SNP molecular marker, primer and application located in the SNP of ifitm1 gene associated with porcine metritis

Abstract

This invention relates to the field of pig selective breeding technology, and particularly to a SNP molecular marker, primers, and applications related to the IFITM1 gene and inter-sex disease in pigs. The nucleotide sequence of this molecular marker is SEQ ID NO:1, and the 32nd base Y in the nucleotide sequence of the SNP molecular marker is a polymorphic site. At this polymorphic site, individuals with genotypes TT and TC exhibit inter-sex disease characteristics, while individuals with genotype CC do not exhibit inter-sex disease characteristics. The SNP molecular marker is located in the second exon of the IFITM1 gene on pig chromosome 2. This SNP molecular marker is closely related to the inter-sex disease trait in pigs. By detecting the SNP site using the primers disclosed in this invention, individuals carrying the pathogenic gene can be screened for use in breeding selection of pigs to prevent the spread of inter-sex diseases in pigs.

Description

Technical Field

[0001] This invention relates to the field of pig selective breeding technology, and in particular to a molecular marker, primer, and application of an inter-sex disease-related SNP located in the IFITM1 gene. Background Technology

[0002] In the introduction of pig breeds or the promotion of semen, exporters are often required to identify the breeders on their pedigrees or state in the sales contract that the breeding pigs are free of genetic defects. However, due to the fact that carriers of pig genetic defects do not exhibit phenotypic traits, it is impossible to effectively eradicate heterozygotes or determine the cause of the genetic defect, leading to a bottleneck in breeding efforts. Furthermore, interspecific diseases in pigs are genetic defects that seriously affect the quality of breeding stock, occurring primarily in imported Landrace, Large White, and their crossbred commercial pigs. This represents a significant technical bottleneck in pig breeding in my country and globally. In addition, the similarities between pigs and humans in anatomical size and structure, physiology, immunology, and genome enhance their potential as human models. Therefore, interspecific diseases in pigs can also provide valuable reference for related human diseases.

[0003] Disorder of sex development (DSD) is a disease caused by congenital genetic factors, resulting in differences in the phenotype of external genitalia and the chromosomes inherited by the individual. In most pig breeds with intersex conditions, they possess a normal female chromosome structure (38,XX) and do not contain the sex-determining region Y (SRY-). Their gonads develop into ovotestis (OT) or immature testis (Testis (T)). This disease is called porcine 38,XX-OT / T-DSD (SRY-). XX-OT / T-DSD (SRY-) is an autosomal genetic disease with an incidence rate of approximately 0.1% to 0.6% in different pig populations, but it can reach as high as 20% in some isolated inbred groups. Intersex pigs not only cause infertility but also lead to decreased growth and development, reduced survival rates, and a lower carcass grade due to the boar's strong odor. They also exhibit a certain degree of aggression, severely restricting the production of high-quality breeding pigs in my country and the world. Currently, my country's pig farming mainly adopts intensive farming methods, with extensive use of artificial insemination for breeding and preservation, leading to an increased risk of intersex disease in pigs. If molecular screening of artificially inseminated boars or their semen can be performed to prevent the amplification and transmission of intersex diseases through artificial insemination (1 (♂): 80~200 (♀) ratio), it can help eliminate the harm caused by intersex pigs and ensure the supply of high-quality breeding pigs in my country. Preventing intersex diseases can effectively improve the economic benefits of pig farms. Currently, the genetic patterns and molecular etiologies of intersex diseases are not fully understood; exploring the causes of intersex diseases in pigs is of great significance for reducing disease incidence. This invention uses high-throughput sequencing technology and molecular biology methods to identify the pathogenic genes of intersex diseases in pigs, and the development of molecular markers will help prevent the occurrence of intersex diseases in pig herds.

[0004] Single nucleotide polymorphisms (SNPs), as a third-generation molecular marker technology, possess characteristics such as co-dominance, automated detection, and rich genetic diversity, and are widely used in the typing and identification of diseases in medicine and animals. Currently, in the study of mammalian XX-DSD, several SNPs associated with XX-DSD have been reported, such as the homozygous mutation c.332G>A (p.cys11tyr) in the furin-like cysteine-rich domain-2 (FU-CRD2) of the human R-spondin1 (Rspo1) gene, and the homozygous mutation c.43_43delA (p.Thr15Argfs*77) in the RSPO1 gene, both of which are associated with 46,XX-DSD. Heterozygous missense mutations in the human Wnt family member 4 gene (WNT4) can lead to varying degrees of masculinization in 46,XX women, including androgen excess and Müllerian duct dysplasia, while homozygous mutations in WNT4 can cause 46,XX-DSD. Studies have found that heterozygous mutations in the c.274C>T (p.Arg92Trp) gene of nuclear receptor subfamily 5 group A member 1 (NR5A1; also known as steroidogenic factor-1, SF1) cause SF1 to suppress the function of key molecules in female differentiation, such as β-catenin. Missense mutations in the nuclear receptor subfamily 0 group B member 1 gene (NR0B1) cause human 46,XX-OT / T-DSD. In 46,XX-T-DSD (SRY-) patients, a heterozygous frameshift mutation was found in the Wilms tumor-associated gene 1 (WT1). Analysis using a crystallographic model revealed this mutation to be a destructive one, leading to inactivation of the fourth zinc finger (ZF4) region of the WT1 protein. Subsequently, Eozenou et al. further identified five heterozygous mutations in the WT1 gene: p.Ser478Thrfs*17, p.Pro481Leufs*15, p.Lys491Glu, p.Arg495Gln, and p.Arg495Gly.These mutations upregulate the expression of testicular Sertoli cell-related transcription factors in human ovarian cells, and WT1Arg495Gly / Arg495Gly female mice initiate testis formation in XX individuals, contributing to 46,XX-OT / T-DSD. In studies of porcine XX-OT / T-DSD (SRY-), Rousseau et al. found an increased haplotype frequency containing nine SNPs in XX-DSD pigs, with the most significant association being with the SNP rs81341093 (M1GA0024789), located approximately 148 kb downstream of SOX9. However, subsequent studies found no association between this site and porcine XX-OT / T-DSD. Therefore, further investigation is needed to identify SNP markers closely related to porcine XX-OT / T-DSD.

[0005] Previous studies have shown that interferon-inducible transmembrane protein families (IFITMs) play important roles in inhibiting cell proliferation, promoting homocellular adhesion, and mediating germ cell development. The gonad is formed by both germ cells and somatic cells. Primitive germ cells from the ectoderm actively migrate to the gonads differentiated from the mesoderm, forming the gonadal ridge. Primitive germ cells belong to the germ cell lineage, and their migration plays a crucial role in their survival and differentiation; defects in primordial germ cell migration can lead to infertility. Among them, the interferon-inducible transmembrane protein-1 (IFITM1) gene has anti-proliferative and homocellular adhesion-promoting effects, and its expression during embryonic development promotes organ development. In zebrafish and rats, IFITM initially exhibits a dynamic spatiotemporal expression pattern during gastrulation and early organogenesis. IFITM1 is expressed in the proximal epithelium, ectoderm, mesoderm, and primordial germ cells. Subsequently, IFITM1 is expressed only in the perimesoderm and not in primordial germ cells, indicating that mouse IFITM1 is necessary for the migration of primordial germ cells from the mesoderm to the endoderm and plays an important role in organogenesis. Furthermore, as a downstream target of the WNT / β-catenin signaling pathway, IFITM1 interference can cause embryonic malformations. However, there are currently no reports on the association between the IFITM1 gene and porcine interstitial sexually transmitted diseases (STDs). Therefore, this invention investigates the IFITM1 gene and provides a molecular marker of the IFITM1 gene associated with porcine STDs and its primers. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker, primers, and applications of a SNP located in the IFITM1 gene associated with interstitial sexually transmitted diseases (STDs) in pigs. This SNP molecular marker is closely related to STD traits in pigs. By detecting the SNP site using the primers disclosed in this invention, individuals carrying pathogenic genes can be screened for breeding selection of pigs to prevent the spread of STDs in pigs.

[0007] To achieve this objective, the present invention adopts the following technical solution:

[0008] A SNP molecular marker associated with interstitial sexually transmitted diseases (ISDs) in the IFITM1 gene is disclosed. The nucleotide sequence of the molecular marker is SEQ ID NO:1. The 32nd base Y in the nucleotide sequence of the SNP molecular marker is a polymorphic site. At this polymorphic site, individuals with genotypes TT and TC exhibit ISD characteristics, while individuals with genotype CC do not exhibit ISD characteristics. The SNP molecular marker is located in the second exon of the IFITM1 gene on chromosome 2 of pigs.

[0009] Specifically, the nucleotide sequence SEQ ID NO:1 of the SNP molecular marker associated with interstitial sexually transmitted diseases in the IFITM1 gene is: GCGAGGGACCGGAAGATGGTGGGAGACATCAY(T / C) TGGGGCCCAGAGCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCTCTGATCCTGGGCCTCATTCTGACCATCGGAGCCACTGTTCTTCTGGTGTTTGTATACATAACAGCCTACCATATGTTAGAGCGCGCAAAGAGTAACAGAGGCTACTAG.

[0010] According to an embodiment of the present invention, individuals with genotypes TT and TC at the polymorphic site of the SNP molecular marker exhibit intersex disease characteristics; individuals with genotype CC at the polymorphic site of the SNP molecular marker have normal sex development. Therefore, this SNP molecular marker is closely associated with the occurrence of 38,XX-DSD pigs. Specifically, at the polymorphic site of this SNP molecular marker, a mutation leads to a mutation from base C to base T, that is, the polar amino acid threonine (Thr) becomes the nonpolar amino acid isoleucine (IIe), and the missense mutation leads to abnormalities in the pig herd. In breeding pigs, individuals with genotypes TT and TC of this SNP molecular marker are excluded to prevent the occurrence of intersex disease in the breeding pig herd. Therefore, the SNP molecular marker located in the IFITM1 gene that is associated with intersex disease in pigs has the advantages of early screening, time saving, low cost, and high accuracy in breeding pigs.

[0011] This invention also provides primers for a SNP molecular marker located in the IFITM1 gene that is associated with porcine interstitial sexually transmitted diseases. These primers are used to amplify the aforementioned SNP molecular marker located in the IFITM1 gene and associated with porcine interstitial sexually transmitted diseases. The primers include an upstream primer and a downstream primer.

[0012] Upstream primer F1: 5'-TCACCCTTGGGACTCAGACC-3',

[0013] Downstream primer R1: 5'-AGTGTGGATGGTGGGGGGAC-3'.

[0014] According to an embodiment of the present invention, the DNA of the test breeding pig is amplified by PCR using the above primers to amplify the target SNP molecular marker fragment. The amplification is then verified by gel electrophoresis. If successful, the sample is sent for Sanger sequencing. The genotype of the mutation site is determined based on the sequencing results, effectively identifying whether the breeding pig carries the pathogenic gene. Therefore, the primer pair used to detect the above SNP molecular marker can be effectively used for early screening of breeding pigs, i.e., breeding pig selection, thereby assisting in the early, short-term, low-cost, and highly accurate screening of superior breeding pig breeds.

[0015] The technical solution provided by this invention may include the following beneficial effects:

[0016] This invention utilizes high-throughput 10×Genomics (60×) sequencing technology combined with de novo assembly for genomic variation detection. Compared to resequencing, this method overcomes multiple alignment problems, exhibits higher specificity, and demonstrates greater sensitivity for detecting highly variable regions, thus capturing more and more reliable SNP information. This allows for the acquisition of SNP molecular markers associated with inter-species sexually transmitted diseases (SSDs) located in the IFITM1 gene. Applying these molecular markers to selective breeding of pigs, using molecular techniques to screen and eliminate suspected harmful individuals, helps prevent the occurrence of SSDs in pig herds, thereby achieving the goal of optimizing the breeding stock. The individuals selected for this screening are not limited by age or sex.

[0017] In this invention, PCR-RFLP is used to identify SNP molecular markers. The mutation sites of nucleotides in SNP molecular markers are enzyme cleavage sites. The genotype of the tested individual can be obtained based on the electrophoresis results. This method is convenient, quick, and highly sensitive for use in pig breeding, and the detection results are more intuitive. Attached Figure Description

[0018] Figure 1 This is the sequencing peak diagram in Example 1 of the present invention;

[0019] Figure 2 This is a schematic diagram of the recognition site of the restriction endonuclease in Example 3 of the present invention;

[0020] Figure 3 This is an electrophoresis result diagram from Embodiment 3 of the present invention. Detailed Implementation

[0021] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0022] Example 1: Screening of SNP molecular markers

[0023] DNA was extracted and quality-tested from ear tissues of two XX-DSD pigs and one normal sow to detect the absence of the SRY gene before genome sequencing. 10× Genomics sequencing technology was then used at a sequencing depth of 60× to perform de novo assembly and variant analysis. Trimmomatic v0.38 software was used to filter the sequencing data, and SOAP-denovo sequencing data was assembled. BUSCO software was used to evaluate the genome assembly. Long sequence fragments were obtained from the SOAP-denovo assembly and aligned with a reference genome (Sscrofa 11.1) using Lastz software to obtain corresponding SNP sites.

[0024] Screening was conducted according to the autosomal recessive inheritance pattern, using normal sows as controls and comparing them with XX-DSD pigs. SNP sites were screened from non-synonymous mutations. The obtained SNP sites were analyzed using GO and KEGG, and further analyzed in conjunction with existing transcriptome sequencing data. The analysis results revealed an SNP site located at nucleotide 32 of the second exon of the IFITM1 gene on porcine chromosome 2, exhibiting T / C polymorphism, thus causing polymorphism in the sequence of the second exon of the IFITM1 gene, as described in SEQ ID NO:1.

[0025] The SEQ ID NO:1 sequence of the SNP molecular marker described in this invention is as follows:

[0026] GCGAGGGACCGGAAGATGGTGGGAGACATCAY(T / C)TGGGGCCCAGAGCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCTCTGATCCTGGGCCTCATTCTGACCATCGGAGCCACTGTTCTTCTGGTGTTTGTATACATAACAGCCTACCATATGTTAGAGCGCGCAAAGAGTAACAGAGGCTACTAG.

[0027] The SNP site (polymorphic site) of the SNP molecular marker described in this invention is located at the 32nd base Y in the above sequence and has a nucleotide polymorphism of T or C. In XX-DSD pigs, the SNP site is T or heterozygous TC; in normal sows, the SNP site is C. Therefore, based on the important role of the IFITM1 gene in mediating germ cell development, it is speculated that mutations in IFITM1 interfere with WNT / β-catenin signaling or cause migration errors in primordial germ cells, thereby leading to developmental abnormalities in XX-DSD pigs. Furthermore, it is speculated that the SNP site may be related to the occurrence of interspecific sexually transmitted diseases (ISDs) in pigs and can be used as an SNP molecular marker for preventing ISDs in breeding work.

[0028] Example 2: Expanding the population to verify the above-mentioned SNP molecular markers

[0029] Because XX-DSD is a rare congenital disease, ear tissue was collected from 32 normal sows and 32 XX-DSD sows to extract DNA. Based on the SNP molecular markers of this invention, specific primers F1 and R1 were designed for SNP marker PCR detection. The PCR products were sent to Shanghai Sangon Biotech for Sanger sequencing to analyze the distribution of SNP marker genotypes in XX-DSD pigs and normal sows. The specific operating steps of this embodiment are as follows:

[0030] (1) Primer design: Based on the polymorphism information of SNP molecular markers, specific primer pairs were designed. The nucleotide sequences of upstream primer F1 and downstream primer R1 are as follows:

[0031] Upstream primer F1: 5'-TCACCCTTGGGACTCAGACC-3',

[0032] Downstream primer R1: 5'-AGTGTGGATGGTGGGGGGAC-3'.

[0033] (2) Using the DNA extracted from XX-DSD pigs and normal sows as templates, PCR amplification was performed using the specific primer pairs designed above. The PCR reaction system was prepared as shown in Table 1, and the total volume of the reaction system was 20.0 μL. The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 35 cycles, each cycle including 95℃ denaturation for 15 s, 60℃ annealing for 15 s and 72℃ extension for 1 min; 72℃ extension for 5 min.

[0034] Table 1 PCR reaction system

[0035]

[0036] (3) The amplified PCR products were detected by 1.0% agarose gel electrophoresis and then subjected to Sanger sequencing. The sequencing results were analyzed to determine the T / C polymorphism at the 32nd base of SEQ ID NO:1 and to analyze the distribution of its genotype. The sequencing peak diagram is shown below. Figure 1 As shown, sequencing analysis revealed that the TT and TC genotypes at position 32 of SEQ ID NO:1 are unique to XX-DSD pigs, with the TT genotype frequency at 87% and the TC genotype frequency at 13%. Meanwhile, the CC genotype at position 32 of SEQ ID NO:1 only appeared in normal sows. The mutation at this SNP site resulted in the polar amino acid threonine (Thr) being replaced by the nonpolar amino acid isoleucine (IIe).

[0037] As demonstrated by the expanded population validation above, the specific primer pair of this invention can accurately validate SNP molecular markers associated with interstitial sexually transmitted diseases (STDs) located in the IFITM1 gene, exhibiting high reliability. When applied to final breeding, the specific primer pair of this invention can accurately screen for breeding pigs carrying pathogenic genes. Specifically, in breeding work, pigs with the TT and TC genotypes at the SNP site are excluded and cannot be used as parents; instead, pigs with the CC genotype are selected for breeding, effectively preventing the spread of STDs in pigs.

[0038] Example 3: Method for detecting SNP sites of SNP molecular markers

[0039] This invention employs a PCR-RFLP method to detect SNP sites on SNP molecular markers. PCR-RFLP (Restriction Fragment Length Polymorphism Polymerase Chain Reaction) is a technique used when amplifying target materials with specifically designed PCR primers. Due to the scarcity of base mutations, insertions, or deletions at specific sites, polymorphism may not be observed. Therefore, it is often necessary to digest the corresponding PCR amplification fragments with enzymes to detect their polymorphism. That is, based on the position and number of restriction endonuclease recognition sequences, DNA with similar sizes but different sequences can be cut into different fragments. By nucleic acid electrophoresis, DNA fragments of different lengths can be separated to reveal their size.

[0040] In this embodiment, the restriction endonuclease BsrⅠ is identified by searching the sequence SEQ ID NO:1 using SnapGene software. BsrⅠ can be recognized when the 32nd base of SEQ ID NO:1 is C; it cannot be recognized when the 32nd base of SEQ ID NO:1 is T. The recognition sequence for BsrⅠ is as follows: Figure 2 As shown in the figure, the arrows indicate the restriction endonuclease BsrⅠ cleavage sites, and "N" represents any deoxyribonucleotide.

[0041] The fragments amplified by the upstream primer sequence F1 and the downstream primer sequence R1 in Example 2 were subjected to enzyme digestion analysis. The enzyme digestion preparation system is shown in Table 2, and the total reaction volume was 25.0 μL. After incubating the mixture at 65 ℃ in a water bath for 1.5 h, gel electrophoresis was performed.

[0042] Table 2 Enzyme digestion reaction system

[0043]

[0044] In this embodiment, the above-mentioned enzyme digestion system was subjected to 2.0% agarose gel electrophoresis at 120 V for 50 min. The electrophoresis results are as follows. Figure 3 As shown in the electrophoresis images, the PCR amplification products of individuals with the CC genotype showed two bands, 344 bp and 199 bp; the PCR amplification products of individuals with the TC genotype showed three bands, 543 bp, 344 bp, and 199 bp; and the PCR amplification products of individuals with the TT genotype showed one band, 543 bp. It is evident that genotyping can be obtained directly from the electrophoresis results. The SNP molecular markers and primers of this invention are convenient, quick, highly sensitive, and provide more intuitive detection results when applied to pig breeding.

[0045] The molecular marker, primers, and other components and operations of the SNP associated with interstitial sexually transmitted diseases in the IFITM1 gene according to embodiments of the present invention are known to those skilled in the art and will not be described in detail here.

[0046] In the description of this specification, references to terms such as "embodiment," "example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0047] Although embodiments of the invention have been shown and described, those skilled in the art will understand that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

Claims

1. Primers for a SNP molecular marker located in the IFITM1 gene associated with porcine interstitial sexually transmitted diseases (SSTDs) for breeding pigs resistant to SSTDs, characterized in that: The nucleotide sequence of the molecular marker is SEQ ID NO:1, and the 32nd base Y in the nucleotide sequence of the SNP molecular marker is a polymorphic site; at this polymorphic site, individuals with genotypes TT and TC exhibit interstitial disease characteristics, while individuals with genotype CC do not exhibit interstitial disease characteristics. The SNP molecular marker is located in the second exon of the IFITM1 gene on pig chromosome 2; The SNP molecular marker is used in pig breeding to screen individuals with the genotype CC of the SNP molecular marker as breeding parents.

2. Primers for a SNP molecular marker located in the IFITM1 gene associated with porcine interstitial sexually transmitted diseases (STDs) for breeding pigs resistant to STDs, characterized in that: The primers are used to amplify the SNP molecular marker associated with porcine interstitial sexually transmitted diseases located in the IFITM1 gene, and the primers include an upstream primer and a downstream primer: Upstream primer F1: 5'-TCACCCTTGGGACTCAGACC-3', Downstream primer R1: 5'-AGTGTGGATGGTGGGGGGAC-3'.

Images