Method and kit for detecting expression of Caspase-6 alleles in the first generation of hybrids of crucian carp and carp

Abstract

The present invention discloses a method for detecting the expression of Caspase‑6 alleles in the first generation of a hybrid of crucian carp and a kit thereof. The detection method comprises: (1) RNA reverse transcription; (2) PCR amplification; (3) pyrophosphate sequencing, and the result analysis is used to obtain the expression ratio of the Caspase‑6 alleles in the hybrid of crucian carp F1. The present invention uses Caspase‑6‑F: 5'‑AGATGGACCACAAGAAACGAGG‑3'; Caspase‑6‑BR: 5'‑CATAAGCCTTCACTTCAAATCCC‑3' as specific primers to analyze the expression results of the Caspase‑6 alleles in the first generation of a hybrid of crucian carp. The present invention has the advantages of simple operation, low cost and is suitable for rapid detection of a large number of samples. The pyrophosphate sequencing method adopted by the present invention identifies the expression changes of the parent Caspase‑6 genotype in the hybrid of crucian carp F1, and the detection results can not only qualitatively characterize the differential bases, but also can be quantitatively analyzed, and the detection results can also be observed in real time, and the detection results can be quickly issued.

Description

Technical Field

[0001] The invention belongs to the field of biochemistry and molecular biology, and in particular relates to a detection method and a kit for the expression of apoptosis-related gene Caspase-6 alleles of the first generation of crucian carp hybrids. Background Art

[0002] Apoptosis is a basic biological phenomenon of cells and an important component of biological evolution, internal environment stability and the development of multiple systems. By activating the conserved apoptotic signaling pathway, damaged cells or unnecessary cells after differentiation are eliminated during embryonic development, tissue remodeling and immune regulation. The caspase protein family plays an important role in these apoptotic pathways. Among them, Caspase-6, one of the executors of apoptosis, can directly act on specific substrates to complete the apoptotic reaction. Caspase-6, as an important member of the caspase family involved in the apoptotic reaction, has rarely been reported in fish. Red crucian carp (Carassius auratus red var.) and common carp (Cyprinus carpio) are important freshwater economic fish. By collecting embryos of hybrid crucian carp F1, the role of Caspase-6 in the embryonic development of F1 was studied, revealing that the lower fertility in F1 is closely related to the expression of key genes in the apoptotic pathway.

[0003] Heterosis refers to the fact that hybrid offspring may inherit superior genetic material from their parents and obtain biological characteristics that are superior to their parents. This situation often applies to plant hybridization. In animals, especially lower vertebrates, during embryonic development, the hybrid offspring are accompanied by cell apoptosis and evolution, and the F1 population is partially fertile and the fertility is reduced. Studies have shown that caspase 6 promotes the activation of programmed cell death pathways. Therefore, the expression regulation of key genes is the key mechanism leading to partial fertility in fish. In hybrid offspring, genome selective expression is one of the key mechanisms for the generation of heterosis in hybrid combinations. In a hybrid triploid Squalius alburnoides, multiple genes are allelically silenced, and the proportion of allelic silencing is different in different tissues. In Amazon killifish (Poecilia formosa), androgen receptor α has obvious biased expression in the ovary, while there is no difference in the selective expression of the parental genome in the brain and gills. In the hybridization and backcrossing studies of Xiphophorus, allele expression is related to its body color. Therefore, in hybrid fish, allele expression is involved in the expression of heterosis. However, due to technical bottlenecks, research methods for allele expression in farmed hybrid fish have yet to be developed.

[0004] Hybrid crucian carp F1 is a new breed obtained by distant hybridization of red crucian carp (Carassius auratus red var.,♀, abbreviated as RCC) and common carp (Cyprinus carpio,♂, abbreviated as CC). Currently, there are three fertile hybrid populations, and the stable hereditary strains obtained by hybridization of crucian carp and common carp have been widely cultivated in southern China. Hybrid crucian carp F1 has overcome reproductive difficulties and provided valuable materials for distant hybridization to break through reproductive isolation. Therefore, it can also be used as a research model for studying the formation of new species after hybridization. Elucidating allele expression will provide a new window for exploring the formation mechanism of hybrid vigor. By studying the Caspase-6 sequences of the red crucian carp and common carp hybrid fish parents, and developing allele expression detection methods and kits, we can not only understand the role of Caspase-6 in the embryonic development of crucian carp F1, but also have significance for future allele research and development of molecular markers in hybrid fish breeding.

[0005] The commonly used methods for traditional allele expression detection are mainly based on the abundant SNPs and InDels variation sites between parents. The main methods include allele-specific PCR (AS-PCR) and TaqMan technology. AS-PCR is a method in which specific PCR primers are designed based on SNP or InDels variation sites, and the 3' end is complementary or mismatched with these differential sites, and can identify allele expression by agarose gel electrophoresis to determine whether there are target bands. The technical implementation scheme includes: 1. Design primers for key differential sites, and one end of the primer must be at the 3' end to ensure sequence complementarity or mismatch; 2. Obtain normal amplification products through PCR amplification; 3. Detect allele expression through agarose gel electrophoresis. TaqMan technology uses a TaqMan probe (composed of FAM TM or Dye labeling, its 3' end combines a minor groove binder and a non-fluorescent quenching group), and the allele expression is detected by the fluorescence brightness of the probe. Its technical implementation scheme includes: 1. Designing TaqMan amplification primers and TaqMan probes; 2. Amplification on a real-time quantitative PCR instrument, and using a machine to obtain the fluorescence value, and using two alleles of genomic DNA as a 1:1 correction internal reference; 3. Calculating the expression ratio of differential sites based on the fluorescence value. The defects of these two methods are: 1. The TaqMan detection method is costly, and this method relies on fluorescence quantitative PCR, in which the fluorescence quantitative reagent is relatively expensive; 2. AS-PCR requires agarose gel electrophoresis detection, which is cumbersome to operate, has low detection efficiency, and is time-consuming and labor-intensive.

[0006] Therefore, studying more appropriate pyrosequencing technology to analyze the detection method and kit of Caspase-6 alleles in Crucian Carp F1 will be of great significance to improving detection efficiency and reducing detection costs. Summary of the invention

[0007] In view of the problems existing in the prior art, such as the high cost of TaqMan detection method and the low efficiency of AS-PCR detection, the present invention develops a set of crucian carp F1Caspase-6 allele expression technology with simple operation and low cost by using pyrophosphate sequencing method.

[0008] The present invention is achieved through the following technical solutions:

[0009] A primer for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1 is:

[0010] Caspase-6-F: 5'-AGATGGACCACAAGAAACGAGG-3';

[0011] Caspase-6-BR: 5'-CATAAGCCTTCACTTCAAATCCC-3'.

[0012] The primers of the invention are used in preparing a hybrid crucian carp F1 Caspase-6 allele expression detection reagent.

[0013] A kit for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1 comprises Caspase-6-F and Caspase-6-BR primers.

[0014] The kit for detecting the expression of hybrid crucian carp F1 Caspase-6 alleles is characterized by comprising: 0.8 μL of cDNA, 1 μL of heat-resistant Taq enzyme, 2 μL of 50 μmol / L dNTP, 0.5 μL of 10 nM forward primer, 0.5 μL of 10 nM reverse primer, and 15.2 μL of sterile water.

[0015] The method for detecting the expression of Caspase-6 allele in hybrid crucian carp F1 comprises the following steps:

[0016] (1) RNA reverse transcription: Take the F1 embryos of crucian carp and common carp, extract the RNA of the embryos, and reverse transcribe the extracted RNA into template cDNA;

[0017] (2) PCR amplification: using the cDNA obtained in step (1) as a template and Caspase-6-F and Caspase-6-BR as specific primers to perform PCR amplification reaction to obtain the nucleic acid fragment to be tested;

[0018] The forward primer sequence Caspase-6-F: 5'-AGATGGACCACAAGAAACGAGG-3';

[0019] The reverse primer sequence Caspase-6-BR: 5'-CATAAGCCTTCACTTCAAATCCC-3';

[0020] (3) Pyrophosphate sequencing reaction: the nucleic acid fragment to be tested obtained in step (2) is transferred into an annealing buffer solution containing sequencing primers, and a pyrophosphate sequencing reaction is performed, and then the results are analyzed to obtain the expression ratio of the Caspase-6 allele in the hybrid crucian carp F1; the sequencing primer Caspase-6-FS: 5'-ACCCAAGGTTAGTAGCAG-3'.

[0021] The 20 mL volume of the above PCR amplification system includes:

[0022]

[0023] As a preferred technical solution, the conditions for PCR amplification are: first pre-denaturation at 95°C for 5 minutes; then cycle denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, denaturation at 72°C for 30 seconds, and this cycle for 30 times, and finally final extension at 72°C for 10 minutes.

[0024] Beneficial effects of the present invention:

[0025] (1) The crossbred crucian carp and common carp F1 Caspase-6 allele primers designed by the present invention have good specificity, high sensitivity, strong stability, simple operation, low detection cost, and are suitable for rapid detection of a large number of samples.

[0026] (2) The present invention uses pyrophosphate sequencing to identify the expression changes of parental Caspase-6 genotypes in hybrid crucian carp F1. The detection results can not only qualitatively identify the differential bases, but also quantitatively. The detection results can also be observed in real time, and the detection results can be quickly issued. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of the differential sites in the Caspase-6 gene sequence of the F1 fish parents (carp and carp), where CC represents carp and RCC represents carp. The differential sites are marked with a yellow background in the figure.

[0028] Figure 2 This is a graph of allele expression levels of the Caspase-6 gene sequence of 14 crucian carp F1 fish of the present invention.

[0029] Figure 3 This is a graph showing the results of the Caspase-6 allele expression detection of 14 crucian carp F1 fish of the present invention. DETAILED DESCRIPTION

[0030] The present invention is illustrated by the following examples, but is not intended to limit the scope of use of the present invention.

[0031] Example 1

[0032] Analysis of allele expression of Caspase-6 gene sequence in 14 F1 fish of crucian carp and carp

[0033] 1. Obtaining template cDNA

[0034] Take 5 mg of crucian carp F1 embryos, freeze them in liquid nitrogen and crush them in a mortar. Use RNA trizol to extract total RNA from the embryos. Use a spectrophotometer to measure the purity and concentration of total RNA, and use 1.2% agarose gel electrophoresis to check whether RNA is degraded. 1 μg of the extracted RNA sample, reverse transcriptase, dNTP, Oligo (dT) 12-18 The mixture was reverse transcribed into cDNA under the following reaction conditions: 42°C for 30 min, 70°C for 5 min.

[0035] 2. PCR Amplification and Gel Recovery

[0036] Place the cDNA sample to be tested in a PCR tube, use cDNA as a template, and use Caspase-6-F and Caspase-6-BR as specific primers for PCR amplification to obtain the nucleic acid fragment to be tested. 0.8 μL of each cDNA sample, then add 18.2 μL of the reaction solution. After mixing and centrifugation, place the PCR reaction system on a common PCR instrument, and the reaction conditions are: 94℃5min pre-denaturation, followed by 30 cycles, including 94℃30s, 60℃30s, 72℃30s, and finally 72℃ final extension for 10min.

[0037] The 20 mL volume of the above PCR amplification system includes:

[0038]

[0039] 3. Pyrosequencing reaction

[0040] Add 40 μL of annealing buffer containing 0.5 μM sequencing primer (Caspase-6-FS) to the PSQ 96 plate in advance; transfer 3 μL of Sepharose beads per sample to an Eppendorf tube; add binding buffer to the Sepharose beads so that the average volume of each sample is about 40 μL, and mix well; add the above mixture to the PCR product, 40 μL per sample; mix the PCR product at room temperature for 5 minutes to allow the beads to bind to biotin; in the Vacuum prep workstation, add 180 ml of high-purity water, 70% ethanol, washing buffer and denaturation buffer to each sample plate in turn; turn on the vacuum prep workstation pump and wash the vacuum prep tool in high-purity water for 30 seconds; then move the vacuum prep tool to the PCR plate and grab the Sepharose beads; put the vacuum prep tool in 70% ethanol; then move it to the denaturation buffer, and then to the washing buffer. Wash in buffer for 5-10 seconds and turn off the pump; put the Vacuum prep tool into the plate containing sequencing primers, shake to release Sepharose beads (sequencing primers can also be added last), and use high-purity water to wash the Vacuum prep tool; heat the PSQ 96 plate with samples to 80℃ for 2 minutes, and then cool to room temperature to carry out the Pyrosequencing reaction.

[0041] Table 1 List of primers used in the present invention

[0042]

[0043] 4. Data Analysis

[0044] Through sequencing and genomic data analysis, specific alleles (such as Figure 1 shown), based on Figure 1 The expression of allele Caspase-6 in hybrid offspring embryos was evaluated and detected by using 6 allele-specific loci (T / G, C / T, G / A, G / T, A / G, G / A). The expression levels of allele Caspase-6 in the 14 individuals of Example 1 were obtained by cloning and cDNA amplification to obtain pyrophosphate templates and sequencing. Figure 2As shown in Table 1, the expression ratio of the paternal parent and the maternal parent was obtained by statistical analysis using the formula (paternal parent: maternal parent = the average value of the paternal ratio of the 6 allele-specific loci: the average value of the maternal ratio of the 6 allele-specific loci). Figure 3 shown.

[0045] Table 1 Expression ratio of Caspase-6 gene sequence alleles from parents of crucian carp F1 fish

[0046]

[0047]

[0048] From Table 1 and Figure 3 It can be seen that the expression levels of allele Caspase-6 in 14 individuals generally showed an expression pattern biased towards the paternal parent (carp) in the hybrids.

[0049] The alleles of Caspase-6 detected in the present invention are based on 6 allele-specific sites (T / G, C / T, G / A, G / T, A / G, G / A). Compared with the previous detection of only a small number of allele-specific sites, the sequence amplified by the primers used in the present invention includes 6 specific sites. The verification of multiple specific sites has higher accuracy, sensitivity and stability than the detection of a small number of allele-specific sites.

[0050] Compared with other allele expression detection technologies (such as fluorescent quantitative PCR, gene chip, sequencing and other technologies), the present invention can perform quantitative analysis on differential bases and quickly obtain detection results.

Claims

1. A primer for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1, characterized in that: The primers are, Caspase-6-F: 5'-AGATGGACCACAAGAAACGAGG-3'; Caspase-6-BR: 5'-CATAAGCCTTCACTTCAAATCCC-3'.

2. Use of the primers as claimed in claim 1 in preparing a reagent for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1.

3. A kit for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1, characterized in that: The method comprises the primers described in claim 1.

4. The kit for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1 according to claim 3, characterized in that: include: cDNA 0.8μL, thermostable Taq enzyme 1μL, dNTP 50μmol / L 2μL, forward primer 10nM 0.5μL, reverse primer 10nM 0.5μL, sterile water 15.2μL.

5. A method for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1 using the primers described in claim 1, characterized in that: The steps include: (1) RNA reverse transcription: Take a tissue sample of crucian carp F1, extract RNA, and reverse transcribe the extracted RNA into template cDNA; (2) PCR amplification: using the cDNA obtained in step (1) as a template and Caspase-6-F and Caspase-6-BR as specific primers to perform PCR amplification reaction to obtain the nucleic acid fragment to be tested; The forward primer sequence Caspase-6-F: 5'-AGATGGACCACAAGAAACGAGG-3'; The reverse primer sequence Caspase-6-BR: 5'-CATAAGCCTTCACTTCAAATCCC-3'; (3) Pyrophosphate sequencing reaction: the nucleic acid fragment to be tested obtained in step (2) is transferred into an annealing buffer solution containing sequencing primers, and a pyrophosphate sequencing reaction is performed, and then the results are analyzed to obtain the expression ratio of the Caspase-6 allele in the hybrid crucian carp F1; the sequencing primer Caspase-6-FS: 5'-ACCCAAGGTTAGTAGCAG-3'.

6. The method for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1 according to claim 5, characterized in that: The PCR amplification system 20 mL comprises:

7. The method for detecting the expression of Caspase-6 alleles in hybrid crucian carp F1 according to claim 5, characterized in that: The conditions of the PCR amplification are: pre-denaturation at 95°C for 5 min; followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and denaturation at 72°C for 30 s, and this cycle is repeated 30 times, followed by final extension at 72°C for 10 min.

Images