Method for preparing a biosensor based on a laser-induced graphene electrode using hot-melt adhesive and applications thereof
By employing laser-induced graphene technology and hot melt adhesive transfer method, porous graphene structures were rapidly generated and substrate patterns were transferred, solving the problem of complex and time-consuming traditional graphene preparation. This led to the construction of a highly sensitive biosensor for rapid detection of MC-LR.
Patent Information
- Application Number
- CN202310655749.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-05
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2043-06-05
AI Technical Summary
Traditional graphene preparation methods are complex and time-consuming, which limits their application in the field of biosensing, especially the low adhesion between laser-induced graphene and polyimide substrates and the time-consuming process of transferring graphene patterns using silicone casting.
By combining laser-induced graphene technology with a hot melt adhesive transfer method, a porous graphene structure is rapidly generated using lasers, and the substrate pattern is rapidly transferred using hot melt adhesive to construct a highly sensitive biosensor.
Rapid array fabrication and precise transfer of graphene sensors were achieved, constructing a highly sensitive MC-LR detection sensor with simple operation, field application, and practical value.
Smart Images

Figure CN116858910B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biosensors, and particularly relates to a preparation method of a biosensor based on a laser-induced graphene electrode of hot melt adhesive and application thereof. BACKGROUND
[0002] In recent years, graphene materials have attracted extensive attention in the sensing field due to their high electrical conductivity and large specific surface area. However, traditional graphene production needs to be prepared by graphene epitaxial growth, liquid phase mixing stripping, chemical vapor deposition and reduced graphene oxide, and the process is quite complex. In order to obtain better sensing performance, most methods realize pattern transfer of graphene sensing substrate through PDMS casting, which is time-consuming and does not meet the demand of efficient construction of sensors.
[0003] Compared with the classical graphene preparation method, the laser-induced graphene technology can mass-produce customized graphene patterns by laser irradiation of polyimide, without any material waste and environmental hazards in the production process, and has the advantages of low cost, fast preparation, good substrate toughness, and porous and multi-layer three-dimensional graphene structure. At the same time, the low adhesion of laser-induced graphene and polyimide substrate hinders its application in the sensing field, and the commonly used silicone casting method to transfer graphene patterns is time-consuming and difficult to operate, which limits the development of graphene in the field of biosensing. Therefore, it is urgent to develop a method for preparing fast and excellent performance of graphene-based sensor construction. SUMMARY
[0004] In view of the problems of difficult preparation of graphene array and complicated substrate pattern transfer in the current construction process of graphene-based sensor, the application aims to provide a sensor preparation scheme integrating rapid production, rapid transfer and rapid detection. The method can generate porous graphene structure by laser rapid induction, and realize rapid transfer of substrate pattern. The graphene sensor obtained by the method has high sensitivity and simple and rapid preparation process.
[0005] The application achieves the application purpose through the following technical solutions:
[0006] Firstly, a preparation method of a biosensor based on a laser-induced graphene electrode of hot melt adhesive is provided, and the steps are as follows:
[0007] S1: Laser-induced graphene substrate electrode acquisition: The polyimide film is placed on the substrate material, and the surface thereof is cleaned with acetone and anhydrous ethanol in sequence. The laser is controlled to scan and write on the surface of the polyimide film directly to obtain a preset array of laser-induced graphene three-electrode substrate, wherein the three electrodes are a working electrode (WE), a reference electrode (RE) and a counter electrode (CE). Then, the power and induction rate of the laser are changed, and the surface of the laser-induced graphene three-electrode substrate is scanned and written again directly to obtain a laser-induced graphene electrode substrate after secondary processing, which is denoted as LIG;
[0008] S2: Laser-induced graphene pattern transfer module construction: First, bubbles in the EVA hot melt adhesive are removed through vacuum treatment, and then the EVA hot melt adhesive is attached to the surface of the LIG, and a PET release film and a metal pressing plate are sequentially attached above the EVA hot melt adhesive to obtain a sample denoted as LIG / EVA;
[0009] S3: Laser-induced graphene substrate transfer: The LIG / EVA obtained in step S2 is placed on a constant temperature heating table for high temperature hot melting. After hot melting, the metal pressing plate and the PET release film are removed, and after annealing at room temperature, solidification treatment is performed to transfer and fix the laser-induced graphene pattern to the EVA hot melt adhesive. Finally, the substrate and the polyimide film are sequentially separated to realize the transfer of the laser-induced graphene electrode substrate, and a transferred laser-induced graphene denoted as LIG-EVA is obtained;
[0010] S4: Synthesis of gold nanoparticles (Au NPs): Chloroauric acid and deionized water are mixed, heated to boiling in an oil bath, and a certain amount of sodium citrate solution is added dropwise into the mixed solution. Continue to heat until the solution turns wine red, and then stop heating to obtain an Au NPs solution;
[0011] S5: Preparation of tetrahedral DNA complex (TDN-cDNA-apt): Four single-stranded DNAs and an aptamer are taken, denoted as S1, S2, S3, S4 and apt, respectively. The four single-stranded DNAs and the aptamer are dissolved in TE buffer and then diluted in TM buffer to obtain five TE diluents, denoted as S1 diluent, S2 diluent, S3 diluent, S4 diluent and apt diluent, respectively. Then, tris(2-carboxyethyl)phosphine (TCEP) is added to the apt diluent to obtain an apt-TCEP diluent;
[0012] Finally, the S1 diluent, the S2 diluent, the S3 diluent, the S4 diluent and the apt-TCEP diluent are mixed in equal proportions, heated and then annealed to obtain a complex denoted as a TDN-cDNA-apt solution;
[0013] S6: sequentially modifying Au NPs solution, TDN-cDNA-apt solution, 6-mercapto-1-hexanol (MCH) solution and methylene blue (MB) solution on the working electrode area of LIG-EVA layer by layer, and electrode incubation is performed after each modification; finally, a laser-induced graphene-based biosensor for microcystin-LR (MC-LR) detection is obtained, which is recorded as LIG-EVA / Au / TDN-cDNA-apt / MCH / MB.
[0014] Preferably, in step S1, the designed graphene electrode substrate pattern includes three independent parts, which are recorded as working electrode (WE), reference electrode (RE) and counter electrode (CE), WE is located in the middle, RE and CE are arranged on both sides, the sensing area of WE is a circular area with a diameter of 4.5 mm, which is convenient for solution dispersion and modification; the sensing area of CE is an arch structure, the inner side of the arch is the sensing area of WE, which is conducive to constructing a reasonable electrolyte solution environment; each electrode can be divided into an upper sensing area and a lower wire area.
[0015] Preferably, in step S1, the thickness of the polyimide film is 80-120 μm, and the thickness of the metal copper plate used as the substrate is 1 mm.
[0016] Preferably, in step S1, the induced laser is a 10.6 μm carbon dioxide laser, the laser power and the induction rate are 3 W and 400 mm / s respectively; the changed action parameters are 3.6 W laser power and 285 mm / s induction rate.
[0017] Preferably, in step S2, the thickness of the EVA hot melt adhesive attached to the surface of LIG is 0.05-0.2 mm; the thickness of the PET release film is 0.1-0.2 mm; and the metal pressing plate is a 5 mm thick copper plate.
[0018] Preferably, in step S3, the temperature of high-temperature hot melting is controlled at 85-110℃, the hot melting time is 5-8 min; the temperature of room temperature annealing is 20-25℃, the annealing time is 8-10 min; the temperature of curing treatment is -18℃, and the curing time is 10-20 min.
[0019] More preferably, in step S3, the hot melting temperature is controlled at 85℃, the hot melting time is 5 min; the temperature of room temperature annealing is 25℃, the annealing time is 10 min; the temperature of low-temperature curing is -18℃, and the curing time is 10 min.
[0020] Preferably, in the step S4, the volume ratio of chloroauric acid, deionized water and sodium citrate solution is 0.2:25:0.25, wherein the concentration of chloroauric acid is 0.1M, and the concentration of sodium citrate solution is 100mg / mL; the heating time is 15-20min.
[0021] Preferably, in the step S5, the DNA sequences (5'-3' end) of S1, S2, S3, S4 and apt are in the following order:
[0022] S1 TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC;
[0023] S2 TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC;
[0024] S3 TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT;
[0025] S4 ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTAGTCATGGTGGTCCTGTTTGGCGCCCTCCGC;
[0026] apt SH-GCGGAGGGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGC;
[0027] Preferably, in the step S5, the concentration of S1 dilution, S2 dilution, S3 dilution, S4 dilution and apt-TCEP dilution is 10μM; wherein the final concentration of TCEP in apt-TCEP dilution is 1mM.
[0028] Preferably, in the step S5, the heating reaction condition is 95℃ for 2min; the annealing condition is 25℃ for 30-90s.
[0029] Preferably, in the step S6, the Au NPs are used to increase the conductivity of the graphene substrate, and the TDN-cDNA-apt is fixed on the sensing interface through Au-S; the TDN-cDNA-apt is used to adjust the density of the probe molecules, and the probe dye molecule MB is adsorbed through electrostatic adsorption, so as to widen the linear range of the sensor detection; the MCH is used as an active site blocking agent to block the Au NPs that are not specifically combined; and the dye molecule MB is used as a signal probe to generate an oxidation current signal.
[0030] Preferably, in the step S6, the concentration of the Au NPs solution is 6nM, the concentration of the TDN-cDNA-apt solution is 2μM, the concentration of the MCH is 1mM, and the concentration of the MB is 5μM; the modification amount of the Au NPs and the TDN-cDNA-apt is 10μL, and the modification amount of the MCH and the MB is 8μL; the incubation time after the modification of the Au NPs solution is 20-40min, and the incubation temperature is 20-25℃; the incubation time after the modification of the TDN-cDNA-apt solution is 4-12h, and the incubation temperature is 4℃; the incubation time after the modification of the MCH solution is 30-50min, and the incubation temperature is 20-25℃; and the incubation time after the modification of the MB solution is 20-100min, and the incubation temperature is 20-25℃.
[0031] The application further provides a use of a laser-induced graphene electrode biosensor based on hot melt adhesive for detecting MC-LR in water, and the steps are as follows:
[0032] S1: first, prepare MC-LR standard solutions with different concentrations, modify the working electrode surface of the LIG-EVA / Au / TDN-cDNA-apt / MCH / MB with the MC-LR standard solutions with different concentrations, incubate at room temperature for a period of time, complete the recognition of the sensing interface to MC-LR, and mark as LIG-EVA / Au / TDN-cDNA-apt / MCH / MB+MC-LR; wherein the MC-LR standard solutions with different concentrations have respective response current signal values;
[0033] S2: establish a standard test curve;
[0034] connect the LIG-EVA / Au / TDN-cDNA-apt / MCH / MB+MC-LR sensor obtained through the incubation in the step S1 with an electrochemical workstation, test the response current signal of the sensor by using a differential pulse voltammetry (DPV), and obtain a corresponding current signal marked as I MB , wherein the logarithmic value of the concentration (C MC-LR ) of the MC-LR standard solution is negatively linearly related to I MB , and I MB is related to C MC-LRThe logarithmic relationship is established to obtain a standard test curve;
[0035] S3: detection of MC-LR concentration in the unknown sample;
[0036] First, the sample liquid to be tested is obtained, a certain amount of sample liquid to be tested is modified on the LIG-EVA / Au / TDN-cDNA-apt / MCH / MB sensing interface, and after incubation at room temperature for a period of time, the electrochemical test is carried out according to the method of testing the response current signal in step S2, the response current signal is obtained and is brought into the standard test curve constructed in step S2, and then the C MC-LR of MC-LR is calculated.
[0037] Preferably, in step S1, the modification amount of the MC-LR standard solution is 10 μL, the concentration of the MC-LR standard solution is 10 fM-100 nM, and the incubation time is 10-60 min.
[0038] More preferably, the incubation time is 50 min.
[0039] Preferably, in step S2, the specific conditions of the differential pulse voltammetry test are: the scanning voltage range is-0.6-0 V, the amplitude is 0.05 V, and the pulse width is 0.05 s; the specific range is 10 fM-100 nM.
[0040] Preferably, in step S3, the sample liquid to be tested needs to be pretreated; the pretreatment operation is specifically: taking the sample liquid, filtering it with a stainless steel sieve, and then filtering and purifying it with a 0.22 μm filter membrane, so as to complete the pretreatment of the sample and obtain the sample liquid to be tested.
[0041] The biosensor obtained by the application has a multilayer structure, the bottom layer is a flexible hot melt adhesive layer, the middle layer is a porous graphene structure, which provides a large specific surface area substrate for sensing interface assembly and is used to improve the detection sensitivity, and the top layer is a sensing interface, which is the core layer for realizing the detection of the target object.
[0042] The application principle of the biosensor is that MC-LR and apt specifically recognize and strip the double-stranded DNA on TDN-cDNA-apt, releases TDN-cDNA adsorbed with a large amount of MB, so that the I MB decreases. And in the linear range, the size of I MB is negatively linearly related to the concentration of MC-LR, and the greater the concentration of MC-LR, the smaller the I MB .
[0043] The biosensor with a sensing substrate of laser-induced graphene transferred by a hot melt adhesive is constructed, and the detection application of MC-LR in water is realized.
[0044] The beneficial effects of the present application are:
[0045] The graphene sensor substrate electrode with a porous structure can be quickly prepared in an array and quickly and accurately transferred on EVA hot melt adhesive material; a sandwich structure sensor is constructed by using laser-induced graphene as a sensing substrate, TDN-cDNA-apt as a sensitized recognition element and MB as a recognition probe, so that the sensitive detection of MC-LR is realized. BRIEF DESCRIPTION OF DRAWINGS
[0046] Figure 1 Adobe illustrator design drawing of the laser-induced graphene three-electrode;
[0047] Figure 2 Porous graphene test resistance change line graph with laser power (a) and scanning rate (b);
[0048] Figure 3 Effect drawing of laser-induced graphene prepared on different substrates;
[0049] Figure 4 Effect drawing of laser-induced graphene transferred by different materials;
[0050] Figure 5 Performance exploration drawing of laser-induced graphene after hot melt adhesive transfer;
[0051] Figure 6 Graphene-based biosensor construction process characterization drawing (a) and feasibility verification drawing (b);
[0052] Figure 7 Sensor preparation experiment condition optimization drawing;
[0053] Figure 8 Performance analysis effect drawing of the graphene-based biosensor for MC-LR;
[0054] Figure 9 Effect drawing of the graphene-based biosensor for on-site detection of MC-LR in water. DETAILED DESCRIPTION
[0055] The present application is further described in conjunction with the drawings and examples, and it should be pointed out that the following examples are intended to facilitate the understanding of the present application and do not have any limiting effect on the present application.
[0056] As Figure 1As shown in Figure a, an integrated three-electrode pattern was designed in advance using Adobe Illustrator, and the electrode pattern was arranged in an array on the SeaCAD host computer control terminal. The result is as follows. Figure 1 As shown in b, the laser power and scanning rate for the secondary processing were optimized to 3.6W and 285mm / s, respectively. -1 The process is as follows Figure 2 As shown in ab.
[0057] The pharmaceutical reagents mentioned in this invention are as follows: polyimide film was purchased from DuPont, USA; EVA hot melt adhesive and MCH were purchased from Maclean Biotechnology Co., Ltd.; the five single-stranded DNAs for synthesizing TDT-cDNA-apt were purchased from Shanghai Sangon Biotech Co., Ltd., China, and their sequences are shown in Table 1. All of them are conventional primers and do not involve sequence listing inventions.
[0058] Table 1 DNA Sequences
[0059]
[0060] This invention uses TM (Tris / MgCl2) buffer and TE (Tris / EDTA) buffer (pH=8.0) to prepare DNA solutions; electrochemical detection and MC-LR dissolution are performed using phosphate-buffered saline (PBS) (0.1M, pH=7.4) and Tris-HCl (0.05M Tris, 0.1M NaCl, 0.2M KCl, 5mM MgCl2, 1mM EDTA, pH=7.4), respectively. All solutions are prepared using deionized water.
[0061] 1. Investigation of substrate materials
[0062] like Figure 3 As shown, the effects of three substrate materials on the graphene pattern induction effect were compared. Figure 3 'a' indicates the effect of inducing polyimide to form graphene on an acrylic substrate; Figure 3 b indicates the laser direct writing effect using transparent glass as a substrate; Figure 3 c represents the processing effect on the copper plate. Among them, the laser-induced graphene patterns obtained on the acrylic glass substrate all showed varying degrees of damage or wrinkles, while the laser-induced graphene patterns obtained on the copper plate were very clear and complete.
[0063] 2. Research on graphene pattern transfer materials
[0064] like Figure 4 As shown, the effects of three transfer materials on the laser-induced graphene electrode transfer effect were compared. Figure 4 'a' indicates the transfer effect of acrylate; Figure 4 b indicates the transfer effect of epoxy resin; Figure 4c represents the transfer effect of EVA hot melt adhesive. Among them, the graphene patterns transferred by the first two materials are incomplete, while the graphene formed by the transfer of EVA hot melt adhesive has the best effect.
[0065] 3. Investigation into the properties of laser-induced graphene after transfer
[0066] The morphology of LIG-EVA was evaluated using scanning electron microscopy (SEM). Figure 5 a): LIG-EVA exhibits a grooved appearance along the laser engraving direction. Defects and pores can be observed in high-magnification images, revealing the porous morphology of graphene. Figure 5 (a. Upper right illustration); Raman spectroscopy was used to characterize and verify the quality of the laser-written multidimensional nanomaterials: Figure 5 b shows three characteristic peaks of LIG-EVA, including 1348 cm⁻¹. -1 (D belt), 1582cm -1 (G-band) and 2702cm -1 (2D band). D-band indicates sp. 3 The structural defects and bends of the bonds, and the 2D and G bands, are consistent with the typical peaks of the graphene structure. D / I G The calculated result of 0.75 reveals its highly defective graphene structure, while the lower Ig 2D / I G A value of 0.58 indicates the presence of multilayer graphene; X-ray photoelectron spectroscopy (XPS) was used to study the chemical structure and elemental composition of graphene (e.g., ...). Figure 5 c): XPS full spectrum showed carbon dominance, with calculated carbon and oxygen atomic percentages of 96.8% and 3.2%, respectively, further indicating that the polyimide film was completely carbonized after laser treatment; X-ray diffraction (XRD) further verified the composition of LIG-EVA: as shown in the figure. Figure 5 As shown in Figure d, the two peaks at 25.9° and 42.9° correspond to the (002) and (100) crystal planes of graphene, respectively. For the prominent peak at 25.9°, the calculated interlayer distance of graphene in LIG-EVA matches the 0.36 nm interlayer spacing, verifying the high degree of graphitization. The weak peak at 42.9° is related to the reflection of the in-plane structure.
[0067] 4. Investigation into the construction process of the biosensor prepared in this invention
[0068] To verify the sensor construction process, six sets of experiments were set up, with the test electrodes being LIG-EVA; LIG-EVA modified with AuNPs; LIG-EVA layer-by-layer modified with AuNPs, TDN-cDNA-apt; LIG-EVA layer-by-layer modified with AuNPs, TDN-cDNA-apt, and MCH; LIG-EVA layer-by-layer modified with AuNPs, TDN-cDNA-apt, MCH, and MB; and LIG-EVA layer-by-layer modified with AuNPs, TDN-cDNA-apt, MCH, MB, and MC-LR, respectively denoted as test a, b, c, d, e, and f.
[0069] Use [Fe(CN)6] 3- / 4- Cyclic voltammetry (CV) tests were performed on each group of experiments using probes. The CV curves on the LIG-EVA electrode showed the potentials of the oxidation and reduction peaks; modification with Au NPs enhanced the conductivity of the LIG-EVA electrode, resulting in a higher peak current compared to the bare electrode; after TDN-cDNA-apt assembly, electron transfer was inhibited due to the steric hindrance and electrostatic repulsion of DNA, leading to a decrease in peak current; MCH modification further reduced the peak current; while the presence of MB facilitated electron transfer and increased the peak current; with the addition of MC-LR, a higher peak current was observed because TDN-cDNA was stripped from the sensing interface. Figure 6 The changes in peak current in the six CV tests in group a indicate that the biosensor was successfully constructed.
[0070] 5. Feasibility study of the biosensor prepared in this invention for MC-LR detection.
[0071] To verify the feasibility of using the sensor for MC-LR detection, four sets of experiments were set up to test the sensor's response under different target conditions: no MC-LR, MC-LR with 0.1 pM added, MC-LR with 0.1 nM added, and MC-LR with 0.1 μM added, denoted as test a, b, c, and d.
[0072] DPV tests were performed on each group of experiments using 0.1M PBS to evaluate the feasibility of using the sensor for MC-LR detection. Figure 6 b indicates the presence of I when MC-LR is present. MB When MC-LR is not present (I) blank The concentration decreased at 3.17 μA, which was due to the stripping of the TDN-cDNA complex. I was observed after the addition of 0.1 pM MC-LR. MB Decrease; when C MC-LR When increased to 0.1 nM, I MB The value dropped sharply to 1.95 μA; while when 0.1 μM MC-LR was added, I... MBThe value is smaller, only 0.95 μA. MB The decrease can be explained as: with the increase of C MC-LR More TDN-cDNA is released from the electrode surface, which reduces the adsorption of MB on the electrode, thus reducing the current response of MB.
[0073] 6. Optimization of experimental conditions
[0074] 10 μL of AuNPs solution was modified on the surface of LIG-EVA working electrode; after drying, 10 μL of 2 μM TDN-cDNA-apt solution was modified and incubated at 4°C for 4-12 h; 8 μL of 1 mM MCH was added to the electrode interface for blocking the non-specific binding active sites, and incubated at room temperature for 40 min; then 8 μL of 5 μM MB was modified on the electrode surface, and incubated at room temperature for 20-100 min for generating electrochemical signal; finally, 1 nM of MC-LR solution was added to the surface of the sensor, and incubated at room temperature for 1-60 min; the response current value of the sensor was tested by DPV method of CHI852D electrochemical workstation.
[0075] Since the detection range of the MC-LR aptamer sensor is affected by the assembly density of TDN-cDNA-apt, the incubation time of TDN-cDNA-apt was first optimized. As shown in Figure 7 a, with the increase of incubation time, I MB increased significantly, but I MB remained basically unchanged within 8-12 h, indicating that most of the Au-S bond combination occurred within 8 h, so 10 h was selected as the optimal incubation time; the binding time of MB was optimized to ensure that MB was fully adsorbed by TDN-cDNA-apt. As shown in Figure 7 b, the adsorption amount of MB reached saturation after 60 min of adsorption time, so 80 min was selected as the optimal adsorption time; the effect of the binding time of MC-LR and aptamer on the detection performance of the sensor was also discussed, as shown in Figure 7 c, with the increase of incubation time from 0 to 40 min, I MB continued to decrease. I MB remained stable after 40 min, so 50 min was the optimal incubation time of MC-LR.
[0076] Example 1:
[0077] S1: Laser-induced graphene substrate electrode acquisition: A 120-μm-thick polyimide film was placed on a 1-mm-thick copper plate, and the surface thereof was cleaned using acetone and anhydrous ethanol in sequence. A 10.6-μm carbon dioxide laser was used to scan and write on the surface of the polyimide film at a laser power of 3 W and an induction rate of 400 mm / s, thereby obtaining a laser-induced graphene three-electrode substrate with a preset WE sensing zone diameter of 4.5 mm. The parameters of the laser were changed to a power of 3.6 W and a rate of 285 mm / s, and the laser-induced graphene electrode substrate was scanned and written on the surface of the laser-induced graphene electrode substrate, thereby obtaining a laser-induced graphene electrode substrate after secondary processing, which is denoted as LIG.
[0078] S2: Laser-induced graphene pattern transfer module construction: The bubbles in the 0.05-mm-thick EVA hot melt adhesive were removed in a vacuum, and then the EVA hot melt adhesive was attached to the surface of the LIG, and a 0.1-mm-thick PET release film and a 5-mm metal pressing plate were sequentially attached above the EVA hot melt adhesive, and the obtained sample is denoted as LIG / EVA.
[0079] S3: Graphene substrate transfer: The LIG / EVA obtained in S2 was heated on a constant temperature heating table at 85°C for hot melting, and the hot melting time was 5 min. Subsequently, the metal pressing plate and the PET release film were removed, and the sample was annealed at room temperature of 25°C for 10 min and then solidified in a low-temperature environment of -18°C for 10 min, so that the laser-induced graphene pattern was transferred and fixed to the EVA hot melt adhesive. The copper substrate and the polyimide film were sequentially separated, thereby realizing rapid transfer of the laser-induced graphene electrode, and obtaining the transferred laser-induced graphene, which is denoted as LIG-EVA.
[0080] S4: Synthesis of Au NPs: 200 μL of 0.1 M chloroauric acid and 25 mL of deionized water were added to a three-necked flask, the flask was heated in an oil bath to boiling of the solution, and 0.25 mL of 100 mg / mL sodium citrate was added dropwise into the mixed solution, and heating was continued for 15 min. A wine red solution was observed in the flask, and the Au NPs solution was obtained.
[0081] S5: Preparation of TDN-cDNA-apt: Five component strands (S1, S2, S3, S4, and apt) of TDN-cDNA-apt were dissolved in TE buffer to obtain five single-stranded DNAs with a concentration of 50 μM, and each was diluted to 10 μM in TM buffer. TCEP (20 mM) was additionally added to the apt for activation of thiol groups, and the final concentration was 1 mM. Finally, equal volumes of the mixture of S1, S2, S3, S4, and apt were heated to 95°C for 2 min in a PCR instrument, and then annealed at a low temperature of 25°C for 60 s, thereby obtaining a complex denoted as TDN-cDNA-apt solution, which was stored in a refrigerator at 4°C for standby use.
[0082] S6: sequentially modify 10 μL of Au NPs in the circular region of LIG-EVA layer by layer and incubate at 25℃ for 30 min, 10 μL of TDN-cDNA-apt and incubate at 25℃ for 10 h, 8 μL of MCH and incubate at 25℃ for 40 min, and 8 μL of MB and incubate at 25℃ for 80 min, to finally obtain a laser-induced graphene-based biosensor for MC-LR detection, denoted as LIG-EVA / Au / TDN-cDNA-apt / MCH / MB.
[0083] S7: take 15 prepared laser-induced graphene-based biosensors (LIG-EVA / Au / TDN-cDNA-apt / MCH / MB), and modify the working electrode surface of the sensor with MC-LR standard solution with a concentration of 0.01 pM, 0.05 pM, 0.1 pM, 0.5 pM, 1 pM, 5 pM, 10 pM, 50 pM, 100 pM, 500 pM, 1000 pM, 5000 pM, 10000 pM, 50000 pM and 100000 pM respectively (one concentration corresponds to one sensor), and incubate at 25℃ for 50 min to complete the recognition of the sensing interface to MC-LR, and the sensor at this time is denoted as LIG-EVA / Au / TDN-cDNA-apt / MCH / MB+MC-LR; wherein different concentrations of MC-LR correspond to different response current signal values.
[0084] S8: establishment of standard test curve;
[0085] Connect the sensor obtained in step S7 with CHI852D electrochemical workstation, and test the response current signal of the sensor using DPV method under a three-electrode system; due to the specific recognition of the apt to MC-LR, when MC-LR exists, the TDN-cDNA adsorbed with MB will be peeled off from the sensing interface, so that I MB decreases; in the range of 10 fM-100 nM, the logarithmic value of C MC-LR is negatively linearly correlated with I MB , and according to the logarithmic relationship between I MB and C MC-LR , the standard test curve can be established as: I MB =-0.33lgC MC-LR +2.62.
[0086] According to Figure 8 a-b, it can be seen that the linear range of the graphene-based biosensor proposed in the application for MC-LR detection is 10 fM-100 nM, and the result spans 7 orders of magnitude.
[0087] S9: Detection of MC-LR concentration in actual water samples;
[0088] A 200 mL sample of Yangtze River water (Zhenjiang section) was collected, filtered through a stainless steel sieve, and then purified by filtration through a 0.22 μm filter membrane. The filtered sample was stored in a brown reagent bottle in the dark as the sample solution to be tested for subsequent analysis.
[0089] The sample solution to be tested was divided into four groups, and 0, 100, 1000, and 10000 pM MC-LR standard solutions were added to each group respectively and mixed thoroughly. Then, 10 μL of the sample solution to be tested was modified at the sensing interface. After incubation at room temperature for 50 min, electrochemical testing was performed using the DPV method, and the measured I... MB The recovery rate was obtained by substituting back into the standard test curve. Simultaneously, the sample solution was tested using the national standard detection method of liquid chromatography-tandem mass spectrometry, and the results are shown in Table 2.
[0090] Table 2. Detection results of MC-LR in Yangtze River water samples
[0091]
[0092] "--": Not detected
[0093] As can be seen from Table 2, the biosensor prepared in this embodiment can sensitively and reliably detect MC-LR in the sample to be tested. It has low preparation cost, simple method, easy operation, and accurate detection results, and has high practical value.
[0094] Example 2:
[0095] Steps S1-S8 of Example 2 are exactly the same as those of Example 1, except that in step S9, the application scenario of the laser-induced graphene-based biosensor is changed to outdoor field operation; the prepared sensor is combined with a portable electrochemical workstation controlled by a laptop computer to construct an outdoor portable detection platform. Figure 9 a) It can perform on-site testing of MC-LR in external environments.
[0096] S9: On-site detection of MC-LR concentration in actual water samples.
[0097] 200 mL of water from the Yangtze River and 200 mL of water from a pond (within Jiangsu University) were collected as sample solutions. After filtration through a stainless steel sieve, the samples were purified by filtration through a 0.22 μm filter membrane. The filtered samples were stored in a brown reagent bottle in the dark as the sample solutions to be used for subsequent analysis. The portable platform was used to analyze the two sets of water samples. Figure 9 b). Figure 9 Figures c and 9d show the baseline-corrected DPV test curves for Yangtze River water samples and pond water samples, respectively, with the original curves shown in their insets. The measured I... MBThe results of the field detection of MC-LR in two groups of water samples by the portable detection platform are shown in Table 3.
[0098] Table 3 The results of the field detection of MC-LR in two groups of water samples by the portable detection platform.
[0099]
[0100] "---": not detected
[0101] It should be noted that the above embodiments are only used to illustrate but not to limit the technical solutions described in the present application; therefore, although the present application has been described in detail with reference to the above various embodiments, those skilled in the art should understand that the present application can still be modified or replaced equivalently; and all technical solutions and improvements without departing from the spirit and scope of the present application should be covered in the scope of claims of the present application.
Claims
1. A method for preparing a hot-melt adhesive-based laser-induced graphene electrode biosensor, characterized by, The steps are as follows: S1: laser-induced graphene base electrode acquisition: polyimide film is placed on the substrate material, and the surface thereof is cleaned with acetone and anhydrous ethanol in sequence, laser is controlled to scan and write on the surface of the polyimide film, a preset array of laser-induced graphene three-electrode base is obtained, wherein the three electrodes are a working electrode, a reference electrode and a counter electrode; then the power and induction rate of the laser are changed, the laser-induced graphene electrode base is scanned and written again on the surface of the laser-induced graphene electrode base, a secondarily processed laser-induced graphene electrode base is obtained, and is denoted as LIG; S2: laser-induced graphene pattern transfer module construction: first, bubbles in EVA hot melt adhesive are removed through vacuum treatment, then the EVA hot melt adhesive is attached to the surface of LIG, and then PET release film and metal pressing plate are sequentially attached to the EVA hot melt adhesive, and the obtained sample is denoted as LIG / EVA; S3: laser-induced graphene base transfer: the LIG / EVA obtained in step S2 is placed on a constant temperature heating table for high temperature hot melting, the metal pressing plate and the PET release film are removed after hot melting, and the sample is annealed at room temperature and then solidified, so that the laser-induced graphene pattern is transferred and fixed to the EVA hot melt adhesive; finally, the substrate and the polyimide film are sequentially separated, so that the laser-induced graphene electrode is transferred, and a transferred laser-induced graphene is obtained, and is denoted as LIG-EVA; S4: synthesis of gold nanoparticles: chloroauric acid and deionized water are mixed, the mixture is heated to boiling in an oil bath, and a certain amount of sodium citrate solution is added dropwise into the mixture, and the heating is continued until the solution turns into a wine red solution, and then the heating is stopped, so that an Au NPs solution is obtained; S5: preparation of tetrahedral DNA complex: four single-stranded DNAs and an aptamer are taken, and are denoted as S1, S2, S3, S4 and apt respectively; the four single-stranded DNAs and the aptamer are dissolved in TE buffer, and then are diluted in TM buffer, so that five TE diluents are obtained, and are denoted as S1 diluent, S2 diluent, S3 diluent, S4 diluent and apt diluent respectively; then tris(2-carboxyethyl) phosphine is added to the apt diluent, so that an apt-TCEP diluent is obtained; finally, the S1 diluent, the S2 diluent, the S3 diluent, the S4 diluent and the apt-TCEP diluent are mixed in equal proportions, and then are subjected to heating reaction and annealing, so that a tetrahedral DNA complex is obtained, and is denoted as TDN-cDNA-apt solution; S6: Au NPs solution, TDN-cDNA-apt solution, 6-mercapto-1-hexanol and methylene blue are sequentially modified on the working electrode region of LIG-EVA layer by layer, and electrode incubation is performed after each modification; finally, a laser-induced graphene base biosensor for microcystin-LR detection is obtained, and is denoted as LIG-EVA / Au / TDN-cDNA-apt / MCH / MB.
2. The method of claim 1, wherein the hot-melt adhesive is a mixture of a thermally conductive material and a thermally conductive adhesive. The graphene electrode substrate pattern designed in the step S1 includes three independent parts, which are respectively referred to as a working electrode, a reference electrode and a counter electrode, each of which can be divided into an upper sensing area and a lower wire area, wherein the working electrode is located in the middle, and the reference electrode and the counter electrode are arranged on the two sides; the working electrode sensing area is a circular area with a diameter of 4.5 mm, which is convenient for solution dispersion and modification; and the counter electrode sensing area is an arch structure, and the inner side of the arch is the working electrode sensing area; The polyimide film has a thickness of 80-120 μm, the metal copper plate with a thickness of 1 mm is selected as the substrate, the induced laser is a 10.6 μm carbon dioxide laser, the laser power and the induction rate are 3 W and 400 mm / s respectively, and the changed action parameters are 3.6 W laser power and 285 mm / s induction rate.
3. The method of claim 1, wherein the hot-melt adhesive is a mixture of a thermally conductive material and a thermally conductive adhesive. In the step S2, the EVA hot melt adhesive is attached to the surface of the LIG with a thickness of 0.05-0.2 mm, the PET release film has a thickness of 0.1-0.2 mm, and the metal pressing plate is a 5 mm thick copper plate; in the step S3, the temperature of the high-temperature hot melting is controlled to be 85-110 ℃, the hot melting time is 5-8 min, the temperature of the room-temperature annealing is 20-25 ℃, the annealing time is 8-10 min, the temperature of the solidification treatment is-18 ℃, and the solidification time is 10-20 min.
4. The method of claim 3, wherein the hot-melt adhesive is applied to the graphene electrode in a thickness of 1-100 pm. The hot melting temperature is controlled to be 85 ℃, the hot melting time is 5 min, the temperature of the room-temperature annealing is 25 ℃, the annealing time is 10 min, the temperature of the low-temperature solidification is-18 ℃, and the solidification time is 10 min.
5. The method of claim 1, wherein the hot-melt adhesive is a mixture of a thermally conductive material and a thermally conductive adhesive. In the step S4, the volume ratio of chloroauric acid, deionized water and sodium citrate solution is 0.2:25:0.25, the concentration of the chloroauric acid is 0.1 M, and the concentration of the sodium citrate solution is 100 mg / mL; the heating time is 15-20 min.
6. The method of claim 1, wherein the hot-melt adhesive is a mixture of a thermally conductive material and a thermally conductive adhesive. In the step S5, the DNA sequences of S1, S2, S3, S4 and apt are as follows: S1 TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC; S2 TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC; S3 TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT; S4 ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTAGTCATGGTGGTCCTGTTTGGCGCCCTCCGC; apt SH-GCGGAGGGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGC; The concentrations of S1 dilution, S2 dilution, S3 dilution, S4 dilution and apt dilution are all 10 µM; the final concentration of tris(2-carboxyethyl)phosphine in apt-TCEP dilution is 1 mM; The heating reaction condition is 95 °C for 2 min; the annealing condition is 25 °C for 30-90 s.
7. The method of claim 1, wherein the hot-melt adhesive is a mixture of a thermally conductive material and a thermally conductive adhesive. In step S6, the concentration of Au NPs solution is 6 nM, the concentration of TDN-cDNA-apt solution is 2 µM, the concentration of MCH is 1 mM, and the concentration of MB is 5 µM; the modification amount of Au NPs and TDN-cDNA-apt is all 10 µL, and the modification amount of MCH and MB is all 8 µL; the incubation time after modification of Au NPs solution is 20-40 min, and the incubation temperature is 20-25 °C; the incubation time after modification of TDN-cDNA-apt solution is 4-12 h, and the incubation temperature is 4 °C; the incubation time after modification of MCH solution is 30-50 min, and the incubation temperature is 20-25 °C; the incubation time after modification of MB solution is 20-100 min, and the incubation temperature is 20-25 °C.
8. Use of a laser-induced graphene-based biosensor prepared according to the method of any one of claims 1-7 for detecting MC-LR in water, characterized in that, The steps are as follows: S1: First, prepare MC-LR standard solutions with different concentrations, modify the MC-LR standard solutions with different concentrations on the surface of the working electrode of LIG-EVA / Au / TDN-cDNA-apt / MCH / MB, incubate at room temperature for a period of time, complete the recognition of MC-LR by the sensing interface, and record as LIG-EVA / Au / TDN-cDNA-apt / MCH / MB+MC-LR; wherein the MC-LR standard solutions with different concentrations have their respective response current signal values; S2: Establishment of standard test curve; The LIG-EVA / Au / TDN-cDNA-apt / MCH / MB+MC-LR sensor obtained by step S1 incubation is connected with an electrochemical workstation, and the response current signal of the sensor is tested by using differential pulse voltammetry to obtain the corresponding current signal, which is denoted as I MB , the concentration logarithm value of the MC-LR standard solution is negatively linearly related to I MB , and the standard test curve is established according to the logarithmic relationship between I MB and the concentration of the MC-LR standard solution; S3: Detection of MC-LR concentration in sample; First, the sample liquid to be measured is obtained, a certain amount of the sample liquid to be measured is modified on the LIG-EVA / Au / TDN-cDNA-apt / MCH / MB sensing interface, and after incubation at room temperature for a period of time, electrochemical testing is performed according to the method for testing the response current signal in step S2, the response current signal is obtained, and is brought into the standard test curve constructed in step S2, so that C MC-LR , the detection of the concentration of MC-LR in the unknown sample is realized.
9. Use according to claim 8, characterized in that, In step S1, the modification amount of MC-LR standard solution is 10 µL, the concentration of MC-LR standard solution is 10 fM-100 nM, and the incubation time is 10-60 min; in step S2, the specific conditions of differential pulse voltammetry test are as follows: scan voltage range -0.6-0 V, amplitude 0.05 V, and pulse width 0.05 s; In step S3, the sample liquid to be tested needs to be pretreated; the pretreatment operation is as follows: take the sample liquid, filter it with a stainless steel sieve, then filter and purify it with a 0.22 µm filter membrane, and thus complete the pretreatment of the sample to obtain the sample liquid to be tested.
10. Use according to claim 9, characterized in that, The incubation time is 50 min.
Citation Information
Patent Citations
Preparation method of laser-induced graphene flexible strain-temperature two-parameter sensor
CN112361953A
Preparation method of electrochemical immunosensor based on laser-induced graphene
CN112903768A