accession No. GI:544489959 (XM_05579730.1); macaque monkey APOC3, its amino acids and its complete coding sequence can be found, for example, in GenBank Accession No. GI:297269260 (XM_001090312.2); mouse APOC3, its amino acids and its complete coding sequence can be found, for example, in GenBank Accession No. GI:577019555 (NM_023114.4); rat (Rattus norvegicus) APOC3's amino acids and its complete coding sequence can be found, for example, in GenBank Accession No. GI:402534545 (NM_012501.2); and rabbit (Ornithogalum) APOC3, GenBank Accession No. GI:655601498 (XM_002708371.2).
[0090] In this application, the terms "iRNA," "RNA inhibitor," "iRNA agent," and "RNA interfering agent" are used interchangeably and generally refer to agents comprising RNA, as defined herein, that mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNAs direct sequence-specific degradation of mRNAs via a process known as RNA interference (RNA inhibitors). iRNAs regulate (e.g., inhibit) expression of the APOC3 gene in cells (e.g., cells in a subject, such as a mammalian subject).
[0091] In certain embodiments, the RNA inhibitor can be a single-stranded siRNA (ssRNA inhibitor) introduced into a cell or organism to inhibit a target mRNA. The single-stranded RNA inhibitor binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNA is generally 15 to 30 nucleotides and is chemically modified.
[0092] In certain embodiments, the "iRNA" used in this application is a double-stranded RNA, and is referred to herein as a "double-stranded RNA inhibitor," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to the target RNA (i.e., the APOC3 gene). In some embodiments of the present application, double-stranded RNA (dsRNA) triggers the degradation of a target RNA (e.g., mRNA) through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNA inhibitors).
[0093] The duplex structure can be any length that allows the desired target RNA to be specifically degraded by the RISC pathway, and can be within the range of about 19 to 36 base pairs, for example, a length of about 19-30 base pairs, for example, a length of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 base pairs. Ranges and lengths intermediate to the above ranges and lengths are also included as part of this application. In certain embodiments, the iRNA agent of the present application is a dsRNA having 15-23 nucleotides in each chain that interacts with a target RNA sequence (e.g., an APOC3 gene) to guide the cutting of the target RNA. In certain embodiments, the iRNA agent of the present application is a dsRNA of 24-30 nucleotides that interacts with a target RNA sequence (e.g., an APOC3 target mRNA sequence) to guide the cutting of the target RNA.
[0094] Typically, the majority of the nucleotides in each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each strand or both strands may also include one or more non-ribonucleotides, for example, deoxyribonucleotides or modified nucleotides. In addition, "iRNA" as used herein may include ribonucleotides having chemical modifications; iRNA may include substantial modifications at multiple nucleotides. The term "modified nucleotides" as used herein means nucleotides independently having a modified sugar moiety, a modified internucleotide linkage or a modified nucleobase, or any combination thereof. Thus, the term "modified nucleotides" encompasses substitutions, additions or removals of, for example, functional groups or atoms of internucleotide linkages, sugar moieties or nucleobases. Modifications suitable for use in the present application's agents include all types of modifications disclosed herein or known in the art.
[0095] In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides or their analogs) of any length. Polynucleotides can have any three-dimensional structure and can perform any function. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNA inhibitor reagents and primers. Polynucleotides can be modified or substituted with any of the various modifications or substitutions described herein or known in the art at one or more bases, sugars and / or phosphates. Polynucleotides can include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, the nucleotide structure can be modified before or after polymer assembly. The nucleotide sequence can be blocked by non-nucleotide components. Polynucleotides can be modified after polymerization, for example, by coupling with a labeling component. The term can include both double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the present application as a polynucleotide includes both the double-stranded form and each of the two complementary single-stranded forms known or predicted to constitute the double-stranded form.
[0096] As used herein, the term "target nucleic acid" or "target sequence" generally refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of an APOC3 gene, including mRNAs that are RNA processing products of the primary transcription product. The target portion of the sequence should be at least long enough to serve as a substrate for iRNA-guided cleavage at or near that portion of the nucleotide sequence of the mRNA molecule formed during transcription of the APOC3 gene. In one embodiment, the target sequence is within the protein-coding region of APOC3. The target sequence can be approximately 19-36 nucleotides in length, for example, preferably approximately 19-30 nucleotides in length. Ranges and lengths intermediate to the aforementioned ranges and lengths are also encompassed by this application.
[0097] In this application, the term "nucleotide sequence" generally refers to a series or order of nucleobases, nucleotides and / or nucleosides, whether modified or unmodified, described by a series of letters using standard nucleotide nomenclature and the symbols for modified nucleotides described in this application.
[0098] In this application, the term "oligonucleotide" generally refers to a polymer composed of a plurality of nucleotide residues (deoxyribonucleotides or ribonucleotides, or their relevant structural variants or synthetic analogs) connected by a phosphodiester bond (or their relevant structural variants or synthetic analogs). Therefore, although the term "oligonucleotide" generally refers to a naturally occurring nucleotide polymer in which the nucleotide residues and the connection therebetween are naturally occurring, it should be understood that the scope of the term also includes various analogs, including but not limited to: peptide nucleic acids (PNAs), phosphoramidates, phosphorothioates, methylphosphonates, 2-O-methylribonucleic acids, etc. The exact size of the molecule can depend on specific applications. Oligonucleotides are generally shorter in length, typically having approximately 10-30 nucleotide residues, but the term can also refer to molecules of any length, although the terms "polynucleotide" or "nucleic acid" are generally used for larger oligonucleotides.
[0099] In certain embodiments, the oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides. The term "modified oligonucleotide" generally refers to an oligonucleotide comprising at least one modified nucleoside and / or at least one modified internucleoside linkage.
[0100] In this application, the term "modified nucleoside" generally means a nucleoside that contains at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. The modified nucleoside contains a modified sugar moiety and / or a modified nucleobase.
[0101] In this application, the term "nucleobase" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine, guanine, cytosine, thymine and uracil. Nucleotides can include modified nucleotides or nucleotide mimetics, abasic sites (Ab or X) or substitute replacement parts. As used in this application, "nucleobase sequence" generally refers to the order of consecutive nucleobases that do not rely on any sugar, linkage or nucleobase modification. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine and guanine; and the pyrimidine bases thymine, cytosine and uracil. "Modified nucleobase" generally refers to any nucleobase that is not a naturally occurring nucleobase.
[0102] "G", "C", "A", "T" and "U" each generally represent a nucleotide containing guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it should be understood that the term "ribonucleotide" or "nucleotide" may also refer to a modified nucleotide, and specific reference may be made to Tables 1 and 2. It is well known to those skilled in the art that guanine, cytosine, adenine, thymidine and uracil can be replaced by other parts without significantly changing the base pairing properties of the oligonucleotide containing the nucleotide with such a replacement part. For example, but not limited to, i (inosinic acid), also called hypoxanthine, can base pair with a, c, and u, and in some cases i can also pair with g, a phenomenon known as the wobble phenomenon. Therefore, a nucleotide containing a, c or u can be replaced by a nucleotide containing, for example, i in the nucleotide sequence of the dsRNA characterized in the present application. In another embodiment, a and c anywhere in the oligonucleotide can be replaced with g and u, respectively, to form a gu wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for use in the compositions and methods of the present application.
[0103] In this application, the term "sugar moiety" generally refers to a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally refers to a ribofuranosyl group as found in naturally occurring RNA or a deoxyribofuranosyl group as found in naturally occurring DNA. A "modified sugar moiety" refers to a substituted sugar moiety or a sugar surrogate.
[0104] In this application, the term "internucleoside linkage" generally refers to the covalent linkage between adjacent nucleosides in an oligonucleotide. "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. "Modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage.
[0105] In this application, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide molecule having a nucleobase sequence that is complementary to a corresponding fragment of a target nucleic acid (e.g., a target genomic sequence, a pre-mRNA, or an mRNA molecule). In certain embodiments, the antisense oligonucleotide is 12 to 30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is an unmodified or modified nucleic acid having a nucleotide sequence that is complementary to a target nucleic acid (e.g., an APOC3 polynucleotide).
[0106] In the present application, the term "antisense strand" generally refers to the chain of an RNA inhibitor (e.g., dsRNA) that includes a region that is substantially complementary to the target sequence. When used in the present invention, the term "region of complementarity" generally refers to a region on the antisense strand that is substantially complementary to a sequence defined herein (e.g., a target sequence). When the region of complementarity is not fully complementary to the target sequence, mispairing can be in the interior or terminal regions of the molecule. Typically, the most tolerated mispairing is in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides at the 5' end and / or 3' end.
[0107] In this application, the term "sense strand" (S) generally refers to a strand of an RNA inhibitor that includes a region that is substantially complementary to the region of the antisense strand as defined herein. The "sense" strand is sometimes referred to as a "sense" strand, a "passenger" strand, or an "anti-guide" strand. By means of their sequence, the antisense strand targets the desired mRNA, while the sense strand targets different targets. Therefore, if the antisense strand is incorporated into RISC, the correct target is targeted. The incorporation of the sense strand can result in off-target effects. These off-target effects can be limited by using modifications or using 5' end caps on the sense strand.
[0108] In this application, the term "complementary" when used to describe a first nucleotide sequence (such as an RNA inhibitor sense strand or APOC3 mRNA) with respect to a second nucleotide sequence (such as an RNA inhibitor antisense strand) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds) and form a duplex or double helical structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics, as long as the above requirements for their hybridization ability are met. "Complementary" does not necessarily have nucleobase complementarity on every nucleoside. On the contrary, some mismatches can be tolerated.
[0109] As used herein, the term "fully complementary" generally means that all (100%) of the bases in the contiguous sequence of a first polynucleotide will hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or a portion of the first or second nucleotide sequence. As used herein, "partially complementary" generally means that in a hybridizing nucleobase sequence pair, at least about 70% of the bases in the contiguous sequence of a first polynucleotide will hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. As used herein, "substantially complementary" generally means that in a hybridizing nucleobase sequence pair, at least about 80% of the bases in the contiguous sequence of a first polynucleotide will hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. As used herein, the terms "complementary," "fully complementary," and "substantially complementary" can be used with respect to base matching between the sense and antisense strands of an RNA inhibitor or between the antisense strand of an RNA inhibitor and the sequence of APOC3 mRNA. Sequence identity or complementarity is independent of modification. For purposes of determining identity or complementarity, for example, A and fA are complementary to U (or T) and identical to a.
[0110] In this application, the term "homologous" or "homology" generally refers to the number of nucleotides of a subject nucleic acid sequence that have been matched to the same nucleotides of a reference nucleic acid sequence, typically determined by sequence analysis programs (e.g., Karlin and Altschul, 1990, PNAS 87:2264-2268; Karlin and Altschul, 1993, PNAS 90:5873-5877), or by visual inspection. As used herein, the term "complete homology" or "complete homology" generally refers to complete (100%) homology or "identity" between a reference sequence and a subject nucleic acid sequence. As used herein, the terms "substantially homologous" or "substantial homology" generally refer to nucleotides that are at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) homologous to the subject sequence and the nucleotides at the same nucleotide position in the reference sequence.
[0111] In this application, the term "ligand" generally refers to any compound or molecule that can be covalently or otherwise chemically bound to a biologically active substance (such as an oligonucleotide). In certain embodiments, a ligand can interact directly or indirectly with another compound, such as a receptor. The receptor that interacts with the ligand can be present on the cell surface, or alternatively can be an intracellular and / or intercellular receptor. The interaction of the ligand with the receptor can result in a biochemical reaction, or can be simply a physical interaction or binding.
[0112] In this application, the terms "induce," "inhibit," "enhance," "elevate," "increase," "reduce," "lower," and the like generally refer to a quantitative difference between two states. For example, "an amount effective to inhibit the activity or expression of APOC3" means that the level of APOC3 activity or expression in a treated sample will be lower than the level of APOC3 activity or expression in an untreated sample. The terms apply, for example, to expression levels and activity levels. The terms "reduce" and "reduce" are used interchangeably and generally refer to any change that is less than the original level. "Reduce" and "reduce" are relative terms and require a comparison between before and after the measurement. "Reduce" and "reduce" include complete depletion.
[0113] In certain embodiments, the term "reduce" refers to a gene, gene product, such as a protein or biomarker, that can be detected by standard methods known in the art (such as those described herein) and an overall reduction of about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 100% of the expression level / amount of a gene, gene product, such as a protein or biomarker in a first sample compared to the expression level / amount of a corresponding gene, gene product, such as a protein or biomarker in a second sample. In certain embodiments, the term "reduce" refers to a reduction in the expression level / amount of a gene or biomarker in a first sample, wherein the reduction is at least about 0.9 times, 0.8 times, 0.7 times, 0.6 times, 0.5 times, 0.4 times, 0.3 times, 0.2 times, 0.1 times, 0.05 times or 0.01 times of the expression level / amount of a corresponding gene or biomarker in a second sample. In certain embodiments, the first sample is a sample obtained from a subject, and the second sample is a reference sample.
[0114] In this application, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (eg, splicing, polyadenylation, addition of a 5'-cap), and translation.
[0115] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may generally contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations may also generally include compatible solid or liquid fillers, diluents, or encapsulating materials suitable for administration to humans. When used in medicine, the salt should be a pharmaceutically acceptable salt, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these are not excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth metal salts, such as sodium, potassium, or calcium salts.
[0116] In this application, the term "lipid nanoparticle" or "LNP" generally refers to a nanoparticle comprising an encapsulated pharmacologically active molecule (e.g., a nucleic acid molecule, e.g., an iRNA or a plasmid from which the iRNA is transcribed). The iRNA may be free of a ligand or contain a ligand, such as a GalNAc derivative. LNPs are described, for example, in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference.
[0117] In this application, the term "prevention and / or treatment" includes not only preventing and / or treating a disease, but also generally includes preventing the onset of a disease, slowing or reversing the progression of a disease, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated therewith and / or preventing further increase in the severity of the disease and / or any symptoms associated therewith, preventing, reducing or reversing any physiological damage caused by the disease, and generally any pharmacological effect that is beneficial to the patient being treated. The RNA inhibitors or pharmaceutical compositions of the present application do not need to achieve a complete cure or eradication of any symptoms or manifestations of the disease to form a viable therapeutic agent. As recognized in the relevant art, drugs used as therapeutic agents can reduce the severity of a given disease state, but do not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a prophylactic administration of a treatment constitutes a viable preventive agent that does not need to be completely effective in preventing the onset of the condition. It is sufficient to simply reduce the impact of the disease in the subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect), or to reduce the likelihood of the disease occurring or worsening.
[0118] In this application, the terms "disease" or "disorder" are used interchangeably and generally refer to any deviation of a subject from the normal state, such as any change in the state of the body or certain organs that prevents or disrupts the performance of functions and / or causes symptoms such as discomfort, dysfunction, suffering or even death in those who suffer from the disease or come into contact with it. Disease or disorder may also be referred to as disorder, discomfort, ailment, disease, disorder, illness, illness and physical discomfort.
[0119] In this application, the term "administer" generally refers to introducing the present pharmaceutical preparation into the body of a subject by any introduction or delivery route. Any method known to those skilled in the art for contacting cells, organs or tissues with the drug can be used. The administration may include, but is not limited to, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous transdermal or oral administration. The daily dose may be divided into one, two or more suitable forms of dosage to be administered at one, two or more times during a certain time period.
[0120] In this application, the term "contact" generally refers to two or more different types of substances being brought into contact with each other in any order, in any manner, and for any duration. Contact can occur in vivo, ex vivo, or in vitro. In certain embodiments, it may refer to direct contact of the RNA inhibitor or composition of the present application with a cell or tissue. In other embodiments, the term refers to indirect contact of the RNA inhibitor or composition of the present application with a cell or tissue. For example, the method of the present application includes a method in which a subject is contacted with an RNA inhibitor or composition of the present application, and then the RNA inhibitor or composition contacts the cell or tissue by diffusion or any other active transport or passive transport process known in the art (the compound circulates in the body through this process).
[0121] In this application, the term "effective amount" or "effective dose" generally refers to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutically effective amount" or "therapeutically effective dose" of a drug or therapeutic agent is generally any amount of the drug that, when used alone or in combination with another therapeutic agent, promotes disease regression (as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or the prevention of damage or disability caused by the disease). A "prophylactically effective amount" or "prophylactically effective dose" of a drug generally refers to an amount of the drug that, when administered alone or in combination with another therapeutic agent to a subject at risk of disease progression or disease recurrence, inhibits the progression or recurrence of the disease. The ability of a therapeutic or prophylactic agent to promote disease regression or inhibit disease progression or recurrence can be assessed using a variety of methods known to those skilled in the art, such as in human subjects during clinical trials, predicting efficacy in humans in animal model systems, or by measuring the activity of the agent in in vitro assays. In certain embodiments, an "effective amount" refers to the amount of an RNA inhibitor that produces the desired pharmacological, therapeutic or prophylactic result.
[0122] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) in need of diagnosis, prognosis, improvement, prevention and / or treatment of a disease, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (poultry such as chickens and ducks, horses, cattle, goats, sheep, pigs) and experimental animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents and adult subjects. Subjects include animal disease models.
[0123] In this application, the terms "include," "comprising," "having," "may," "containing," and variations thereof are generally intended to be open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The term "consisting of" generally indicates that no other components (or, similarly, features, integers, steps, etc.) can be present.
[0124] In this application, the term "about" generally means approximately, in the vicinity of, roughly, or around. When the term "about" is used in reference to a numerical range, a cutoff or specific value is used to indicate that the stated value may vary from the recited value by up to 10%. Thus, the term "about" can be used to encompass variations of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from the specified value.
[0125] It should be understood that the term "at least" preceding a number or a series of numbers includes the number adjacent to the term "at least" and all subsequent numbers or integers logically included therein, i.e., "greater than or equal to". For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 15 nucleotides" means 15, 16, 17, 18, 19, 20, 21 or more nucleotides; "at least 16 nucleotides" means 16, 17, 18, 19, 20, 21 or more nucleotides; "at least 17 nucleotides" means 17, 18, 19, 20, 21 or more nucleotides; and so on. When "at least" appears before a series of numbers or a range, it should be understood that "at least" can modify each number in the series or range.
[0126] It should be understood that "no more than" as used herein refers to a value or integer that is adjacent to and logically lower than the value, i.e., "less than or equal to," as the context logically states, to zero. For example, "no more than 3 nucleotides" means having 3, 2, or 1 nucleotides. When "no more than" appears before a series of numbers or a range, it should be understood that "no more than" can modify each number in the series or range. Ranges used herein include both upper and lower limits. Detailed Description of the Invention
[0128] In one aspect, the present invention provides an RNA inhibitor or a pharmaceutically acceptable salt thereof for inhibiting APOC3 gene expression.
[0129] In certain embodiments, the RNA inhibitor comprises a single-stranded oligonucleotide or double-stranded ribonucleic acid (dsRNA) molecule for inhibiting expression of an APOC3 gene in a cell, such as a cell of a subject (e.g., a mammal, such as a human susceptible to an APOC3-related disorder such as hyperlipidemia). The dsRNA comprises an antisense strand having a complementary region that is complementary to at least a portion of an mRNA formed during expression of the APOC3 gene. The complementary region is about 15-30 nucleotides in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, or 15 nucleotides in length).
[0130] dsRNA comprises two RNA chains, which can complement and hybridize to form a duplex structure (complementary region) under the conditions of dsRNA use. One chain of dsRNA (the antisense strand) includes a complementary region that is substantially complementary to the target sequence and is usually completely complementary. The target sequence can be derived from the sequence of mRNA formed during APOC3 gene expression. The other chain (the positive strand) includes a region complementary to the antisense strand so that when combined under suitable conditions, the two chains can hybridize and form a duplex structure. Typically, the length of the duplex structure is 15 to 30 base pairs. Similarly, the length of the complementary region to the target sequence is 15 to 30 nucleotides.
[0131] In certain embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 24 to about 30 nucleotides in length. Typically, the length of the dsRNA is sufficient to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs greater than about 21-23 nucleotides in length can be used as substrates for Dicer. It is also understood by those skilled in the art that the region of the RNA targeted for cleavage is typically a portion of a larger RNA molecule (typically an mRNA molecule). A "portion" of a target is a continuous nucleotide of an mRNA target that is long enough to allow it to be a substrate for RNA inhibitor-guided cleavage (i.e., cleavage via the RISC pathway).
[0132] Those skilled in the art will also understand that the duplex region is the main functional portion of the dsRNA, for example, a duplex region of about 19 to about 30 base pairs, for example, about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20 base pairs. Therefore, in one embodiment, in order to achieve a functional duplex (e.g., 15-30 base pairs) that targets the desired RNA for cleavage, the RNA molecule or complex of RNA molecules having a duplex region of more than 30 base pairs is a dsRNA.
[0133] In one aspect of the present invention, the RNA inhibitor of the present application or a pharmaceutically acceptable salt thereof comprises an antisense strand, wherein the antisense strand comprises at least 15 consecutive nucleotides that are substantially complementary to the nucleotides selected from the corresponding positions of APOC3 mRNA NM_000040.3 (SEQ ID NO.1:) or a sequence that differs from it by no more than 3 nucleotides.
[0134] In certain embodiments, the antisense strand and the sense strand form a duplex structure (complementary region), and the complementary region comprises at least 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides.
[0135] In certain embodiments, the sense strand of the RNA inhibitor has substantial homology to a target sequence in Table 1.
[0136] Table 1 Target sequences of RNA inhibitors
[0137]
[0138]
[0139] Wherein, g = guanylate, a = adenylate, c = cytidylate, t = thymidylate.
[0140] In certain embodiments, the sense strand of the RNA inhibitor has substantial homology to a target sequence in Table 1 selected from a) a sequence in Table 2, b) a sequence that is identical to the sequence in a) over at least 15 consecutive nucleotides, and c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides:
[0141] Table 2 Sense chain sequences of RNA inhibitors
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.
[0151] In certain embodiments, the antisense strand of the RNA inhibitor is selected from a) the following sequence, b) a sequence that is identical to the sequence in a) for at least 15 consecutive nucleotides, or c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides:
[0152] Table 3 Antisense strand sequences of RNA inhibitors
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162] Where g = guanylate, a = adenylate, u = uridylate, c = cytidylate.
[0163] In some screening embodiments, the RNA inhibitor is selected from a) a combination of a sense strand in Table 2 and an antisense strand in Table 3, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides:
[0164] In certain embodiments, the RNA inhibitor is selected from: a) a sequence in Table 5, b) a sequence that is identical to the sequence in a) over at least 15 consecutive nucleotides, or c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides:
[0165] Table 5 RNA inhibitors
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173] In some embodiments, the RNA inhibitor can be administered to a cell line for sequence screening via cell transfection or liposome-nucleic acid nanoparticles, as is well known to those skilled in the art. The methods for preparing lipid compounds and liposome-nucleic acid nanoparticles described in US Pat. Nos. 9233971B2, 9080186B2, 102985548B, and 103189057B are incorporated herein in their entirety.
[0174] In some embodiments, the amphoteric lipids in the lipid compound are preferably macrocyclic lipid compounds D1C1, T1C1, T1C6, T4C4, B2C1, B2C6, B2C7 and M10C1.
[0175] It is well known to those skilled in the art that dsRNA having a duplex structure of about 19 to 23 base pairs, for example, 21 base pairs, has been found to be particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20: 6877-6888). However, others have found that shorter or longer RNA duplex structures are also effective (Chu and Rana (2007) RNA 14: 1714-1719; Kim et al. (2005) Nat Biotech 23: 222-226). It is reasonable to expect that one skilled in the art can design a new sequence based on a sequence in Tables 1-3 and 5 by subtracting or adding a few nucleotides at one or both ends, and such a sequence can be similarly effective as the sequences of the present invention. Therefore, sequences comprising at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides identical to the sequences shown in Tables 1-3 and 5 should all be within the scope of protection of the present invention. At least 15 consecutive nucleic acids refer to sequences of 15, 16, 17, 18, 19, 20, 21, 22, 23 or more consecutive nucleotides, and sequences that differ in their ability to inhibit APOC3 gene expression from the inhibitory effect of the sequences of the present invention by no more than about 5, 10, 15, 20, 25 or 30% are included within the scope of protection of this application.
[0176] The dsRNA described herein may further include one or more single-stranded nucleotide overhangs, for example, 1, 2, 3 or 4 nucleotides. The nucleotide overhangs may comprise nucleotide / nucleoside analogs or their compositions, including deoxynucleotides / nucleosides. The overhangs may be on the sense strand, the antisense strand or any combination thereof. In addition, the nucleotides of the overhangs may be present at the 5' end, the 3' end or both ends of the antisense or sense strand of the dsRNA. The overhangs may be caused by one chain being longer than the other, or by two chains of the same length being staggered. The overhangs may form a mismatch with the target mRNA, or they may be complementary to the targeted gene sequence, or they may be another sequence.
[0177] dsRNA can also contain only single overhangs, which can enhance the interference activity of RNA inhibitors without affecting their overall stability. For example, a single-stranded overhang can be located at the 3' end of the sense strand, or alternatively, at the 3' end of the antisense strand. RNA inhibitors can also have a flush end, located at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa. Typically, the antisense strand of an RNA inhibitor has a nucleotide overhang at the 3' end, while the 5' end is a flush end.
[0178] In certain embodiments, the overhang is present at the 3' end of the sense strand, the antisense strand, or both strands. In certain embodiments, the 3'-overhang is present in the antisense strand. In certain embodiments, the 3'-overhang is present in the sense strand.
[0179] In certain embodiments, the dsRNA is 21 nucleotides long and blunt-ended.
[0180] In certain embodiments, the dsRNA is 21 nucleotides in length, and both the sense and antisense strands have a 2-nucleotide overhang at the 3' end.
[0181] In certain embodiments, the sense strand of the dsRNA is 19 nucleotides in length, the antisense strand is 21 nucleotides in length, and the antisense strand has a 2-nucleotide overhang at the 3' end.
[0182] In certain embodiments, the sense strand of the dsRNA is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the antisense strand has a 2-nucleotide overhang at the 3' end.
[0183] To enhance the in vivo stability of the RNA inhibitors described herein, the sense and antisense strands of the RNA inhibitors may be modified without affecting their activity or even enhancing their activity. The nucleotides therein may include modifying groups, and the entire strand or a portion thereof may be modified. In certain embodiments, one or more nucleotides in the sense and / or antisense strands are modified to form modified nucleotides.
[0184] In certain embodiments, the RNA of the RNA inhibitor (e.g., dsRNA) of the present application is unmodified and does not contain, for example, chemical modifications or couplings known in the art and described herein. In other embodiments, the RNA of the RNA inhibitor (e.g., dsRNA) of the present application is chemically modified to enhance stability or other advantageous properties. In other embodiments of the present application, all or substantially all nucleotides of the RNA inhibitor of the present application are modified, i.e., the RNA inhibitor chain has no more than 5, 4, 3, 2, or 1 unmodified nucleotides.
[0185] The nucleic acids described herein can be synthesized and / or modified using methods known in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, SL et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-terminal modifications (phosphorylation, conjugation, reverse ligation) or 3'-terminal modifications (conjugation, DNA nucleotides, reverse ligation, etc.); base modifications, such as the use of stabilizing bases, destabilizing bases, or bases that pair with an expanded partner library, base removal (absorptive nucleotides), or conjugated bases; sugar modifications (e.g., 2'-position or 4'-position) or sugar replacement; or backbone modifications, including modification or replacement of phosphodiester linkages. In the RNA inhibitors provided herein, neither the sense nor the antisense strands of the RNA inhibitors need be uniformly modified, and one or more modifications may be incorporated into individual nucleotides thereof.
[0186] In certain embodiments, the modified nucleotides include deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, nucleotides containing non-natural bases, bridged nucleotides, peptide nucleic acids (PNAs), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabino nucleotides, 5'-Me / 2'-fluorine-bearing nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides.
[0187] In certain embodiments, the 2'-modified nucleotides include 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides, and 2'-alkyl nucleotides.
[0188] In certain embodiments, some or all of the 2' positions of the sugar moieties of the odd-numbered nucleotides starting from the 5' end of the sense strand are fluorine.
[0189] In certain embodiments, the sense strand has at least 3 or 4 nucleotides whose sugars have a fluorine residue at the 2' position.
[0190] In certain embodiments, some or all of the 2' positions of the sugar moieties of the even-numbered nucleotides starting from the 5' end of the antisense strand are fluorine.
[0191] In certain embodiments, the antisense strand has at least two or four nucleotides whose sugars have a fluorine residue at the 2' position.
[0192] In certain embodiments, at least one of the 2' positions of the sugar moieties at positions 2, 4, 6, 8, 14, and 16 from the 5' end of the antisense strand is fluorine. For example, the 2' positions of the sugar moieties at positions 2, 4, 6, 8, 14, and 16 from the 5' end of the antisense strand are all fluorine.
[0193] In certain embodiments, except for the 2nd, 4th, 6th, 8th, 14th, and 16th nucleotides starting from the 5' end of the antisense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.
[0194] In certain embodiments, at least one of the 2' positions of the sugar groups at positions 9, 10, and 11 starting from the 5' end of the sense strand is fluorine. For example, the 2' positions of the sugar groups at positions 9, 10, and 11 starting from the 5' end of the sense strand are all fluorine.
[0195] In certain embodiments, except for the 9th, 10th, and 11th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.
[0196] In certain embodiments, except for the 7th, 9th, 10th, and 11th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.
[0197] For example, the -OH at the 2' position of some or all of the nucleotide sugar groups of the sense chain and / or antisense chain can be substituted, wherein the substituent group is fluorine or methoxy, preferably the 2' position of the nucleotide sugar groups at positions 9, 10, and 11 from the 5' end of the sense chain is fluorine and the 2' position of the nucleotides at positions 2, 4, 6, 8, 14, 16, 18, and 20 from the 5' end of the antisense chain is fluorine, and the 2' position of the remaining nucleotide sugar groups are all methoxy, or preferably the 2' position of the nucleotides at positions 5, 7, 8, and 9 from the 5' end of the sense chain is fluorine and the 2' position of the nucleotide sugar groups at positions 7, 12, and 14 from the 5' end of the antisense chain is fluorine, and the 2' position of the remaining nucleotide sugar groups are all methoxy.
[0198] In some embodiments, there are at least two consecutive phosphorothioate bonds between nucleotides in the sense strand and / or antisense strand.
[0199] In some embodiments, at least two consecutive phosphorothioate bonds exist between three consecutive nucleotides at at least one end of the sense strand and / or the antisense strand.
[0200] For example, there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' end and the 3' end of the sense strand and the antisense strand.
[0201] For another example, the 2' position of the sugar group of the nucleotides at positions 9, 10, and 11 from the 5' end of the sense strand is fluorine, and the 2' position of the sugar group of the nucleotides at positions 2, 4, 6, 8, 14, 16, 18, and 20 from the 5' end of the antisense strand is fluorine, and the 2' position of the sugar group of the remaining nucleotides is methoxy, and there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' and 3' ends of the sense and antisense strands.
[0202] In some embodiments, the 2' position of some nucleotides in the sense strand is fluorine or methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated. From the 5' end of the sense strand, the 2' position of nucleotides 5, 7, 8, 9 or 3, 5, 7, 9, 11, 13, and 15 is fluorine, and the 2' position of the remaining nucleotides is methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated.
[0203] In some embodiments, the 2' position of some nucleotides in the sense strand is fluorine or methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated. From the 5' end of the sense strand, the 2' position of nucleotides 9, 10, 11, or 3, 5, 7, 9, 11, 13, 15, and / or 17 is fluorine, and the 2' position of the remaining nucleotides is methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated.
[0204] In some screening embodiments, two tt residues can be respectively suspended from the 3' ends of the sense strand and the antisense strand, and the sense strand and the antisense strand of the RNA inhibitor are selected from a) sequences in Table 6, b) sequences having at least 15 consecutive nucleotides identical to the sequences in a), and c) sequences that differ from the sequences in a) and b) by no more than 3 nucleotides:
[0205] Table 6 RNA inhibitors
[0206]
[0207]
[0208] Where g = guanylate, a = adenylate, u = uridylate, c = cytidylate, t = thymidylate.
[0209] In some embodiments, the 2' position of some nucleotides in the sense strand is fluorine, and the phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand can be thiolated.
[0210] In some embodiments, the sense strand in the RNA inhibitor is preferably selected from the sense strand sequences in Table 6-1 and Table 6-2 below.
[0211] Table 6-1 Modified sequences of the positive chain
[0212]
[0213]
[0214]
[0215] Table 6-2 Modified sequences of the positive chain
[0216]
[0217]
[0218]
[0219]
[0220] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate, Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioguanylate 2'-Fluoro-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidylic acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenosine, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thiocytidylic acid, T = thymidylic acid, Ts = 3'-thiothymidylic acid.
[0221] In certain embodiments, the sense strand of the RNA inhibitor described herein is selected from: a) a sequence in Table 6-1 and Table 6-2, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), or c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides.
[0222] In some embodiments, the 2' position of some nucleotides in the antisense strand is fluorine, and the phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand can be thiolated. The antisense strand in the RNA inhibitor is preferably selected from a) sequences in Table 7-1 and Table 7-2, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), or c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides:
[0223] Table 7-1 Modified sequences of antisense strands
[0224]
[0225]
[0226]
[0227] Table 7-2 Modified sequences of antisense strands
[0228]
[0229]
[0230]
[0231] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate, fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate, Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidylate, fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenosine, fUs = 2'-fluoro-3'-thiouridine, fCs = 2'-fluoro-3'-thiocytidylate, and T = thymidylate.
[0232] In certain embodiments, the antisense strand of the RNA inhibitor described herein is selected from: a) sequences in Table 7-1 and Table 7-2, b) a sequence having at least 15 consecutive nucleotides identical to the sequence in a), and c) a sequence that differs from the sequences in a) and b) by no more than 3 nucleotides.
[0233] In certain embodiments, the sense strand and antisense strand of the RNA inhibitor are selected from Table 8 below.
[0234] Table 8 Sequence-modified RNA inhibitors
[0235]
[0236]
[0237] In certain embodiments, the distribution, targeting, or stability of an RNA inhibitor is altered by introducing a ligand for a target tissue receptor into the vector. For example, a specific ligand can provide enhanced affinity for a selected target (e.g., a molecule, cell or cell type, compartment (e.g., a cell or organ compartment, body tissue, organ, or region)) compared to a species in which the ligand is not present.
[0238] The ligand can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL) or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid); or lipids. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, for example, a synthetic polyamino acid.
[0239] The ligand can also include a targeting group, such as a cell or tissue targeting agent that binds to a specified cell type such as a nephrocyte, such as a lectin, glycoprotein, lipid or protein, such as an antibody. The targeting group can be thyrotropin, melanocyte stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, vitamin A, biotin or RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is a multivalent galactose, such as N-acetyl-galactosamine.
[0240] The sense strand and antisense strand comprised by the RNA inhibitor of the present invention can be conveniently and routinely prepared by the well-known technology of solid phase synthesis. Any other method known in the art for this type of synthesis, such as liquid phase synthesis or fermentation, can be used additionally or alternatively. It is also known to use similar techniques to prepare other oligonucleotides (such as phosphorothioates and alkylated derivatives).
[0241] In certain embodiments, in addition to standard nucleoside phosphoramidite monomers and non-standard nucleoside phosphoramidite monomers that are commercially available and routinely used in oligonucleotide synthesis, the oligonucleotides or linked nucleotides of the present application can be synthesized by an automated synthesizer using a phosphoramidite method derived from carrier-nucleoside phosphoramidite monomers.
[0242] In certain embodiments, the ligand of the present invention is conjugated to the 5' end and / or 3' end of the antisense strand, and / or the 5' end and / or 3' end of the sense strand via a carrier structure.
[0243] For example, the carrier structure can be coupled to the 5' end and / or the 3' end of the sense strand; or the carrier structure can be coupled to the 5' end of the antisense strand, and the carrier structure is coupled to the 3' end of the sense strand; or the carrier structure can be coupled to the 3' end of the antisense strand, and the carrier structure is coupled to the 5' end of the sense strand.
[0244] In certain embodiments, the carrier structure includes 5'MVIP and 3'MVIP, wherein the 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and the 3'MVIP is coupled to the 3' end of the antisense strand and / or sense strand. The structure of the 5'MVIP is shown in Formula I, and the structure of the 3'MVIP is shown in Formula II.
[0245] (XL) n -BDR I -,
[0246] I
[0247] (XL) m -BD-R2-,
[0248] II
[0249] in,
[0250] X is a liver-targeting specific ligand;
[0251] L is a branched chain;
[0252] B is the connector;
[0253] D is the connecting chain;
[0254] R1 and R2 are transfer points;
[0255] The 5'MVIP is connected to the 5' end of the sense strand or the 5' end of the antisense strand through the transfer point R1, and the 3'MVIP is connected to the 3' end of the sense strand or the 3' end of the antisense strand through the transfer point R2. n and m are each independently any integer from 0 to 4, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, and more preferably 4.
[0256] In certain embodiments, the connection between R1 or R2 and the sense strand or antisense strand is through phosphate or modified phosphate, preferably R1 or R2 is connected to the sense strand or antisense strand through phosphate or phosphorothioate.
[0257] In certain embodiments, m or n may be 0, ie, there is no 3'MVIP or 5'MVIP.
[0258] In certain embodiments, when n=0 (ie, there is no 5'MVIP), the structure of the 3'MVIP can be:
[0259]
[0260]
[0261] In certain embodiments, when n=1, the structure of the 3'MVIP can be:
[0262] In certain embodiments, when n=2, the structure of the 3'MVIP can be:
[0263]
[0264] In certain embodiments, when n=3, the structure of the 3'MVIP can be:
[0265]
[0266] In certain embodiments, when n=4, the structure of the 3'MVIP can be:
[0267]
[0268] In certain embodiments, n refers to the sum of n's in 5'MVIPs placed at the 5' ends of both the sense and antisense strands of the RNA inhibitor, and m refers to the sum of m's in 3'MVIPs placed at the 3' ends of both the sense and antisense strands of the RNA inhibitor.
[0269] In certain embodiments, the R1 and R2 structures contain -NH-, -S- and / or -O-, and R1 and R2 are connected to the connecting chain D and the 5' end and 3' end of the sense chain and / or antisense chain respectively through the -NH-, -S- or -O- in the structure, and R1 and R2 are the same or different.
[0270] In certain embodiments, R1 and R2 are optionally linear, or linear or cyclic structures with amide, carboxyl or alkyl side chains, wherein the cyclic structure includes a saturated or unsaturated aliphatic carbocyclic group, or a five-membered or six-membered heterocyclic group or aromatic hydrocarbon group containing sulfur, oxygen or nitrogen atoms.
[0271] In certain embodiments, said R1 and / or R2 is -E1(CH2) x CH2E2-, wherein x is any integer from 3 to 12, and the groups E1 and E2 can be -NH-, -S- or -O-, respectively.
[0272] In certain embodiments, said R1 and / or R2 is -E1(CH2) x1 CH(OH)(CH2) x2 E2-, wherein x1 or x2 is each independently any integer from 3 to 10, and E1 and E2 can be -NH-, -S- or -O-.
[0273] In certain embodiments, R1 is a heterocyclic or carbocyclic structure containing N, S, or O as shown below:
[0274]
[0275] In certain embodiments, the transition point R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6, can be introduced by the following two phosphoramidite monomers.
[0276] i. An -O- or -S- group in the R1 structure is used to synthesize the R1 phosphoramidite monomer, which is then incorporated into the 5' end of the sense or antisense strand of an RNA inhibitor via solid-phase synthesis. The -NH-, -S-, or -O- group in this structure is used to connect to the linker strand D in the 5'MVIP, thereby introducing the liver-targeting-specific ligand X into the 5' end of the sense or antisense strand of the RNA inhibitor. An exemplary structure of a monomer incorporated into the 5' end of the sense or antisense strand of an RNA inhibitor is as follows:
[0277]
[0278] In certain embodiments, the following structures are preferred:
[0279]
[0280] ii. One -NH-, -S-, or -O- in the R1 structure is first connected to the connecting chain D, and the other -NH-, -S-, or -O- is used to form an ester with the phosphoramidite in the synthesis of the 5'MVIP phosphoramidite monomer. Examples of the structures of the sense chain or antisense chain 5'MVIP phosphoramidite monomer are as follows:
[0281]
[0282] In certain embodiments, the sense or antisense 5'MVIP phosphoramidite monomer preferably has the following structure:
[0283]
[0284] When n in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding monomer compound. With the help of the above monomer compound, the liver-targeting specific ligand X is introduced into the 5' end of the sense chain or antisense chain through solid phase synthesis.
[0285] In certain embodiments, the transition point R1 is -NH(CH2) x CH2O-, wherein x can be any integer from 3 to 12, preferably any integer from 4 to 6.
[0286] In certain embodiments, the 5'MVIP phosphoramidite monomer structure is selected from the following structures:
[0287]
[0288]
[0289]
[0290] In certain embodiments, the transition point R2 is a heterocyclic or carbocyclic structure containing N, S, or O as shown below:
[0291]
[0292] In certain embodiments, the transition point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4.
[0293] The transfer point R2 described in the present application is formed by forming an ester or amide with -NH-, -S- or -O- in the R2 structure through succinic anhydride, and coupling with -NH- in the blank Solid Support to form a 3'MVIP solid spport, and then introducing 3'MVIP into the 3' end of the sense chain or antisense chain through the phosphoramidite solid phase synthesis method.
[0294] In certain embodiments, the heterocyclic ring in the transition point R2 structure is a pyrrole ring or a piperidine ring, which is connected to the connecting chain D of 3'MVIP via the nitrogen heteroatom in the ring. The exemplary structure of the introduced 3'MVIP solid spport is as follows:
[0295]
[0296] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.
[0297] In certain embodiments, the transition point R2 is -B4(CH2) x1 CH(OH)(CH2) x2 CH2B5-, wherein x1 is any integer from 1 to 4, x2 is any integer from 0 to 4, B4 and B5 are respectively -NH-, -S- or -O-, and the exemplary structure of the introduced 3'MVIP solid spport is as follows:
[0298]
[0299] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.
[0300] In certain embodiments, R2 is -NHCH2CH(OH)CH2O-, and the exemplary structure of the introduced 3'MVIP solid spport is as follows:
[0301]
[0302] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.
[0303] In certain embodiments, the 3'MVIP solid support structure is as follows:
[0304]
[0305]
[0306]
[0307] In certain embodiments, the liver-targeting-specific ligand X is selected from structures used to enhance hepatocyte uptake of RNA inhibitors, and may include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetics. In the RNA inhibitors provided herein, the liver-targeting-specific ligands X introduced into the ends of the sense or antisense strands of the RNA inhibitors may be identical or different. For example, some may enhance liver targeting, some may regulate the in vivo pharmacokinetics of the RNA inhibitor, or some may possess in vivo lytic activity. In certain embodiments, the liver-targeting-specific ligand X is selected from one or more monosaccharides and their derivatives in the following structures:
[0308] In certain embodiments, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose. The monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives and other derivatives.
[0309] In certain embodiments, the liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, and its general structural formula is as follows:
[0310]
[0311] Wherein, W1 is hydrogen or a hydroxyl protecting group, which may be the same or different; W is -OH, -NHCOOH or -NHCO(CH2) q CH3, wherein q is an integer from 0 to 4; W2 is -NH-, O, S or C.
[0312] In certain embodiments, the liver-targeting specific ligand X is N-acetylgalactosamine and its derivatives.
[0313] In certain embodiments, the liver-targeting specific ligand X is selected from the following structures:
[0314]
[0315] Wherein, W is selected from -OH, -NHCOOH or -NHCO(CH2) q One or two of CH3, wherein q is an integer of 0-4.
[0316] In certain embodiments, the liver-targeting specific ligand X in the same 5'MVIP or 3'MVIP structure may be the same or different.
[0317] In certain embodiments, X between 5'MVIP and 3'MVIP may be the same or different.
[0318] In certain embodiments, the branched chain L is a group containing -NH-, -C(=O)-, -O-, -S-, amide, phosphoryl, thiophosphoryl, C4-C 10 aliphatic carbocyclic group, phenyl group or a combination of these groups C4-C 18 Carbon chain.
[0319] In certain embodiments, the branched chain L further has a hydroxyethyl or carboxylic acid side chain.
[0320] In certain embodiments, the side chain L is a C7-C 18 Carbon chain.
[0321] In certain embodiments, the side chain L is selected from one or more of the following structures:
[0322]
[0323] Wherein, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, such as a C1-C5 alkyl group.
[0324] In certain embodiments, the structure of the linker B is related to the number of Xs that can be introduced. The linker B contains -NH-, C, O, S, amide, phosphoryl, or thiophosphoryl. When n or m is 1, it is a straight chain. When n or m is 2, 3, or 4, the number of forks is 2, 3, or 4, respectively.
[0325] In certain embodiments, the linker B is selected from the following structures:
[0326]
[0327] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is an integer of 0-4.
[0328] In certain embodiments, the linker B is selected from the following structures:
[0329]
[0330]
[0331] Wherein, r is any integer from 0 to 4.
[0332] In certain embodiments, the linker B is selected from the following structures:
[0333]
[0334]
[0335]
[0336] In certain embodiments, the linker B is selected from the following structures:
[0337]
[0338] In certain embodiments, the linker D is a group containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aromatic hydrocarbon, C4-C 10 aliphatic carbocyclic group, a five-membered or six-membered heterocyclic group containing 1 to 3 nitrogen atoms, or a combination of these groups; 18 Carbon chain.
[0339] In certain embodiments, the connecting chain D further has a side chain of a hydroxymethyl group, a methyl tert-butyl group, a methylphenol group, or a C5-C6 aliphatic ring group.
[0340] In certain embodiments, the connecting chain D is a C3-C ... 10 Carbon chain.
[0341] In certain embodiments, the linker chain D is a C3-C containing two C=O 10 Carbon chain.
[0342] In certain embodiments, the connecting chain D is selected from the following structures:
[0343]
[0344]
[0345] Wherein, each p is independently any integer from 1 to 20; s is an integer from 2 to 13; Z1 and Z2 are the same or different substituent groups, such as C3-C 10 alkyl.
[0346] In certain embodiments, the connecting chain D is selected from the following structures:
[0347]
[0348]
[0349]
[0350] In certain embodiments, the connecting chain D is selected from the following structures:
[0351]
[0352] In certain embodiments, (XL) in the 5'MVIP structure n -BD- and 3'MVIP structures (XL) m -BD- is selected from one or more of the following structures:
[0353]
[0354]
[0355]
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363]
[0364]
[0365] In certain embodiments, the X, L, B, and D are the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP.
[0366] In certain embodiments, (XL) in the 5'MVIP structure n -BD- is selected from the structures shown in Table 9:
[0367] Table 9 5'MVIP (XL) n -BD-Structure
[0368]
[0369]
[0370]
[0371]
[0372] In certain embodiments, 5'MVIP may not be present, in which case m may be any integer from 2 to 4.
[0373] In certain embodiments, (XL) in the 3'MVIP structure m -BD- is selected from the structures shown in Table 10:
[0374] Table 10 3'MVIP (XL) m -BD-Structure
[0375]
[0376]
[0377]
[0378]
[0379] In certain embodiments, the carrier structure 5'MVIP (XL) n The combinations of -BD- and R1 are shown in Table 11.
[0380] Table 11 5'MVIP Medium (XL) n -BD- and R1 combination
[0381]
[0382]
[0383] In certain embodiments, 3'MVIP may not be present, in which case n may be any integer from 2 to 4.
[0384] In certain embodiments, the carrier structure 3'MVIP (XL) m The combinations of -BD- and R2 are shown in Table 12.
[0385] Table 12 3'MVIP (XL) m -BD- combined with R2
[0386]
[0387]
[0388]
[0389] In certain embodiments, the 5'MVIP is selected from any one or more of 5'MVIP01 to 5'MVIP22 in Table 11.
[0390] In certain embodiments, the 3'MVIP is selected from any one or more of 3'MVIP01 to 3'MVIP27 in Table 12.
[0391] In certain embodiments, a 5'MVIP in Table 11 may be combined with any of the 3'MVIPs in Table 12, wherein n+m=2, 3, 4, 5, or 6.
[0392] In some embodiments, the sense strand in the RNA inhibitor can be selected from the sequences in Table 13 below.
[0393] Table 13 Sense chain coupled with 5'MVIP09
[0394] Justice Chain Code Sense strand sequence 5'→3' S19301 5'MVIP09-GsAsGCfACfCfGfUUAAGGACAAGsUsU S19401 5'MVIP09-GsCsACfCGfUfUfAAGGACAAGUUsCsU S19501 5'MVIP09-UsUsACAUGAfAfGfCACGCCACCsAsA S19601 5'MVIP09-UsCsUCAGCUfUfCfAUGCAGGGUsUsA S19701 5'MVIP09-GsCsUUfCAfGfUfUCCCUGAAAGAsCsU S19801 5'MVIP09-UsUsCCfCUfGfAfAAGACUACUGGsAsG S19901 5'MVIP09-AsGsACUACUfGfGfAGCACCGUUsAsA S20001 5'MVIP09-CsCsGUUAAGfGfAfCAAGUUCUCsUsG S20101 5'MVIP09-CsUsGCfCCfCfUfGUAGGUUGCUUsAsA S20201 5'MVIP09-CsAsGUfAUfUfCfUCAGUGCUCUCsCsU S20301 5'MVIP09-UsGsGCUGCCfUfGfAGACCUCAAsUsA S20401 5'MVIP09-GsAsGCfUCfCfUfUGGGUCCUGCAsAsU S20501 5'MVIP09-CsCsUGAGGUfCfAfGACCAACUUsCsA S20601 5'MVIP09-AsAsGGGACAfGfUfAUUCUCAGUsGsC
[0395] In certain embodiments, the sense strand of the RNA inhibitors described herein differs from each sequence in Table 13 by one, two, or three nucleotides, or has the same sequence as a sequence in Table 13 for at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0396] In certain embodiments, the antisense strand in the RNA inhibitor can be selected from the sequences in Table 14 below.
[0397] Table 14 Antisense strand coupled to 3'MVIP09
[0398] Antisense chain code Antisense strand sequence 5'→3' AS19301 AsAsCUUGfUCCUUfAAfCGGUGCsUsC-3'MVIP09 AS19401 AsGsAACUfUGUCCfUUfAACGGUsGsC-3'MVIP09 AS19501 UsfUsGfGUfGGfCGUGCUfUCfAUGUsAsA-3'MVIP09 AS19601 UsfAsAfCCfCUfGCAUGAfAGfCUGAsGsA-3'MVIP09 AS19701 AsGsUCUUfUCAGGfGAfACUGAAsGsC-3'MVIP09 AS19801 CsUsCCAGfUAGUCfUUfUCAGGGsAsA-3'MVIP09 AS19901 UsfUsAfACfGGfUGCUCCfAGfUAGUsCsU-3'MVIP09 AS20001 CsfAsGfAGfAAfCUUGUCfCUfUAACsGsG-3'MVIP09 AS20101 UsUsAAGCfAACCUfACfAGGGGCsAsG-3'MVIP09 AS20201 AsGsGAGAfGCACUfGAfGAAUACsUsG-3'MVIP09 AS20301 UsfAsUfUGfAGfGUCUCAfGGfCAGCsCsA-3'MVIP09 AS20401 AsUsUGCAfGGACCfCAfAGGAGCsUsC-3'MVIP09 AS20501 UsfGsAfAGfUUfGGUCUGfACfCUCAsGsG-3'MVIP09 AS20601 GsfCsAfCUfGAfGAAUACfUGfUCCCUUsUsU-3'MVIP09
[0399] In certain embodiments, the antisense strand of the RNA inhibitor described herein differs from each sequence in Table 14 by one, two, or three nucleotides, or has the same sequence as a sequence in Table 14 for at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0400] In some in vivo assay embodiments, the RNA inhibitors described herein are selected from the sequences in Table 15.
[0401] Table 15 RNA inhibitors containing 5'MVIP09 / 3'MVIP09 combination
[0402] RNA inhibitors Justice Chain Code Antisense chain code Kylo-12-DS1041 S19301 AS19301 Kylo-12-DS1051 S19401 AS19401 Kylo-12-DS1071 S19501 AS19501 Kylo-12-DS1081 S19601 AS19601 Kylo-12-DS1091 S19701 AS19701 Kylo-12-DS1111 S19801 AS19801 Kylo-12-DS1131 S19901 AS19901 Kylo-12-DS1141 S20001 AS20001 Kylo-12-DS1181 S20101 AS20101 Kylo-12-DS1221 S20201 AS20201 Kylo-12-DS1241 S20301 AS20301 Kylo-12-DS1261 S20401 AS20401 Kylo-12-DS1311 S20501 AS20501 Kylo-12-DS1321 S20601 AS20601
[0403] In certain embodiments, the sense and antisense strands of the RNA inhibitors described herein differ from each sequence in Table 15 by one, two, or three nucleotides, or have the same sequence as a sequence in Table 15 for at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0404] It should be noted that the combinations listed in Tables 13, 14, and 15 are not exhaustive. The sequences of the present invention can be linked to MVIPs of any structure, with no restrictions on the site or number of links. Unrestricted linking means that the link can be at the 5' end, the 3' end, or not at the end. Unrestricted number of links means that one or more links can be linked, with no restriction on the number.
[0405] In certain embodiments, the 5' end and / or 3' end of the antisense strand UsfAsAfCCfCUfGCAUGAfAGfCUGAsGsA (SEQ ID NO: 382) of the RNA inhibitor is linked to 5'MVIP and / or 3'MVIP of different structures, and the antisense strand and its carrier structure are selected from the following Table 16:
[0406] Table 16 5'MVIP and / or 3'MVIP coupled antisense strand
[0407]
[0408]
[0409] In certain embodiments, the antisense strand of the RNA inhibitor described herein differs from each sequence in Table 16 by one, two, or three nucleotides, or has a sequence identical to a sequence in Table 16 of at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0410] In certain embodiments, the antisense strand coupled to 5'MVIP and / or 3'MVIP in Table 16 can be obtained by coupling the sequences in Table 7-1 and Table 7-2 to 5'MVIP and / or 3'MVIP.
[0411] In certain embodiments, the 5' end and / or 3' end of the sense strand UsCsUCAGCUfUfCfAUGCAGGGUsUsA (SEQ ID NO: 412) of the RNA inhibitor is linked to 5'MVIP and / or 3'MVIP of different structures, and the sense strand and its carrier structure are selected from the following Table 17:
[0412] Table 17 5'MVIP and / or 3'MVIP coupled sense strand
[0413]
[0414]
[0415]
[0416] In certain embodiments, the sense strand of the RNA inhibitors described herein differs from each sequence in Table 17 by one, two, or three nucleotides, or has the same sequence as a sequence in Table 17 for at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0417] In certain embodiments, the 5' end and / or 3' end of the antisense strand AsfCsAfCUfGAfGAAUACfUGfUCfGCsfUsC (SEQ ID NO: 970) of the RNA inhibitor is linked to a 5'MVIP and / or 3'MVIP of different structures, and the antisense strand and its carrier structure are selected from the following Table 18:
[0418] Table 18 5'MVIP and / or 3'MVIP coupled antisense strand
[0419]
[0420]
[0421]
[0422] In certain embodiments, the antisense strand of the RNA inhibitor described herein differs from each sequence in Table 18 by one, two, or three nucleotides, and has the same sequence of at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides as the sequence in Table 18.
[0423] It should be noted that the combinations listed in Table 18 are not exhaustive. The sequences of the present invention can be linked to MVIPs of any structure, with no restrictions on the site or number of links. "Unrestricted" means that the link can be at the 5' end, the 3' end, or neither end. "Unrestricted" means that the link can be one or more, with no restriction on the number of links.
[0424] In certain embodiments, the 5' end and / or 3' end of the sense strand GsAsGCGACAfGfUfAUUCUCAGUsGsU (SEQ ID NO: 1033) of the RNA inhibitor is linked to a 5'MVIP and / or 3'MVIP of different structures, wherein the sense strand and its carrier structure are selected from the following Table 19:
[0425] Table 19 5'MVIP and / or 3'MVIP coupled sense strand
[0426]
[0427]
[0428]
[0429] In some embodiments, the sense strand of the RNA inhibitor described herein differs from each sequence in Table 19 by one, two, or three nucleotides, or has the same sequence as a sequence in Table 19 of at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0430] It should be noted that the combinations listed in Table 19 are not exhaustive. The sequences of the present invention can be linked to MVIPs of any structure, with no restrictions on the site or number of links. Unrestricted linking means that the link can be at the 5' end, the 3' end, or not at the end. Unrestricted number of links means that one or more links can be linked, and the number is unlimited.
[0431] In certain embodiments, the antisense strand of the RNA inhibitor can be obtained by coupling the antisense strand sequence exemplified above with any 5'MVIP and / or 3'MVIP.
[0432] In certain embodiments, the sense strand of the RNA inhibitor can be obtained by coupling the sense strand sequence exemplified above with any 5'MVIP and / or 3'MVIP.
[0433] In certain embodiments, the sequences within the scope of protection of this application can be linked to any number of 5'MVIP or 3'MVIP of any structure at any position to form RNA inhibitors. These RNA inhibitors are all within the scope of protection of the present invention and are inspired by the present invention.
[0434] Chinese patent CN113171371B examines in detail the effects of different X, L, B, D, R1 and R2 in the 5'MVIP and / or 3'MVIP structures on RNA inhibitor activity. The entire text of this patent is incorporated herein by reference. When one of X, L, B, D, R1 and R2 is different, the remaining parts of the corresponding 5'MVIP and / or 3'MVIP are the same as those of 5'MVIP09 / 3'MVIP09.
[0435] When X is galactose, galactosamine, N-acetylgalactosamine and its derivatives, among the RNA inhibitors provided by the present invention, N-acetylgalactosamine and its derivatives are preferably used as liver-targeting specific ligands:
[0436]
[0437]
[0438] The length of L significantly influences the efficacy of RNA inhibitors; the L chain should be neither too short nor too long. When containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aliphatic carbocyclic groups such as cyclohexane, or combinations of these groups, or within the same 5'MVIP or 3'MVIP structure, or when 5'MVIP and 3'MVIP have different L structures and the carbon chain length is within the C7-C18 range, the resulting RNA inhibitors exhibit similar activity.
[0439]
[0440]
[0441] In addition to the structural changes in linker B, when X, L, D, and R1 / R2 are consistent with those in the combination 5'MVIP09 / 3'MVIP09, A1 and A2 in the general formula of linker B are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl, or thiophosphoryl, r is any integer from 0 to 4, and when linker B is the same or different between 5'MVIP and 3'MVIP, the resulting RNA inhibitory activity is not much different.
[0442]
[0443]
[0444]
[0445]
[0446]
[0447]
[0448]
[0449] When the MVIP structure and RNA inhibitor are the same, different connecting chains D will affect the activity of the RNA inhibitor, among which D1, D2, and D4 have similar effects and are better than D3.
[0450]
[0451]
[0452] Different transfer points R1 will affect the activity of RNA inhibitors, among which R1-1 as the transfer point has the best RNA inhibitor activity.
[0453] <![CDATA[R1 code]]> <![CDATA[Structure of R1]]> R1-1 <![CDATA[-NH(CH2)6O-]]> R1-2 <![CDATA[-O(CH2)6O-]]> R1-3 <![CDATA[-S(CH2)6O-]]> R1-4 <![CDATA[-NH(CH2)8 O-]]> R1-5 <![CDATA[-NH(CH2)5CH(CH2CH3)O- <!-- 128 -->]]> R1-6 <![CDATA[-S(CH2)4CH(CH3)O-]]>
[0454] Different transfer points R2 will affect the activity of RNA inhibitors, among which R2-1 is the best when used as the transfer point.
[0455]
[0456]
[0457] In certain embodiments, n+m in the RNA inhibitors of the present invention is 2, 3, 4, 5, and 6, respectively. The positions where 5'MVIP and / or 3'MVIP are coupled include the 5' and / or 3' ends of the antisense strand, the 5' and / or 3' ends of the sense strand, the 5' end of the antisense strand and the 3' end of the sense strand, or the 5' end of the sense strand and the 3' end of the antisense strand. The antisense strand and the sense strand are annealed by base pairing, wherein n+m=2, 3, 4, 5, and 6, as shown in Table 20:
[0458] Table 20 Coupling positions of 5'MVIP and 3'MVIP with the sense strand and / or antisense strand
[0459]
[0460]
[0461] In some embodiments, n and m are each independently any integer from 0 to 4, preferably each independently an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, more preferably 4.
[0462] In certain embodiments, the sense strand and antisense strand of the 5'MVIP and / or 3'MVIP conjugated are selected from the following Table 21:
[0463] Table 21 5'MVIP and / or 3'MVIP coupled sense and antisense strands
[0464]
[0465]
[0466]
[0467]
[0468]
[0469]
[0470]
[0471]
[0472]
[0473]
[0474]
[0475]
[0476] In some embodiments, the RNA inhibitor is selected from Table 22-1 and Table 22-2, wherein the sense strand and / or antisense strand differs from each sequence in Table 22-1 and Table 22-2 by 1, 2, or 3 nucleotides, or has the same sequence of at least 15 consecutive nucleotides as the sequences in Table 22-1 and Table 22-2:
[0477] Table 22-1 RNA Inhibitors
[0478]
[0479]
[0480] Table 22-2 RNA inhibitors
[0481]
[0482]
[0483] In certain embodiments, the RNA inhibitors described herein or pharmaceutically acceptable salts thereof are preferably prepared or synthesized in the form of sodium salts, triethylamine salts or other pharmaceutically acceptable salts.
[0484] In certain embodiments, the RNA inhibitor or a pharmaceutically acceptable salt thereof is more preferably a sodium salt or a triethylamine salt thereof.
[0485] The present application also provides a pharmaceutical composition comprising the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof.
[0486] In one embodiment, the present invention also provides a pharmaceutical composition comprising the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable pharmaceutical excipient. The pharmaceutical composition comprising the RNA inhibitor can be used to prevent and / or treat diseases associated with elevated levels of APOC3, for example, hepatic diseases, inflammatory, cardiovascular and cerebrovascular and metabolic diseases, wherein cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, aortic valve stenosis, hypertriglyceridemia (HTG), severe hypertriglyceridemia (sHTG) or familial chylomicronemia syndrome (FCS). Such pharmaceutical compositions are formulated according to the delivery mode. An example scheme is to formulate a composition for systemic administration by parenteral delivery, for example, subcutaneous (SC), intramuscular (IM) or intravenous (IV) delivery. The pharmaceutical composition of the present application can be administered at a dose sufficient to inhibit APOC3 gene expression.
[0487] A pharmaceutically acceptable "excipient" or "vegetarian" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle used to deliver one or more nucleic acids to an animal. Excipients can be liquid or solid and are selected based on the intended mode of administration to provide the desired volume, consistency, etc. when combined with the nucleic acid and other components of a given pharmaceutical composition. RNA inhibitors can be delivered in a manner that targets specific tissues (e.g., hepatocytes).
[0488] In certain embodiments, the pharmaceutical composition further comprises a delivery vehicle (eg, nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems).
[0489] In certain embodiments, the delivery vehicle comprises a liposome.
[0490] In certain embodiments, the delivery vehicle comprises nanolipids that are capable of forming liposome-nucleic acid nanoparticles with nucleic acid molecules.
[0491] In certain embodiments, the delivery vehicle comprises the amphiphilic lipid compound M10C1.
[0492] The pharmaceutical compositions provided herein include, but are not limited to, solutions, emulsions, and formulations comprising liposomes. These compositions can be produced from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Formulations include those targeted to the liver. The pharmaceutical formulations of the present application, which can be conveniently presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with a pharmaceutically acceptable excipient or vehicle.
[0493] use
[0494] On the other hand, the present application further provides a method for reducing APOC3 mRNA or protein expression in cells or tissues, comprising contacting the cells or tissues with an effective amount of the aforementioned RNA inhibitor for inhibiting APOC3 gene expression or a pharmaceutically acceptable salt thereof, and / or the aforementioned pharmaceutical composition.
[0495] Cells suitable for treatment using the methods of the present application can be any cell expressing the APOC3 gene, for example, liver cells, brain cells, gallbladder cells, heart cells, or kidney cells, but are preferably liver cells. Cells suitable for use in the methods of the present application can be mammalian cells, and when contacted with cells expressing the APOC3 gene, the RNA inhibitor inhibits the expression of the APOC3 gene (e.g., human, primate, non-primate, or rat APOC3 gene) by at least about 50%, as determined, for example, by PCR or branched DNA (bDNA)-based methods, or by protein-based methods such as immunofluorescence analysis, Western blotting, or flow cytometry.
[0496] In certain embodiments, the tissue is liver tissue.
[0497] As used herein, the term "inhibit" can be used interchangeably with "reduce," "lower," "silence," "downregulate," "suppress," and other similar terms, and encompasses any level of inhibition. The expression of the APOC3 gene can be assessed based on the level or change in level of any variable associated with APOC3 gene expression, for example, APOC3 mRNA level or APOC3 protein level. This level can be analyzed in a single cell or in a population of cells (including, for example, a sample from a subject). Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables associated with APOC3 expression compared to a control level. The control level can be any type of control level used in the art, for example, a baseline level before administration or a level measured from a similar subject, cell, or sample that has not been treated or that has been treated with a control (such as, for example, a buffer-only control or a no-active-agent control).
[0498] Inhibition of APOC3 gene expression can be demonstrated by a reduction in the amount of mRNA expressed by a first cell or cell population (such cells may, for example, be present in a sample derived from a subject) in which the APOC3 gene is transcribed and has been treated (e.g., by contacting one or more cells with an RNA inhibitor of the present invention, or by administering an RNA inhibitor of the present invention to a subject in which such cells are present) such that APOC3 gene expression is inhibited, compared to a second cell or cell population that is substantially identical to the first cell or cell population but has not been treated in this manner (control cells that have not been treated with the RNA inhibitor or with an RNA inhibitor targeting the gene of interest). In a preferred embodiment, inhibition is assessed in a cell line that highly expresses APOC3 using an appropriate concentration of siRNA by the method provided in Example 2, and the mRNA level in the treated cells is expressed as a percentage of the mRNA level in the non-treated control cells.
[0499] In other embodiments, inhibition of APOC3 gene expression can be assessed by a decrease in a parameter functionally associated with APOC3 gene expression, e.g., APOC3 protein levels in the blood or serum of a subject. APOC3 gene silencing can be measured in any cell expressing APOC3 (endogenous or exogenous from an expression construct) and by any assay known in the art.
[0500] Inhibition of APOC3 protein expression can be demonstrated by a decrease in the level of APOC3 protein expressed by a cell or cell population or a sample from a subject (e.g., protein levels in a blood sample from a subject). As described above, for the assessment of mRNA inhibition, inhibition of protein expression levels in treated cells or cell populations can be similarly expressed as a percentage of protein levels in control cells or cell populations, or as a change in protein levels in a sample from a subject (e.g., blood or serum derived therefrom).
[0501] Control cells, cell populations, or subject samples that can be used to evaluate APOC3 gene inhibition include cells, cell populations, or subject samples that have not been contacted with the RNA inhibitors of the present application. For example, control cells, cell populations, or subject samples can be derived from a single subject (e.g., a human or animal subject) or an appropriately matched population control prior to treatment with the RNA inhibitor.
[0502] The level of APOC3 mRNA expressed by a cell or cell population can be measured using any method known in the art for evaluating mRNA expression. For example, qRT-PCR can be used to evaluate a decrease in gene expression. A decrease in protein production can be evaluated by any method known in the art, such as ELISA. In certain embodiments, a liver biopsy sample is used as the tissue material for monitoring a decrease in APOC3 gene or protein expression. In other embodiments, a blood sample is used as the subject sample for monitoring a decrease in APOC3 protein expression.
[0503] On the other hand, the present application further provides the aforementioned RNA inhibitor for inhibiting APOC3 gene expression or a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition for use in preparing a medicament for preventing and / or treating a disease or condition or reducing the risk of a disease or condition.
[0504] In certain embodiments, the disease or condition comprises a disease or condition associated with APOC3.
[0505] In certain embodiments, the disease or condition is selected from atherosclerosis, vascular disease, myocardial infarction, angina, stroke, renal disease, renal failure, obesity, glucose intolerance, type 2 diabetes (non-insulin-dependent diabetes mellitus), and metabolic syndrome.
[0506] In yet another aspect, the present application further provides a method for preventing and / or treating a disease or condition, comprising administering to a subject in need thereof an effective amount of the aforementioned RNA inhibitor for inhibiting APOC3 gene expression or a pharmaceutically acceptable salt thereof, and / or the aforementioned pharmaceutical composition.
[0507] The in vivo method of the present application may include administering to a subject a composition comprising an RNA inhibitor, wherein the RNA inhibitor comprises a nucleotide sequence complementary to at least a portion of an RNA transcript of an APOC3 gene of a mammal to which the RNA inhibitor is administered. The composition may be administered by any means known in the art, including but not limited to: oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the pharmaceutical composition is administered by intravenous infusion or injection. In certain embodiments, the composition is administered by subcutaneous injection. In certain embodiments, the composition is administered by intramuscular injection.
[0508] The RNA inhibitors of the present application can also be administered as "free RNA inhibitors". Free RNA inhibitors are administered in the absence of a pharmaceutical composition. Naked RNA inhibitors can be in a suitable buffer. The buffer can contain acetate, citrate, prolamin, carbonate or phosphate, or any combination thereof. In one embodiment, the buffer is phosphate buffered saline (PBS). The pH and osmotic pressure of the buffer containing the RNA inhibitor can be adjusted so that it is suitable for administration to a subject.
[0509] Alternatively, the RNA inhibitors of the present application can be administered as a pharmaceutical composition, such as a liposomal formulation.
[0510] The pharmaceutical composition of the present application can be administered at a dose sufficient to inhibit APOC3 gene expression. In some embodiments, a suitable dose of the RNA inhibitor of the present application is in the range of about 0.001 to about 1000.0 mg per kilogram of body weight of the subject per day; in some embodiments, a suitable dose of the RNA inhibitor of the present application is in the range of about 1 to 50 mg per kilogram of body weight per day; in some embodiments, a suitable dose of the RNA inhibitor of the present application is in the range of about 0.1 mg / kg to about 10.0 mg / kg, for example, in the range of about 0.3 mg / kg to about 3.0 mg / kg.
[0511] In one embodiment, the method comprises administering a pharmaceutical composition of the invention to reduce target APOC3 gene expression, such as for about 1, 2, 3, 4, 5, 6, 1-6, 1-3, or 3-6 months per dose. In certain embodiments, the composition is administered once every 3-6 months.
[0512] In certain embodiments, after the initial treatment regimen, the treatment is administered less frequently. A repeated dosage regimen may include administering a therapeutic amount of the RNA inhibitor regularly, such as once a month to once a year. In certain embodiments, the RNA inhibitor is administered from about once a month to about once every three months, or from about once every three months to about once every six months.
[0513] After the initial treatment regimen, treatment can be administered less frequently. The duration of treatment can be determined based on the severity of the disease.
[0514] In other embodiments, a single dose of the pharmaceutical composition of the present application can be long-acting, so that the dosage is applied at intervals of no more than 1, 2, 3 or 4 months. In some embodiments of the present application, a single dose of the pharmaceutical composition of the present application is applied approximately once a month. In other embodiments of the present application, a single dose of the pharmaceutical composition of the present application is applied quarterly (i.e., approximately every 3 months). In other embodiments of the present application, a single dose of the pharmaceutical composition of the present application is applied 2 times per year (i.e., approximately once every 6 months).
[0515] It will be understood by those skilled in the art that certain factors may affect the dosage and administration time required to effectively treat a subject, including but not limited to: mutations present in the subject, previous treatments, the subject's general health or age, and other diseases present. In addition, treating a subject with a prophylactically and / or therapeutically effective amount of a pharmaceutical composition may include a single treatment or a series of treatments, as needed.
[0516] In certain embodiments, it further comprises determining the level of APOC3 in a sample from the subject.
[0517] For example, it further comprises determining the level of APOC3 in a blood sample, serum sample, or urine sample from the subject.
[0518] In certain embodiments, the method further comprises administering to the subject an additional therapeutic agent for treating hyperlipidemia.
[0519] For example, the additional therapeutic agent can be selected from statins, such as atorvastatin, rosuvastatin, etc.; cholesterol absorption inhibitors such as ezetimibe; PCSK9 inhibitors.
[0520] On the other hand, the present application further provides a cell comprising the aforementioned RNA inhibitor for inhibiting APOC3 gene expression or a pharmaceutically acceptable salt thereof.
[0521] In yet another aspect, the present application further provides a drug kit comprising the aforementioned RNA inhibitor for inhibiting APOC3 gene expression or a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.
[0522] Without intending to be bound by any theory, the following examples are merely intended to illustrate the RNA inhibitors, preparation methods, and uses of the present invention, and are not intended to limit the scope of the present invention.
[0523] Example
[0524] illustrate:
[0525] The Chinese name of DMSO is dimethyl sulfoxide;
[0526] The Chinese name of DMF is N,N-dimethylformamide;
[0527] The Chinese name of HOBt is 1-hydroxybenzotriazole;
[0528] The Chinese name of HBTU is O-benzotriazole-tetramethyluronium hexafluorophosphate;
[0529] The Chinese name of DIPEA (DIEA) is N,N-diisopropylethylamine;
[0530] The Chinese name of DCM is dichloromethane;
[0531] The Chinese name of DMAP is 4-dimethylaminopyridine;
[0532] The Chinese name of DMT-CL is 4,4'-dimethoxytriphenylmethane;
[0533] The Chinese name for MEOH is methanol;
[0534] The Chinese name of TBTU is O-benzotriazole-N,N,N',N'-tetramethyluronium tetrafluoroborate;
[0535] The name of the solid phase carrier is macroporous aminomethyl resin (Resin).
[0536] Example 1 Synthesis of RNA Inhibitors
[0537] The sense and antisense strands of the uncoupled vector construct were synthesized using a standard solid-phase phosphoramidite method using a solid-phase synthesizer. The sense strands were then complementary annealed with the corresponding antisense strands to produce RNA inhibitors.
[0538] The basic steps of the solid phase phosphoramidite method include:
[0539] 1) Deprotection: removing the hydroxyl protecting group (DMTr) of the starting monomer Solid Support;
[0540] 2) Coupling: Add the first phosphoramidite monomer and the coupling reaction occurs in the 3' to 5' direction;
[0541] 3) Oxidation: oxidizing the resulting nucleoside phosphite to a more stable nucleoside phosphate (i.e., oxidation of trivalent phosphorus to pentavalent phosphorus);
[0542] 4) Blocking: Block the 5'-OH group of the nucleotide sequence that failed in the previous step to prevent it from further participating in the reaction; repeat the above steps until the last phosphoramidite monomer is added; then use methylamine aqueous solution and ammonia water to cleave the ester bond between SolidSupport and the starting monomer, and remove the protecting groups on each base and phosphate on the resulting nucleotide sequence; after HPLC separation and purification, filter sterilization, and lyophilization to obtain the corresponding sense chain or antisense chain.
[0543] Description of the synthesis process of RNA inhibitors:
[0544] Reconstitute the sense and antisense strand lyophilized powders separately and mix them in equal moles. Add an appropriate amount of water for injection and an appropriate amount of TRIS buffer. Gently shake the solution for approximately 1–2 minutes to mix thoroughly. Heat a water bath to 92–95°C. Heat the reaction mixture in a water bath for 3–5 minutes, gently shaking to ensure even heating. Cool naturally to room temperature. A colorless or slightly yellowish transparent liquid is obtained. Sample the solution for analysis and concentration determination.
[0545] Example 2-1 In vitro inhibition of APOC3 gene expression by RNA inhibitors 1
[0546] The RNA inhibitors (DS52-DS102) of this example were prepared using the method described in Example 1. An aqueous solution of the RNA inhibitor and an organic solution of DOTMA were mixed to form a water-insoluble precipitate. The precipitate was separated, dried, dissolved in chloroform, and further mixed with chloroform solutions of other lipids, including M10C1 and PEG600-cholesterol. The mixture was vacuum centrifuged and dried overnight to obtain nanolipid-encapsulated RNA inhibitors, wherein the weight ratios of DOTMA, M10C1, and PEG600-cholesterol to the RNA inhibitor were 1-1.6, 1.5-2.5, and 2.5-3.5, respectively.
[0547] Prepare the corresponding concentration of nanolipid-encapsulated RNA inhibitor sample solution using DMEM containing 10% fetal bovine serum. 5 HepG2 cells were seeded at a high density in DMEM medium with 10% fetal bovine serum at 37°C and 5% CO2. After 24 hours of incubation, 10 nM of the sample intervention was added. After 72 hours of incubation, the cell samples were collected and 1 mL of Ezol lysis buffer was added to the collected cell samples. Vortex to mix thoroughly. 0.2 mL of chloroform was added, and the mixture was shaken vigorously for 10 seconds. The mixture was then incubated at room temperature for 1 minute. Centrifuge at 12,000 x g for 15 minutes at 4°C. The supernatant was transferred to a fresh RNase-free centrifuge tube and an equal volume of 100% ethanol was added. The entire sample was aspirated and loaded into a mini-spin column with a 2 mL collection tube. Centrifuge at 8,000 x g for 15 seconds at room temperature. Discard the flow-through. Transfer the remaining sample to the spin column and repeat the previous step. Add 700 μL of Western blotting buffer to the spin column, gently cap, and centrifuge at 8,000 × g for 15 seconds at room temperature. Discard the flow-through and repeat the previous step, washing the spin column twice with 500 μL of Western blotting buffer. Measure APOC3 mRNA levels by qRT-PCR. Compare the relative expression of APOC3 mRNA in the treated sample group to that in the supernatant of untreated HepG2 cells.
[0548] Data analysis ΔΔCt method (Ct difference comparison method):
[0549] The housekeeping gene GAPDH is expressed in all cells. Its product is essential for cell survival. Its expression level, or genomic copy number, is constant and is minimally affected by environmental factors. Therefore, GAPDH is used as an internal reference gene. After qRT-PCR, the CT value of the internal reference is recorded, referred to as Ct(GAPDH). The CT value of the sample is referred to as Ct(sample).
[0550] ΔCt(sample)=Ct(sample)-Ct(GAPDH)
[0551] ΔCt(control)=Ct(control)-Ct(GAPDH)
[0552] ΔΔCt = ΔCt(sample) - ΔCt(control)
[0553] Relative gene expression level = 2-ΔΔCt
[0554] The test results are shown in Table 23 below.
[0555] Table 23 APOC3 mRNA levels in HepG2 cells after RNA inhibitor intervention
[0556]
[0557]
[0558]
[0559]
[0560]
[0561] The experimental results showed that the RNA inhibitors in Table 6 exhibited varying degrees of inhibitory effects on the expression level of APOC3 mRNA in HepG2 cells at different concentrations, among which DS52-58, DS60, DS62-64, DS66-75, DS77-87, DS90-98 and DS100-102 had significant inhibitory effects on the expression level of APOC3 mRNA in HepG2 cells.
[0562] Example 2-2 In vitro inhibition of APOC3 gene expression by RNA inhibitors 2
[0563] The RNA inhibitor sequences of this example were selected from Table 5 and prepared by the method described in Example 1. HepG2 cells were inoculated with the RNA inhibitors in 96-well cell plates. Simultaneously, the siRNA compounds were transfected into the cells using a transfection reagent. siRNA concentrations were tested at 1 nM and 0.1 nM. The cells were incubated overnight at 37°C in a 5% CO2 incubator. Three replicates were tested. A control group was also established.
[0564] qPCR detection of target gene mRNA expression levels: 48 hours after transfection, RNA was extracted and target cDNA was detected by qPCR. GAPDH cDNA was also detected in parallel as an internal control. 8 μL of the prepared qPCR reaction solution and 2 μL of sample cDNA were added to 384-well plates. The qPCR reaction program was as follows: heating at 95°C for 10 minutes, followed by cycling at 95°C for 15 seconds, followed by 60°C for 1 minute, for a total of 40 cycles. The relative expression level of APOC3 mRNA in the sample-treated group was compared with that in the supernatant of untreated HepG2 cells. The average of the APOC3 relative expression level was calculated from three tests. The experimental results obtained at 1 nM and 0.1 nM are shown in Tables 24 and 25 below.
[0565] Table 24 RNA inhibitors inhibit APOC3 gene effect in vitro (1nM)
[0566]
[0567]
[0568]
[0569]
[0570]
[0571]
[0572]
[0573] Table 25 RNA inhibitors inhibit APOC3 gene effect in vitro (0.1nM)
[0574]
[0575]
[0576]
[0577]
[0578] RNA inhibitors Ky-12-DS230, Ky-12-DS250, Ky-12-DS254, Ky-12-DS297, Ky-12-DS298, Ky-12-DS317, and Ky-12-DS330 were selected as EC 50 The experimental results are shown in Table 26.
[0579] Table 26EC 50 value
[0580]
[0581] Example 3 In vitro inhibition of APOC3 gene expression by RNA inhibitors 2
[0582] The sequences of this example were selected from Table 8. The sense and antisense strands were modified with methoxylation or fluorination at the 2' position of the sugar group. The modified sequences of the sense and antisense strands are shown in Tables 6-1 and 7-1, respectively. RNA inhibitors were synthesized by annealing the corresponding sequences in Tables 6-1 and 7-1.
[0583] The RNA inhibitor prepared as described in Example 1 was transfected into HepG2 cells. The inhibitor's effect on the cells was assessed at a concentration of 1.0 nM. APOC3 mRNA levels were measured by qRT-PCR. The relative expression of APOC3 mRNA in the treated samples was calibrated by comparing the supernatant with that in the untreated HepG2 cells. The results are shown in Table 27.
[0584] Table 27 APOC3 mRNA levels in HepG2 cells after RNA inhibitor intervention
[0585]
[0586]
[0587] The RNA inhibitors DS104-105, DS107-109, DS111, DS113-114, DS118, DS122, DS124, DS127, DS131 and DS132 were selected for further activity studies.
[0588] Example 4 In vitro inhibition of APOC3 gene expression by RNA inhibitors 3
[0589] The sequences of this embodiment are selected from Table 8. The 2'-position methoxylation or fluorination modification of the sugar group is performed in the sense chain and antisense chain sequences, and the modified sequences of the sense chain and antisense chain are shown in Table 6-1 and Table 7-1, respectively. The corresponding sequences in Table 6-1 and Table 7-1 are annealed to synthesize RNA inhibitors. The effect of RNA inhibitors on APOC3 intervention in cells at a low concentration of 0.1 nM was investigated. The RNA inhibitors prepared according to the method described in Example 1 were taken. The RNA inhibitors were transfected into HepG 2 cells, and the APOC3 mRNA level was determined by qRT-PCR. Compared with the supernatant of HepG 2 cells without intervention, the relative expression of APOC3 mRNA in the sample intervention group was calibrated. The obtained experimental results are shown in Table 28.
[0590] Table 28
[0591]
[0592] Results: DS107, DS108, DS113, DS114, DS124, DS131 and DS132 were further selected for the next EC 50 Detection.
[0593] Example 5 In vitro inhibition of APOC3 gene expression by RNA inhibitors
[0594] This example detects the EC of DS107, DS108, DS113, DS114, DS124, DS131, and DS132. 50 value.
[0595] RNA inhibitors were transfected into HepG2 cells to investigate the effects of RNA inhibitors on the APOC3 gene at concentrations of 10 nM, 5 nM, 2 nM, 1 nM, 0.5 nM, 0.1 nM, 0.05 nM, and 0.01 nM. APOC3 mRNA levels were measured by qRT-PCR, and EC values were calculated. 50 The test results are shown in Table 29.
[0596] Table 29 RNA inhibitor EC 50 value
[0597] RNA inhibitors <![CDATA[Absolute EC 50 (nM)]]> DS107 0.035 DS108 <0.01 DS113 <0.01 DS114 0.029 DS124 0.042 DS131 0.018 DS132 0.019
[0598] DS107, DS108, DS113, DS114, DS124, DS131 and DS132 were selected and entered the next step of ligation with 5'MVIP / 3'MVIP.
[0599] Example 6 Synthesis of 5'MVIP and 3'MVIP Compounds
[0600] When the 3' end of the sense or antisense strand of the RNA inhibitor of the present invention is coupled with the support structure 3'MVIP, the solid support of 3'MVIP serves as the starting monomer for solid-phase synthesis. When the 5' end of the sense or antisense strand of the RNA inhibitor of the present invention is coupled with the support structure 5'MVIP, the 5'MVIP phosphoramidite monomer serves as the last monomer for solid-phase synthesis.
[0601] When the 3' end of the sense strand or antisense strand of the RNA inhibitor of the present application is coupled with 3'MVIP, the solid support of 3'MVIP serves as the starting monomer for solid phase synthesis. The general formula of the solid support of 3'MVIP is as follows:
[0602]
[0603] When m is 1-4, the linker B portion in the general formula is branched 1 to 4 times to obtain the corresponding 3'MVIP SolidSupport.
[0604] For example, when m is 1, the resulting Solid Support acts as an RNA inhibitor
[0605] Starting monomers for solid-phase synthesis of the sense strands of Kylo-12-DS134 to Kylo-12-DS136, Kylo-12-DS142, Kylo-12-DS145, Kylo-12-DS146, Kylo-12-DS157, and Kylo-12-DS158, and the antisense strands of Kylo-12-DS131 to Kylo-12-DS133, Kylo-12-DS139, Kylo-12-DS140, Kylo-12-DS149, Kylo-12-DS150, and other RNA inhibitors described herein;
[0606] When m is 2, the obtained Solid Support is used as a starting monomer for the solid-phase synthesis of the sense chains of the RNA inhibitors Kylo-12-DS141, Kylo-12-DS143, Kylo-12-DS144, Kylo-12-DS154 to Kylo-12-DS156, Kylo-12-DS166, Kylo-12-DS169, and Kylo-12-DS170, and the antisense chains of Kylo-12-DS1081, Kylo-12-DS137, Kylo-12-DS138, Kylo-12-DS151 to Kylo-12-DS153, Kylo-12-DS163, Kylo-12-DS164, and other RNA inhibitors described in the present invention;
[0607] When m is 3, the obtained Solid Support is used as the starting monomer for the solid-phase synthesis of the positive strands of the RNA inhibitors Kylo-12-DS159, Kylo-12-DS160, Kylo-12-DS165, Kylo-12-DS167, Kylo-12-DS168, Kylo-12-DS174, Kylo-12-DS175 and the antisense strands of Kylo-12-DS147, Kylo-12-DS148, Kylo-12-DS161, Kylo-12-DS162, Kylo-12-DS171, Kylo-12-DS172 and other RNA inhibitors described in the present invention.
[0608] When the 5' end of the sense strand or antisense strand of the RNA inhibitor of the present application has 5'MVIP, the 5'MVIP phosphoramidite monomer is the last phosphoramidite monomer in the solid phase synthesis of the sense strand or antisense strand. The general formula of the 5'MVIP phosphoramidite monomer is as follows:
[0609]
[0610] When n is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding 5'MVIP phosphoramidite monomer.
[0611] For example, when n is 1, the resulting 5'MVIP phosphoramidite monomer is used as the last monomer in the solid-phase synthesis of the sense strands in the RNA inhibitors Kylo-12-DS131 to Kylo-12-DS134, Kylo-12-DS137, Kylo-12-DS138, Kylo-12-DS141, Kylo-12-DS147, and Kylo-12-DS148, and other RNA inhibitors described herein, and the antisense strands in Kylo-12-DS135, Kylo-12-DS136, Kylo-12-DS143, Kylo-12-DS144, Kylo-12-DS159, Kylo-12-DS160, and other RNA inhibitors described herein;
[0612] When n is equal to 2, the obtained 5'MVIP phosphoramidite monomer is used as the last monomer in the solid-phase synthesis of the sense strands in Kylo-12-DS1081, Kylo-12-DS139, Kylo-12-DS140, Kylo-12-DS142, Kylo-12-DS151 to Kylo-12-DS154, Kylo-12-DS161, Kylo-12-DS162, Kylo-12-DS165 and other RNA inhibitors described in the present invention, and the antisense strands in Kylo-12-DS145, Kylo-12-DS146, Kylo-12-DS155, Kylo-12-DS156, Kylo-12-DS167, Kylo-12-DS168 and other RNA inhibitors described in the present invention.
[0613] When n is 3, the resulting 5'MVIP phosphoramidite monomer with three liver-targeting specific ligands X can be used as the last monomer in the solid-phase synthesis of the sense strands in Kylo-12-DS149, Kylo-12-DS150, Kylo-12-DS163, Kylo-12-DS164, Kylo-12-DS166, Kylo-12-DS171 to Kylo-12-DS173 and other RNA inhibitors described in the present invention, and the antisense strands in Kylo-12-DS157, Kylo-12-DS158, Kylo-12-DS169, Kylo-12-DS170, Kylo-12-DS174, Kylo-12-DS175 and other RNA inhibitors mentioned in this specification.
[0614] The above examples are merely examples of some RNA inhibitors. All RNA inhibitors described in the present invention but not listed here are subject to this rule. That is, when the 3' end of the sense or antisense strand of the RNA inhibitor of the present application is coupled with the support structure 3'MVIP, the solid support of 3'MVIP serves as the starting monomer for solid-phase synthesis. When the 5' end of the sense or antisense strand of the RNA inhibitor of the present application is coupled with the support structure 5'MVIP, the 5'MVIP phosphoramidite monomer serves as the last monomer for solid-phase synthesis.
[0615] Before the phosphoramidite solid phase synthesis of the sense and antisense strands of the RNA inhibitors, the corresponding 3'MVIP Solid Support and 5'MVIP phosphoramidite monomers need to be chemically synthesized.
[0616] This example only provides examples of the chemical synthesis of several 3'MVIP Solid Support and 5'MVIP phosphoramidite monomers of the RNA inhibitor of the present invention. Those skilled in the art can easily synthesize other 3'MVIP Solid Support and 5'MVIP phosphoramidite monomers not listed. The synthesis process is described as follows:
[0617] 4.1 Synthesis of 3'MVIP Solid Support
[0618] 4.1.1 Synthesis of the Solid Support of 3'MVIP09
[0619]
[0620] Description of the synthesis process:
[0621] 4.1.1.1 Synthesis of ERC-01-c1
[0622]
[0623] Weigh 2-amino-1,3-propanediol (5.0 g, 54.9 mmol) and add 50 mL of DMSO and 5 mL of sodium hydroxide solution (1 g / mL). Cool to 0°C and add tert-butyl acrylate (20 mL, 137.8 mol) dropwise over 2 hours. Let react at room temperature for 48 hours. Add petroleum ether (100 mL), wash twice with saturated brine, and dry the organic layer. Pass the mixture through a chromatography column (eluent: ethyl acetate:petroleum ether = 25%-75%). Add 0.05% triethylamine to the column to obtain 6.2 g of a colorless oil.
[0624] 4.1.1.2 Synthesis of ERC-01-c2
[0625]
[0626] Weigh ERC-01-c1 (6.2 g, 17.9 mmol), add 50 mL of dichloromethane and 23 mL of sodium carbonate solution (25%), and add benzyl chloroformate (8.2 mL, 57.4 mmol) dropwise at room temperature for 2 hours. React at room temperature overnight, wash three times with saturated brine, dry over anhydrous sodium sulfate, evaporate the solvent, and pass through a chromatography column (ethyl acetate: petroleum ether = 5%-30%) to obtain 4.0 g of an oil.
[0627] 4.1.1.3 Synthesis of ERC-01-c3
[0628]
[0629] Take ERC-01-c2 (4.0 g, 8.3 mmol) and add 12 mL of formic acid, react at room temperature overnight, and evaporate the solvent under reduced pressure to obtain 2.8 g of product. 4.1.1.4 Synthesis of ERCd-01-c1
[0630]
[0631] Compounds ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by HOBt (2.24 g) and HBTU (3.36 g), and then DIEA (4.16 mL) was slowly added. The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 x 10 mL). The organic layers were combined and washed sequentially with saturated sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated brine (60 mL). The mixture was dried over anhydrous sodium sulfate, evaporated to dryness under reduced pressure, and purified by silica gel column chromatography (eluent: 3-15% MeOH in DCM). 3.24 g of a pale yellow solid was obtained.
[0632] 4.1.1.5 Synthesis of ERCd-01-c2
[0633]
[0634] ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium on carbon (0.3 g) and acetic acid (2.0 mL) were added. Hydrogenation was then added under normal pressure, and the reaction was allowed to proceed overnight. The reaction solution was filtered through celite, and the filtrate was evaporated to dryness under reduced pressure to obtain 2.9 g of ERCd-01-c2 as an oil.
[0635] 4.1.1.6 Synthesis of 3'MVIP09-c1
[0636]
[0637] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added to the reaction flask in sequence, and then 10 mL of DCM was added and stirred to dissolve. TBTU (0.963 g) and DIPEA (0.517 g) were added in sequence, and the reaction was allowed to proceed overnight. Water was added and the mixture was extracted with DCM. The organic phase was washed with saturated brine, dried, filtered, concentrated, and finally purified by silica gel column to obtain 1.3 g of the product.
[0638] 4.1.1.7 Synthesis of 3'MVIP09-c2
[0639]
[0640] 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added to the reaction flask in sequence, stirred at room temperature to dissolve, and then DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added in sequence. The reaction was stirred at room temperature and analyzed by TLC. If the reaction was qualified, DCM was concentrated and water was added. The mixture was extracted with DCM, and the organic phase was washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and finally purified by silica gel column to obtain 1.55 g of the product.
[0641] 4.1.1.8 Solid Support Synthesis of 3'MVIP09
[0642]
[0643] 3'MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL of DMF were added to the reaction flask in sequence and dissolved. HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g) were then added in sequence. The mixture was shaken for 24 h and filtered. The resin was washed with 10% methanol / DCM and capped with 25% acetic acid / pyridine. The degree of substitution was 150 μmol / g.
[0644] 4.1.2 Synthesis of the Solid Support of 3'MVIP17
[0645]
[0646] 4.1.2.1 Synthesis of SANC-01-c1
[0647]
[0648] The synthesis steps refer to 4.1.1.1. Synthesis of ERC-01-c1. 4.1.2.2 Synthesis of SANC-01-c2
[0649]
[0650] The synthesis steps refer to 4.1.1.2. Synthesis of ERC-01-c2. 4.1.2.3 Synthesis of SANC-01-c3
[0651]
[0652] The synthesis steps refer to 4.1.1.3. Synthesis of ERC-01-c3. 4.1.2.4 Synthesis of SANCd-01-c1
[0653]
[0654] The synthesis steps refer to 4.1.1.4. Synthesis of ERCd-01-c1. 4.1.2.5 Synthesis of SANCd-01-c2
[0655]
[0656] The synthesis steps refer to 4.1.1.5. Synthesis of ERCd-01-c2.
[0657] 4.1.2.6 Synthesis of 3'MVIP17-c1
[0658]
[0659] The synthesis steps refer to the synthesis of 4.1.1.6.3'MVIP09-c1 to obtain 3'MVIP17-c1. 4.1.2.7 Synthesis of 3'MVIP17-c2
[0660]
[0661] The synthesis steps refer to 4.1.1.7.3'MVIP09-c2 synthesis.
[0662] 4.1.2.8 Solid Support Synthesis of 3'MVIP17
[0663]
[0664] The synthesis steps refer to 4.1.1.8 Synthesis of Solid Support of 3'MVIP09. 4.1.3 Synthesis of Solid Support of 3'MVIP01:
[0665]
[0666] Description of the synthesis process:
[0667] 4.1.3.1 Synthesis of 3'MVIP01-c1
[0668]
[0669] The synthesis steps are as described in 4.1.1.6.3'MVIP09-c1. 4.1.3.2 3'MVIP01-c2
[0670]
[0671] The synthesis steps refer to 5.1.1.7.3'MVIP09-c2 synthesis.
[0672] 4.1.3.3 Solid Support Synthesis of 3'MVIP01
[0673]
[0674] The synthesis steps refer to 4.1.1.8.3'Solid Support Synthesis of MVIP09.
[0675] 4.2. Synthesis of 5'MVIP Phosphoramidite Monomer
[0676] 4.2.1 Synthesis of 5'MVIP09 phosphoramidite monomer:
[0677]
[0678] 4.2.1.1 Synthesis of 5'MVIP09-ERCd-PFP-c1
[0679]
[0680] ERCd-01-c2 (2.18 g, 2.0 mmol) was weighed and dissolved in DMF (50 mL). Benzyl glutarate (0.53 g, 2.4 mmol), DIPEA (0.78 g) and TBTU (0.84 g) were added and stirred at room temperature overnight. The mixture was quenched with water (50 mL) and extracted with DCM (30 mL*3). The mixture was washed with 10% citric acid (50 mL*3), saturated sodium bicarbonate (50 mL) and pyridine (100 mL). The mixture was dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain the product 5'MVIP09-ERCd-PFP-c1 (2.15 g).
[0681] 4.2.1.2 Synthesis of 5'MVIP09-ERCd-PFP-c2
[0682]
[0683] Weigh 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium on carbon (0.21 g), add methanol (50 mL), stir and hydrogenate at room temperature overnight. After the reaction is completed, filter the palladium on carbon through celite and rotary evaporation to obtain the crude product 5'MVIP09-ERCd-PFP-c2 (1.9 g).
[0684] 4.2.1.3 Synthesis of 5'MVIP09-ERCd-PFP
[0685]
[0686] The crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g, 1.58 mmol) was weighed and dissolved in DCM (60 mL). DIPEA (1.33 g) was added and cooled. Pentafluorophenol trifluoroacetate (2.21 g, 7.9 mmol) was added and stirred at room temperature for 2 h. The product was then rotary evaporated and dissolved in DCM (60 mL). The product was washed with saturated sodium bicarbonate (30 mL*3), 10% citric acid (30 mL*1), and saturated brine (50 mL*1). The product was dried over anhydrous sodium sulfate, filtered, and rotary evaporated to obtain the crude product of 5'MVIP09-ERCd-PFP (2.35 g). The product was dried and used directly in the next reaction without purification.
[0687] 4.2.1.4 Synthesis of 5'MVIP09 Phosphoramidite Monomer-c1
[0688]
[0689] The crude 5'MVIP09-ERCd-PFP product (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL) and DIPEA (0.82 g, 6.32 mmol) and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added. The mixture was stirred at room temperature overnight. 10% citric acid (30 mL) was added and the mixture was extracted with DCM (30 mL x 3). The product was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain 5'MVIP09 monomer-c1 (1.73 g).
[0690] 4.2.1.5 5'MVIP09 phosphoramidite monomer
[0691]
[0692] 5'MVIP09 phosphoramidite monomer-c1 (1.3 g, 1.0 mmol) was weighed and dissolved in acetonitrile (30 mL). Diisopropylamine triazole (0.22 g) was added, and bis-(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) was added dropwise under ice bath. The reaction was carried out at room temperature for 4 h. The reaction was controlled by HPLC. After the reaction was qualified, the product 5'MVIP09 monomer (1.2 g) was obtained by concentration and column purification.
[0693] 4.2.2 Synthesis of 5'MVIP01 phosphoramidite monomer:
[0694]
[0695] 5'MVIP01 phosphoramidite monomer YICd-01-c2 (1.12 g, 2.0 mmol) was weighed, and the remaining operations were carried out according to 4.2.1.1. to 4.2.1.5.
[0696] Example 7 Synthesis of RNA Inhibitors Conjugated with 5'MVIP09 / 3'MVIP 09 and Different siRNAs
[0697] Synthesis of the antisense strand and its vector structure: Purge the reagent bottle with argon for at least 2 minutes. Add the phosphoramidite monomer and acetonitrile to the vial, tighten the cap, and shake until the solid is visually dissolved. Then, add 3A molecular sieves and let it stand for at least 8 hours before use. Purge the reagent bottle with argon for at least 2 minutes. Add hydrogenated xanthan gum and dry pyridine to the vial, tighten the cap, and shake until the solid is visually dissolved. Set aside. Ensure that the ambient temperature is 20-30°C. Perform the following steps: Weigh the 3'MVIP vector and add it to the vial. Add acetonitrile and shake to mix thoroughly. Transfer the vector to the synthesis column and rinse the remaining vector in the vial with acetonitrile. After rinsing, fill the synthesis column with acetonitrile, recording the amount of acetonitrile used. Install and secure the synthesis column according to the instrument instructions.
[0698] Connect the prepared monomer solution, CAP A, CAP B, oxidant, thiolation reagent, activator, decapping agent and acetonitrile to the corresponding tubing of AKTA PILOT100, ensuring that the tubing is inserted into the bottom of the reagent bottle.
[0699] Once the synthesis method is set up and the instrument is ready, click Run to begin the synthesis. Observe and record the area of each detritylation peak online. During the synthesis, add additional deprotection reagent based on the actual amount used.
[0700] After the synthesis is completed, argon is purged into the synthesis column for ≥2h, and the synthesis column is unloaded according to the operating procedures. The solid phase carrier in the synthesis column is transferred to the reaction bottle, methylamine aqueous solution and ammonia water are added, and the reaction bottle is placed in a shaker at 35°C for 2-3 hours. The solution is filtered into a round-bottom flask, and the residual solid phase is washed with 50% ethanol aqueous solution, filtered again and combined with the previous filtrate, the round-bottom flask is connected to a rotary evaporator, the water temperature is set to 50°C and evaporated until no distillate is produced, ethanol is added to the round-bottom flask, mixed, and evaporated again until no distillate is produced. Repeat the operation until white powder appears at the bottom of the bottle. The obtained white powder is prepared into a solution, purified using a reverse chromatography column, and samples are taken to detect OD260 and purity. The purified antisense chain solution is divided into vials and freeze-dried for use, and the product is sealed and stored in a -20°C refrigerator.
[0701] The synthesis of the sense strand and its vector structure follows the same procedure as for the antisense strand and its vector structure, except that the column is loaded with a Universal vector. Add DIPEA to the resulting intermediate to create a solution, then add the 5'MVIP phosphoramidite monomer. Mix thoroughly, and place the reaction flask in a shaker at 35°C for 2-3 hours.
[0702] Description of the synthetic annealing process of RNA inhibitors:
[0703] Take the positive chain and its vector structure, take the antisense chain and its vector structure, mix them in a reaction bottle at an equimolar ratio of 1:1, and place them in a water bath at 95°C for 5 minutes. Then turn off the power of the water bath and let it cool naturally to below 40°C. Add 3M sodium acetate aqueous solution to the double-stranded solution, mix evenly, then add an appropriate volume of anhydrous ethanol, mix evenly, and place the reaction solution in a -20°C refrigerator for 45 minutes. Set the refrigerated high-speed centrifuge to 4°C for pre-cooling. After the temperature is reached, add the double-stranded solution and start the centrifuge. Take out the double-stranded solution after centrifugation, remove the supernatant, add ultrapure water to completely dissolve the solid, take samples to test OD260 and purity, and obtain the RNA inhibitors in Table 14. The purified finished solution is divided into syringe bottles and freeze-dried for use, and the product is sealed and stored in a -20°C refrigerator.
[0704] Example 8-1 Application of PHH to evaluate the activity of RNA inhibitors containing 5'MVIP09 / 3'MVIP09 structure
[0705] Primary human hepatocytes (PHH) were used to evaluate the in vitro activity of the RNA inhibitors listed in Table 15. Frozen PHH were revived and the cell density was adjusted to 6×10 5 cells per milliliter. Prepared RNA inhibitors were added from the dilution plate to a 96-well cell culture plate (10 μL / well), and 90 μL / well of cells were added to the 96-well plate, with a final volume of 100 μL per well. RNA inhibitors were diluted 10-fold starting at 200 nM, with a total of three concentration points, in triplicate, and incubated in a 5% CO2, 37°C incubator for 48 hours. Intracellular RNA was extracted and then reverse-transcribed into cDNA. Target gene cDNA was detected using qPCR. GAPDH was used as an internal reference gene, and qPCR was performed in a 384-well plate. The qPCR reaction procedure was: 95°C for 10 minutes; then 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The relative expression level of APOC3 mRNA was detected. The experimental results are shown in Table 31.
[0706] Table 31 Relative expression levels of APOC3 mRNA after RNA inhibitor intervention
[0707]
[0708] This example verifies that the 5'MVIP09 / 3'MVIP09 vector combination can achieve self-delivery of siRNA.
[0709] Example 8-2 Application of PHH to evaluate the inhibitory activity of RNA with 5'MVIP / 3'MVIP
[0710] This example uses primary human hepatocytes to evaluate the in vitro activity of the modified RNA inhibitors listed in Table 22-1. 5 cells per milliliter. Prepared RNA inhibitors were added from the dilution plate to a 96-well cell culture plate (10 μL / well), and 90 μL / well of cells were added to the 96-well plate, for a final volume of 100 μL per well. Two concentrations of RNA inhibitors were added: 200 nM and 20 nM, in triplicate. After addition, the cells were incubated in a 5% CO2, 37°C incubator for 48 hours. Intracellular RNA was extracted and then reverse-transcribed into cDNA. qPCR was performed in a 384-well plate to detect the target gene cDNA. GAPDH was used as an internal reference gene, and qPCR was performed in a 384-well plate. The qPCR reaction procedure was: 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The relative expression level of APOC3 mRNA was measured. The experimental results are shown in Table 32 below.
[0711] Table 32 APOC3 mRNA relative expression levels
[0712]
[0713]
[0714] The experimental results showed that the vector structure at the modified 5' end of the sense chain was 5'MVIP17, the vector structure at the modified 3' end of the sense chain was 3'MVIP17, and the RNA inhibitors formed by the modified sense and antisense chain coupled vectors 5'MVIP / 3'MVIP combinations 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, 5'MVIP17 / 3'MVIP01, or 5'MVIP09 / 3'MVIP09, or the sense chain 5'MVIP and sense chain 3'MVIP combinations 5'MVIP01 / 3'MVIP09, 5'MVIP09 / 3'MVIP01, or 5'MVIP01 / 3'MVIP01 could be freely taken up into PHH cells and exhibited a significant inhibitory effect on APOC3 mRNA in PHH cells.
[0715] Example 9 Study on the Effect of Different Structures of 5'MVIP and 3'MVIP Coupled with the Same siRNA on the Activity of RNA Inhibitors
[0716] The antisense strand and the sense strand were selected separately, and the RNA inhibitors were paired and annealed according to the method described in Example 7 (see Table 22-2). The effect of different X, L, B, D, R1 or R2 in the 5'MVIP and / or 3'MVIP structure on the activity of RNA inhibitors was investigated. An APOC3 Tg mouse model of appropriate age was used for experimental evaluation. 3 mg / kg was administered by subcutaneous injection on Day 0. Blood was collected on the 14th day after administration (Day 14), serum was separated, and the APOC3 level in the serum was determined by ELISA. The test results are shown in Tables 33 and Figure 1 .
[0717] Table 33 APOC3 average level in serum of APOC3 Tg mice (normalized)
[0718] RNA inhibitors Average APOC3 levels after RNA inhibitor intervention Normal saline group 1.000 Kylo-12-DS131 0.331 Kylo-12-DS141 0.312 Kylo-12-DS142 0.291 Kylo-12-DS147 0.138 Kylo-12-DS148 0.136 Kylo-12-DS149 0.101 Kylo-12-DS150 0.127 Kylo-12-DS1081 0.179 Kylo-12-DS151 0.193 Kylo-12-DS152 0.184 Kylo-12-DS153 0.100 Kylo-12-DS154 0.134 Kylo-12-DS155 0.199 Kylo-12-DS156 0.142 Kylo-12-DS157 0.178 Kylo-12-DS158 0.211 Kylo-12-DS159 0.243 Kylo-12-DS160 0.191
[0719] Note: Normalization is performed by dividing the TG level of each animal at a given time point by its Day 0 TG level, yielding a ratio A1. The average TG level of the control group at a given time point is divided by the average TG level of the control group on Day 0, yielding a ratio A2. Dividing A1 by A2 yields the normalized average blood TG level. The experimental results show that the overall activity of RNA inhibitors in the 5'MVIP / 3'MVIP combination with n+m=4 is slightly higher than that in the combination with n+m=3.
[0720] Example 10 Investigating the Effects of Different 5' or 3' End Nucleotides on RNA Inhibitor Activity
[0721] RNA inhibitors were transfected into HepG2 cells, and APOC3 mRNA levels were measured by qRT-PCR. The relative percentage of APOC3 mRNA in the intervention group was determined by comparing the supernatant of HepG2 cells without intervention. The experimental results are shown in Tables 34 and Figure 2 :
[0722] Table 34 Inhibition rate of APOC3 mRNA after RNA inhibitor intervention
[0723]
[0724]
[0725] The results showed that the 5' or 3' ends of the sense and antisense strands of RNA inhibitors can be modified by 1, 2 or even 3 nucleotides without significantly affecting the activity of the RNA inhibitors.
[0726] Example 11 Investigating the Effects of Different Modifications at the 2' Position of the Nucleotide Sugar on RNA Inhibitor Activity
[0727] The effects of 2'-position fluorine modification of nucleotide sugars at different positions starting from the 5' end of the sense strand and 2'-position fluorine modification of nucleotide sugars at different positions starting from the 5' end of the antisense strand on the RNA inhibitory activity were investigated.
[0728] The RNA inhibitor was transfected into HepG2 cells and the APOC3 mRNA level was measured by qRT-PCR. The average expression level of APOC3 mRNA in the sample intervention group was compared with that in the untreated HepG2 cell supernatant, and the inhibition rate was calculated. The results are shown in Tables 35 and Figure 3 :
[0729] Table 35 Inhibition rate of APOC3 mRNA after RNA inhibitor intervention
[0730]
[0731]
[0732] According to the experimental results, the modification method is sequence-specific. The 2'-position fluorine modification of the nucleotide sugar groups of 5, 7, 8, and 9 starting from the 5' end of the sense chain and the 2'-position fluorine modification of the nucleotide sugar groups of 7, 14, and 16 starting from the 5' end of the antisense chain are more ideal. DS231, DS261, DS281, and DS311 have the best effect.
[0733] DS541 and DS551 have the same sequence, with fluorine modification at the 2' position of the nucleotide sugar groups at 5, 7, 8, and 9 starting from the 5' end of the sense strand and fluorine modification at the 2' position of the nucleotide sugar groups at 7, 14, and 16 starting from the 5' end of the antisense strand, or fluorine modification at the 2' position of the nucleotide sugar groups at 3, 5, 7, 8, 9, 11, 13, and 15 starting from the 5' end of the sense strand and fluorine modification at the 2' position of the nucleotide sugar groups at 2, 4, 6, 8, 14, and 16 starting from the 5' end of the antisense strand, and RNA inhibitors maintain good activity.
[0734] DS571 has ideal fluorine-modified 2' positions of nucleotide sugars at 3, 5, 7, 8, 9, 11, 13, and 15 starting from the 5' end of the sense strand, and fluorine-modified 2' positions of nucleotide sugars at 2, 4, 6, 8, 14, and 16 starting from the 5' end of the antisense strand.
[0735] DS591 has ideal fluorine modification effects on the 2'-position of nucleotide sugars at positions 9, 10, and 11 starting from the 5' end of the sense strand, and on the 2'-position of nucleotide sugars at positions 2, 4, 6, 8, 14, and 16 starting from the 5' end of the antisense strand.
[0736] Example 12: Using PHH Screening to Evaluate the Effect of 5'MVIP09 / 3'MVIP09 Combination on RNA Inhibitor Delivery
[0737] Primary human hepatocytes were used to evaluate the in vitro activity of the RNA inhibitors listed in Table 36. Frozen PHH were revived and the cell density was adjusted to 6×10 5 cells per milliliter. Take the prepared RNA inhibitor from the dilution plate and add it to a 96-well cell culture plate (10 μL / well), and add 90 μL / well cells to the 96-well plate, with a final volume of 100 μL per well. The RNA inhibitor starts at 500 nM and is diluted 10 times in sequence, with a total of 3 concentration points and 3 replicates. After adding, it is placed in a 5% CO2, 37°C incubator and cultured for 48 hours. The intracellular RNA is extracted, and then the RNA is reverse transcribed into cDNA. The target gene cDNA is detected by qPCR. GAPDH is used as the internal reference gene, and qPCR is performed in a 384-well plate. The qPCR reaction procedure is: 95°C for 10 minutes; then 95°C for 15 seconds, 60°C for 1 minute for 40 cycles. The relative expression level of APOC3 mRNA was detected, and the inhibition rate was calculated. The results are shown in Tables 36 and Figure 4 .
[0738] Table 36 Inhibition rate of APOC3 mRNA after RNA inhibitor intervention
[0739]
[0740] The experimental results showed that the RNA inhibitor formed by the modified positive chain and antisense chain coupling vector 5'MVIP09 / 3'MVIP09 can be freely taken up into PHH cells, exerting an inhibitory effect on APOC3 mRNA in PHH cells, and exhibiting a significant dose-effect effect.
[0741] Example 13: Evaluation of RNA Inhibitor Activity Using a Transgenic Mouse Model
[0742] The in vivo activity of the RNA inhibitors listed in Table 36 was investigated. Appropriately aged APOC3 Tg mice were used for experimental evaluation. 3 mg / kg of each inhibitor was administered subcutaneously on day 0. Blood samples were collected on days 8, 15, 22, 29, 35, and 42 after administration to measure TG and APOC3 levels. The normalized mean APOC3 levels in serum after RNA inhibitor intervention are shown in Tables 37 and 38. Figure 5 .
[0743] Table 37 Normalized mean APOC3 levels in serum
[0744] RNA inhibitors d0 d8 d15 d22 d29 d35 d42 Normal saline group 1.000 1.000 1.000 1.000 1.000 1.000 1.000 Kylo-12-DS2311 1.000 0.219 0.161 0.234 0.199 0.267 0.299 Kylo-12-DS2611 1.000 0.209 0.178 0.157 0.246 0.278 0.300 Kylo-12-DS2911 1.000 0.159 0.169 0.210 0.269 0.250 0.289 Kylo-12-DS5911 1.000 0.189 0.193 0.225 0.253 0.320 0.35
[0745] Note: Normalization involves dividing the APOC3 level of an animal at a given time point by its level on day 0, yielding a ratio, A1. Dividing the mean level of the control group at that time point by the mean level of the control group on day 0 yields a ratio, A2. Dividing A1 by A2 gives the normalized mean serum APOC3 level.
[0746] After RNA inhibitor intervention, the normalized average serum TG levels are shown in Table 38 and Figure 6 :
[0747] Table 38 Normalized mean TG levels in serum
[0748] RNA inhibitors d0 d8 d15 d22 d29 d35 d42 Normal saline group 1.000 1.000 1.000 1.000 1.000 1.000 1.000 Kylo-12-DS2311 1.000 0.356 0.307 0.389 0.394 0.450 0.560 Kylo-12-DS2611 1.000 0.289 0.297 0.322 0.398 0.411 0.460 Kylo-12-DS2911 1.000 0.199 0.213 0.278 0.321 0.345 0.384 Kylo-12-DS5911 1.000 0.201 0.267 0.293 0.307 0.323 0.360
[0749] Note: Normalization involves dividing the TG level of an animal at a given time point by its level on day 0, yielding a ratio, A1. Dividing the average level of the control group at that time point by the average level of the control group on day 0 yields a ratio, A2. Dividing A1 by A2 gives the normalized average serum TG level.
[0750] Example 14: Evaluation of RNA Inhibitor Activity Using a Transgenic Mouse Model
[0751] The in vivo activity of the RNA inhibitors listed in Table 22-1 was investigated. Fifty-five male hAPOC3 Tg mice, 6-8 weeks old, were randomly divided into two groups: the drug-treated group (Ky-12-DS23001, Ky-12-DS25001, Ky-12-DS25401, Ky-12-DS29701, Ky-12-DS29801, Ky-12-DS31705, Ky-12-DS33001, and Ky-12-DS31701) and the saline group. After acclimating the mice for 2-3 days, blood was collected from the mice while fasting, and serum was isolated to measure hAPOC3 protein, TG, TC, and LDL-c levels. The mice were randomly divided into groups based on TG levels, with 5 mice per group. The day of administration was defined as Day 0. Three dose groups of Ky-12-DS31701 were investigated. On Day 0, 1 mg / kg, 3 mg / kg, and 6 mg / kg were administered subcutaneously. The other groups were administered 3 mg / kg by subcutaneous injection. Blood was collected on Days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, and 77 after administration to measure hAPOC3, TC, TG, and LDL-c levels. The measured results were normalized (see Example 13 for calculation method). The normalized hAPOC3, TC, TG, and LDL-c interference effects are shown in Table 1. Figure 7 、 Figure 8 、 Figure 9 and Figure 10 .
[0752] The experimental results showed that the RNA inhibitors investigated in this example had varying degrees of effects on hAPOC3 expression and TC, TG, and LDL-c levels in the serum of hAPOC3 Tg mice, with significant and sustained effects on hAPOC3 expression and TG levels. At a dose of 3 mg / kg, Ky-12-DS25401 reduced TG levels by as much as 89.89% by Day 35, and by Day 77, the reduction remained above 50%. This example also investigated the dose-effect relationship of the RNA inhibitor Ky-12-DS31701 on hAPOC3 expression and TC, TG, and LDL-c levels. The results showed a significant dose-effect relationship for this RNA inhibitor on TG levels. By Day 14, 1 mg / kg, 3 mg / kg, and 6 mg / kg doses reduced TG levels by 84.21%, 88.98%, and 95.06%, respectively.
[0753] Example 15 Evaluation of RNA Inhibitor Activity Using the Cynomolgus Monkey Model
[0754] High-fat cynomolgus monkeys, male, 15, 3 in each group, drug-treated groups (Ky-12-DS31701, Ky-12-DS31712, Ky-12-DS31711 and Ky-12-DS33001) and saline groups, after 2 weeks of adaptive feeding, were randomly divided into groups according to TG levels and subcutaneously administered on the day of grouping, 4 mg / kg. Blood was collected from the saphenous vein or cephalic vein at the following time points: Day 0 and Days 7, 14, 21, 28, 35, 42, 49, 56 and 63 after drug administration. APOC3, TC, TG, HDL-c and LDL-c levels were measured, and the measured results were normalized. The interference effects of normalized APOC3, TG, HDL-c, LDL-c and TC are shown in Figure 2. Figure 11 、 Figure 12 、 Figure 13 、 Figure 14 and Figure 15 On Day 28 and Day 63, additional liver biopsies were performed on the cynomolgus monkeys in the Ky-12-DS31701-treated group, and liver tissue was extracted. The APOC3 mRNA level in the liver of the cynomolgus monkeys was measured by RT-qPCR, and the test results were normalized.
[0755] The results showed that the RNA inhibitors Ky-12-DS31701, Ky-12-DS31712, Ky-12-DS31711, and Ky-12-DS33001 significantly inhibited APOC3 expression in cynomolgus macaque serum. Ky-12-DS31701 and Ky-12-DS33001 reduced triglyceride levels by 84.01% and 81.15%, respectively. TC and LDL-c levels also decreased to varying degrees, while HDL-c levels increased significantly. These compounds demonstrated significant and sustained inhibitory effects on APOC3 expression and triglyceride levels, with Ky-12-DS31701 maintaining a 75.48% reduction in triglyceride levels as early as Day 63. On Day 28 and Day 63, liver biopsies were performed on cynomolgus monkeys in the Ky-12-DS31701-treated groups. Liver tissue was extracted and APOC3 mRNA levels in the monkey livers were measured by RT-qPCR. The test results were normalized using the normalization calculation method described in Example 13. The test results showed that Ky-12-DS31701 inhibited APOC3 mRNA levels in cynomolgus monkeys by 91.65% and 87.23%, respectively, with the highest individual inhibition rate reaching 95%.
[0756] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solutions obtained by equivalent replacement or equivalent transformation fall within the scope of protection of the present invention.
Claims
1. An RNA inhibitor for inhibiting APOC3 gene expression or a pharmaceutically acceptable salt thereof, characterized in that: The structure of the RNA inhibitor is shown in Formula Ia: Wherein, the sense strand and antisense strand described in Formula Ia are as follows: Sense strand 5'→3' Antisense strand 5'→3' GsAsGCGACAfGfUfAUUCUCAGUsGsU AsfCsAfCUfGAfGAAUACfUGfUCfGCsfUsC Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate, Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidylate, fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidylate, The structure of the 5'MVIP coupled to the 5' end of the sense strand is 5'MVIP09 as shown below, and the structure of the 3'MVIP coupled to the 3' end of the antisense strand is 3'MVIP09 as shown below:
2. Use of the RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1 in the preparation of a medicament for treating cardiovascular and cerebrovascular diseases, characterized in that: The cardiovascular and cerebrovascular disease is hyperlipidemia.
3. The use according to claim 2, characterized in that The hyperlipidemia is hypertriglyceridemia or familial chylomicronemia syndrome.
4. The use according to claim 3, characterized in that The hypertriglyceridemia is severe hypertriglyceridemia.
5. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the RNA inhibitor according to claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, and the pharmaceutical composition is an oral preparation, an intravenous injection, or a subcutaneous or intramuscular injection.
6. The pharmaceutical composition according to claim 5, characterized in that The pharmaceutical composition is a subcutaneous injection.