A method for constructing a mouse model of retinoblastoma
By increasing the injection volume of tumor cells in mice by refractory of scleral pressure in mice, and using genetically engineered cell lines and fluorescence examination techniques, the problems of slow tumor growth and difficulty in evaluation in the retinoblastoma model were solved, and efficient model construction and dynamic monitoring were achieved.
Patent Information
- Application Number
- CN202311120951.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-01
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2043-09-01
AI Technical Summary
In the existing methods for building animal models of retinoblastoma, insufficient tumor cell injection results in slow growth and difficulty in quantifying and dynamically monitoring of tumor size, affecting the success rate of model construction and evaluation accuracy.
By relieving the sclera of mice, the injection volume of retinoblastoma cells was increased, and the genetically engineered monoclonal stable cell line overexpressing the Y79/luciferase+CopGFP gene was used, combined with fluorescence examination technology, quantification and dynamic detection of tumor size were achieved.
The injection volume of tumor cells was increased, the tumor growth rate was promoted, the model construction success rate was improved, and the tumor size was quantified and dynamic monitoring was achieved through fluorescence examination, solving the difficulties in the existing technology.
Smart Images

Figure CN116897889B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of animal models, and particularly relates to a method for constructing a retinoblastoma mouse model. Background Art
[0002] Retinoblastoma (RB) is a common primary malignant tumor that occurs in the eyes of infants and young children. Most cases occur in infants under 5 years old, and the majority of cases occur in infants under 3 years old. It has a high degree of malignancy and is prone to systemic metastasis. RB not only endangers the vision of children but also seriously threatens their lives. The research and development of the pathogenesis and drugs of RB both require the establishment of animal models first.
[0003] Currently, the globally recognized cells for the xenograft animal model of retinoblastoma are Y79 and WERI-Rb cells. The Y79 retinoblastoma model has invasiveness and metastasis, similar to the invasive and metastatic diseases seen in humans. Y79 cells will invade the subretinal space, choroid, optic disc, anterior chamber of the eye, subarachnoid space, brain, and the contralateral eyeball. The WERI-Rb retinoblastoma model is very similar to non-metastatic human retinoblastoma. The WERI-Rb tumor is confined within the eye and only invades the choroid at an advanced stage.
[0004] It has been reported that animals that can be used to construct retinoblastoma models include mice, rats, rabbits, Xenopus laevis, zebrafish, etc. Research has shown that implanting human retinoblastoma cells into the vitreous body of the eyes of newborn rats can reveal the process of retinoblastoma growth, invasion, and metastasis, and basically reproduce the pathogenesis, progression, and metastasis process of retinoblastoma in human patients. Nassr et al. injected RB cells into the eyes of newborn rats and studied the growth of tumors and the efficacy of drugs through fluorescence color scanning. Berti et al. conducted a large number of studies on the role of the Rb1 gene in embryonic development and tumor suppression in mice. Zheng Songshan et al. injected RB cells into the anterior chamber of rabbits' eyes and revealed that when the cell density is greater than 4×10 7 cells / mL, there is tumor growth to varying degrees. Naert et al. made a retinoblastoma model by injecting triple CRISPR / Cas9 gRNA into Xenopus laevis (rb1+rb11+ modified genes).
[0005] The existing methods for constructing retinoblastoma animal models and the characteristics of the models are shown in Table 1:
[0006] Table 1
[0007]
[0008]
[0009] From the above comparison results, it can be seen that mice are the most commonly used animals, and both transgenic and gene knockout mice face huge technical difficulties. Xenotransplantation has a short cycle and low cost. Methods such as fundus and spectral domain optical coherence tomography imaging, pathology, and immunohistochemistry are used to judge and monitor the growth cycle of intraocular tumors. Most xenotransplantations use pathology and immunohistochemistry methods to judge the growth of tumors. It is difficult to quantify and a large number of animals need to be sacrificed to obtain effective data. According to the existing literature, the amount directly injected into the eye is about 0.5 μL, the amount of cell injection is small, and the tumor formation is slow. Summary of the Invention
[0010] In view of this, the purpose of the present invention is to provide a method for constructing a mouse model of retinoblastoma, which improves the number of transplanted tumor cells and accelerates tumor growth by optimizing the transplantation method of tumor cells.
[0011] The present invention provides a method for constructing a mouse model of retinoblastoma, comprising the following steps:
[0012] Relieve the pressure on the sclera of the mouse, and inject retinoblastoma cells into the vitreous body.
[0013] Preferably, the method for relieving the pressure on the sclera of the mouse is to puncture the sclera in the upper nasal area of the eyeball and exclude part of the vitreous body from the puncture hole.
[0014] Preferably, the retinoblastoma cells are injected in the form of a suspension; the injection volume of the retinoblastoma cell suspension is 2.8 - 3.2 μL; the density of the retinoblastoma cell suspension is (1.0 - 1.5)×10 7 / mL.
[0015] Preferably, the retinoblastoma cells are the Y79 / luciferase+CopGFP gene overexpressing monoclonal stable transfected cell line.
[0016] Preferably, the nucleotide sequence of the luciferase gene is as shown in SEQ ID NO:1.
[0017] Preferably, the nucleotide sequence of the CopGFP gene is as shown in SEQ ID NO:2.
[0018] Preferably, the injection is preferably performed using a 33G ophthalmic needle;
[0019] After the injection is completed, keep the 33G ophthalmic needle at the injection position for several seconds.
[0020] Preferably, after the injection, ofloxacin eye drops are instilled into the mouse's eyes.
[0021] The present invention provides a method for constructing a mouse model of retinoblastoma, comprising the following steps: relieving pressure on the sclera of a mouse and injecting retinoblastoma cells into the vitreous body. In view of the problems that the volume of retinoblastoma transplanted into the vitreous body of mice is limited, resulting in slow growth of tumor cells, and increasing the injection volume causes exudation of tumor cells, thus the success rate of constructing the mouse model is low and there are problems such as eyeball damage. The present invention creatively perforates the sclera to relieve pressure first, allowing a part of the vitreous body to flow out, increasing the injection volume of tumor cells, avoiding exudation of tumor cells, increasing the growth rate of tumor cells, thereby increasing the success rate of model construction, and at the same time the eyeball remains normal.
[0022] Further, the present invention defines that the retinoblastoma is a modified retinoblastoma, a monoclonal stable transfected cell line with overexpression of Y79 / luciferase+CopGFP gene. In view of the problems that in the evaluation process, the size of the tumor cannot be comprehensively evaluated by techniques such as optical coherence tomography imaging, and only the growth of foreign bodies can be judged. It is necessary to judge by histopathology and, if necessary, add immunohistochemistry methods for judgment, and it is difficult to quantify the tumor. The present invention realizes the purpose of quantifying the size of the tumor and dynamically detecting the growth of the tumor by injecting genetically engineered modified cells under the method of fluorescence examination. Description of the Drawings
[0023] Figure 1 It is a result diagram of virus packaging;
[0024] Figure 2 It is a result diagram of the pre-experiment of drug screening for Y79 cells;
[0025] Figure 3 It is a result diagram of the recombinant virus infection experiment;
[0026] Figure 4 It is the result of the drug screening experiment for Y79 / pCDH-LUC-copGFP cells;
[0027] Figure 5 It is the state before cryopreservation of the monoclonal cell line of Y79 / pCDH-LUC-copGFP;
[0028] Figure 6 It is a melting curve diagram;
[0029] Figure 7 It is the result of observing the tumor changes at different times with a slit lamp. Among them, A is the eyeball before injection, B is the eyeball 3 days after injection, C is the eyeball 7 days after injection, D is the eyeball 11 days after injection, E is the eyeball 15 days after injection, F is the eyeball 19 days after injection, G is the eyeball 23 days after injection, H is the eyeball 27 days after injection, I is the eyeball 31 days after injection, J is the eyeball 35 days after injection, K is the eyeball 39 days after injection, and L is the eyeball 49 days after injection;
[0030] Figure 8 For the results of fluorescence imaging monitoring flux;
[0031] Figure 9 For the HE staining results, where the left figure is the left eye (control) and the right figure is the right eye (model eye). Specific implementation manners
[0032] The present invention provides a method for constructing a mouse model of retinoblastoma, comprising the following steps:
[0033] Relieve the pressure of the sclera of the mouse, and inject retinoblastoma cells into the vitreous body.
[0034] In the present invention, it is preferred to pre-treat the mouse. The method of the pre-treatment is preferably to anesthetize the mouse. The method of the anesthesia is preferably to anesthetize the mouse with sodium pentobarbital, and use 1-2 drops of mydriatic, proxymetacaine hydrochloride eye drops for topical surface anesthesia. The mouse is preferably a BALB / c-nu mouse with an age of 4-6 weeks.
[0035] In the present invention, it is preferred to fix the eyeball in advance when relieving the pressure of the sclera of the mouse. The method of fixing the eyeball is preferably to open the eyelid, protrude the eye to expose the eye diameter, and keep the protruding eye position until the injection is completed; place the finger on the outside of the orbital margin for fixation to prevent the displacement of the needle during the injection and expose the upper nasal area of the eye. The method of relieving the pressure of the sclera of the mouse is preferably to puncture the sclera in the upper nasal area of the eyeball and exclude part of the vitreous body from the puncture hole. The needle used for the puncture is preferably an insulin needle. The puncture avoids contacting the ocular muscles and blood vessels and reduces the damage to the eye.
[0036] In the present invention, the retinoblastoma cells are preferably injected in the form of a suspension; the injection volume of the retinoblastoma cell suspension is preferably 2.8-3.2 μL, more preferably 3 μL. The density of the retinoblastoma cell suspension is preferably (1.0-1.5)×10 7 / mL. The injection is preferably performed with a 33G ophthalmic needle. The injection preferably inserts through the pre-puncture hole into the vitreous body at a 45° angle through the sclera. After the injection is completed, it is preferred to keep the 33G ophthalmic needle at the injection position for several seconds and then gently remove the needle to avoid the outflow of tumor cells.
[0037]
[0038] In the present invention, after the injection, ofloxacin eye drops are preferably instilled into the eyes of the mice. During this period, a warming pad is provided for the animals to keep them warm. After the operation, the animals are placed in an incubator until they fully wake up. Before modeling, slit lamp examination and fluorescence examination are performed once, and about once a week after modeling. The eyeballs are removed by gross dissection, stained with HE, and the tumor metastasis is observed to determine whether the animal model is successfully constructed.
[0039] The following is a detailed description of a method for constructing a mouse model of retinoblastoma provided by the present invention in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0040] Example 1
[0041] I. Construction method of Y79 / luciferase+CopGFP gene overexpressing monoclonal stable cell line
[0042] 1. Materials
[0043] 1.1 Instrument and equipment
[0044] Clean bench, research-grade inverted microscope, centrifuge, carbon dioxide incubator, ultra-low temperature refrigerator, liquid nitrogen tank.
[0045] 1.2 Consumables
[0046] 1) Pipette tips of various specifications, pipettes of various specifications, 96-well plates, 12-well plates, 6-well plates, T25 culture flasks, latex gloves (domestic), disposable masks (domestic);
[0047] Restriction enzymes EcoRI, NotI (Thermo Scientific) and supporting Buffer
[0048] Agarose Andygene, Lot: HTCH006
[0049] Electrophoresis buffer IGE
[0050] Gel extraction kit IGE
[0051] Marker DL5000 (IGE)
[0052] Water bath Changfeng brand, model: XMTD-6000
[0053] Electrophoresis apparatus Junyi brand, model: JY 300E
[0054] Gel imaging system Junyi brand, model: JY02G.
[0055] 1.3 Reagents
[0056] RPMI 1640 + 20% FBS + 1% P / S medium, 1×PBS, 0.25% Trypsin - 0.04% EDTA, Polybrene, Puromycin, cryopreservation solution with RPMI1640:FBS:DMSO = 5:4:1;
[0057] Agarose Andygene, Lot: HTCH006
[0058] Electrophoresis buffer IGE
[0059] Gel extraction kit IGE
[0060] Marker DL2000 (IGE)
[0061] Homologous recombination kit IGE
[0062] 2×YT (Kan) medium IGE
[0063] Ordinary plasmid miniprep kit IGE
[0064] Centrifuge eppendorf, model: Centrifuge 5417C
[0065] 2xYT (Kan) plate IGE
[0066] Competent cell Stbl3
[0067] 2. The construction method of the pCDH - EF1 - LUC - P2A - copGFP - T2A - Puro lentiviral recombinant vector and the rescue of the virus are specifically entrusted to Guangzhou Aiji Biotechnology Co., Ltd. The specific steps are as follows:
[0068] S1. Restriction digestion of the viral vector
[0069] The restriction digestion system is shown in Table 2.
[0070] Table 2 Restriction digestion system of the viral vector
[0071]
[0072] Digest at 37°C for 30 min, run gel electrophoresis, and recover the linearized viral plasmid.
[0073] S2. Amplification and purification of the GFP gene
[0074] 1. Amplification of the GFP gene fragment, the reaction system is shown in Table 3, and the reaction program is shown in Table 4.
[0075] Table 3 Amplification system of the GFP gene fragment
[0076]
[0077] Among them, GFP-F:
[0078] GCTGTGACCGGCGCCTACTCTAGAGCTAGCGAATTCGCCGCCACC ATGGCCTTACCAGTGACC (SEQ ID NO:3);
[0079] GFP-R: TGTAATCCAGAGGTTGATTGTCGACCAGGTGGATCCTTAGC GAGGGGGCAGGGCCTGCATGT (SEQ ID NO:4).
[0080] Table 4 Reaction program for GFP gene amplification
[0081]
[0082]
[0083] 2. Purification and recovery of PCR products.
[0084] 2.1 Cut out the target fragment and purify and recover it.
[0085] Concentration before recovery: 75 ng / ul, total amount: 1500 ng;
[0086] Concentration after recovery: 25 ng / ul, total amount: 500 ng;
[0087] 2.2 Process of gel recovery
[0088] (1) Gel cutting: Cut the gel under ultraviolet light and weigh it. Then crush the gel block with a pipette tip.
[0089] It is best to use a disposable blade for gel cutting, and wipe the experimental bench, etc. as clean as possible with ethanol.
[0090] The mass of the gel can be calculated by the difference in mass between the empty EP tube and the EP tube containing the gel. Note that when cutting the gel, try to avoid cutting the gel outside the band and avoid excessive ultraviolet exposure time.
[0091] Don't forget that the gel strip has a thickness, and try to cut off the extra parts at the front and back as well.
[0092] If you feel the feel is not good, you can try the gel cutting tool:
[0093] (2) Gel solubilization: Add 1 μL of membrane binding solution (MB) to every 1 mg of gel, add MB in a ratio of 1:1, and dissolve it in a water bath at 55 °C. Vortex and mix every 1 - 2 minutes, and keep it in the water bath for at least 1 - 2 minutes after dissolution to ensure that the gel block is completely dissolved.
[0094] During electrophoresis, DNA binds tightly to macromolecular polysaccharides. Different types and qualities of gels result in different binding forces with DNA. Only when the gel is fully dissolved can DNA be fully released. Otherwise, the gel will precipitate with the DNA, affecting the purity of the recovery result after elution.
[0095] (3) Binding: Transfer the sol to the purification column, centrifuge at 12000 rpm for 1 min, pour out the waste liquid in the collection tube, and reinsert the purification column into the collection tube.
[0096] After the gel block is completely dissolved, it is best to cool the gel solution to room temperature before loading it onto the column because the purification column has a weaker ability to bind DNA at higher temperatures.
[0097] Pay attention to placing the centrifuge tubes symmetrically during centrifugation.
[0098] (4) Rinsing: Add 600 μL of rinsing solution (previously added with absolute ethanol) to the center of the purification column, centrifuge at 12000 rpm for 30 s, and remove the waste liquid. After repeating once, centrifuge the purification column with the lid open for 2 min to completely remove the ethanol in the residual rinsing solution.
[0099] The center of the purification column is made of silicon-based material, which can adsorb DNA in a high-salt environment and release DNA in a low-salt environment.
[0100] Residual ethanol in the rinsing solution will affect subsequent experiments such as digestion and PCR.
[0101] (5) Elution: Place the purification column in a 1.5 mL centrifuge tube, add 30 μL of elution buffer or sterile water to the center of the purification column, let it stand for 1 min, and then centrifuge at 12000 rpm for 1 min to elute the DNA.
[0102] Be sure to add the elution buffer or sterile water to the center of the purification column. If it adheres to the tube wall, shake the centrifuge tube to make the liquid slide to the bottom of the tube so that it can be absorbed by the purification column.
[0103] (6) Storage: Store the obtained DNA fragment at -20 °C or use it directly for subsequent experiments.
[0104] S3. Ligation
[0105] 1. Add each component according to the reaction system shown in Table 5 below and ligate at 50 °C for 30 min.
[0106] Table 5 Ligation of GFP gene and linearized vector
[0107]
[0108] S4. Transformation
[0109] 1. Add 7 μl of ligation solution to 70 μl of competent cells. After incubation on ice for 30 min, heat shock at 42 °C for 1 min, incubate at 0 °C for 2 min, and spread on 2xYT (Kan) plates after 1 h of recovery.
[0110] 2. Screening of positive clones
[0111] Pick 6 single colonies into 4 ml of 2×YT (Kan) medium respectively, culture at 37 °C and 250 rpm for 14 - 16 h, extract plasmids, and send the plasmids with appropriate height for sequencing.
[0112] S5. Sequencing
[0113] Sequence the positive clones using the ABI 3730XL sequencing platform. The expected GFP fragment is obtained, indicating that the lentiviral recombinant vector pCDH-EF1-LUC-P2A-copGFP-T2A-Puro has been successfully constructed.
[0114] S6. Virus rescue
[0115] 1) Use an endotoxin removal kit (purchased from Beijing Biolab Technology Co., Ltd.) to remove the endotoxin of the lentiviral recombinant vector. Detect the quality of the endotoxin-free extracted lentiviral recombinant vector. The results are shown in Table 6.
[0116] Table 6 Quality detection results of lentiviral recombinant vector
[0117]
[0118] 2) Co-transfect 293T cells with the lentiviral recombinant vector and the helper plasmid. The specific steps are as follows:
[0119] Add 5 μL of virus at a cell density of 1.5×10 5 cells / well in a 12-well plate, infect for 72 h, and observe the cells under an optical fiber microscope and a fluorescence microscope respectively. The fluorescence image of the infected 293T cells is shown in Figure 1 .
[0120] 3) Incubate for about 48 - 72 h, and collect the supernatant containing the virus.
[0121] 4) Purification and concentration of the virus.
[0122] a. Preparation of 5×PEG8000 + NaCl solution: Weigh 8.766 g of NaCl and 50 g of PEG8000, dissolve them in 200 ml of pure water, sterilize at 121 °C for 30 min; store at 4 °C.
[0123] b. Filter the lentiviral supernatant using a 0.45 μm filter head;
[0124] c. For every 30 ml of the filtered initial virus solution, add 7.5 ml of the 5×PEG-8000 + NaCl mother solution;
[0125] d. Mix once every 20 - 30 minutes for a total of 3 - 5 times;
[0126] e. Place at 4°C overnight;
[0127] f. Centrifuge at 4°C and 4000g for 20 minutes;
[0128] g. Aspirate the supernatant, let the tube stand for 1 - 2 minutes, and aspirate the remaining liquid;
[0129] h. Add an appropriate amount of lentivirus lysate to dissolve the recombinant lentivirus precipitate;
[0130] 5) Aliquot and store at -80°C.
[0131] 2. Experimental methods for recombinant cells
[0132] 2.1 Puromycin drug screening pre-experiment for Y79 cells
[0133] 1) On the first day, inoculate 5 wells of a 12-well plate with 2×10 5 cells per well;
[0134] 2) On the second day, observe whether the cell density is around 30% - 50%. If the density is appropriate, select 4 wells and add puromycin with final concentrations of 0.5, 0.8, 1, and 1.5 μg / mL respectively to start the drug screening. Leave the remaining well as a blank control;
[0135] 3) Observe the drug screening wells every day thereafter, and select the dose at which Y79 cells are completely screened to death at 2 - 3 days as the optimal drug screening dose.
[0136] 2.2 Virus infection pre-experiment
[0137] 1) On the first day, inoculate 5 wells of a 6-well plate with 4.5×10 5 cells per well;
[0138] 2) On the second day, replace the cell medium with fresh medium and add Polybrene, then add the corresponding amounts of pCDH-EF1-LUC-P2A-copGFP-T2A-Puro lentivirus according to the MOI gradients of 5, 10, 15, and 20. Leave the remaining well as a blank control;
[0139] 3) Observe the cell status under the microscope 48 hours after transfection;
[0140] 4) After the cells are confluent, passage and purification culture are carried out according to the transduction situation of the cells. Observation indicators: cell status, fluorescence efficiency, etc.
[0141] 2.3 Formal drug screening experiment
[0142] 1) Passage the two cell lines of Y79 and Y79 / pCDH-LUC-copGFP (the cell line with the best MOI in the infection pre-experiment), inoculate them into 6-well plates in a certain amount, one well for each cell line;
[0143] 2) The next day, change the medium of the two wells of cells, and perform drug screening using the best drug screening dose in the Puromycin drug screening pre-experiment;
[0144] 3) Change the medium every 2 days after drug screening until the blank Y79 cells are completely screened to death, and then change to normal medium to continue culturing Y79 / pCDH-LUC-copGFP cells;
[0145] 4) When the Y79 / pCDH-LUC-copGFP cells are amplified and cultured to a sufficient cell quantity, a part of the cells are used for monoclonal plating and then clone sorting, and the rest are cryopreserved for storage.
[0146] 2.4 Monoclonal screening and identification
[0147] 1) Dilute the cells to 1 cell / 100 μL using the limited dilution method, and then add 100 μL of cell suspension to each well;
[0148] 2) Observe under the microscope after culturing for a period of time and mark the single clone cell wells;
[0149] 3) When the cells grow to 70% - 80%, digest and passage them for amplification culture. When the cell quantity is sufficient, a part of the cells are used for qPCR to detect gene expression, and a part continue to be cultured;
[0150] 4) The cloned cells after the qPCR detection of gene expression results are confirmed are passaged for amplification culture and cryopreserved for storage.
[0151] 3. Experimental results
[0152] 3.1 Results of the Y79 cell drug screening pre-experiment
[0153] The pictures of the screening experiment are as Figure 2 . Perform a drug screening pre-experiment on Y79 cells at gradient concentrations. It can be seen that after 48 hours of drug screening with 4 concentration measurements of Puromycin at 0.5, 0.8, 1, and 1.5 μg / mL, the Y79 cells at the drug screening concentrations of 0.8, 1, and 1.5 μg / mL are all completely dead, and the cell death rate at the drug screening concentration of 0.5 μg / mL reaches more than 90%. Therefore, a drug concentration of 0.5 μg / mL can be used for subsequent drug screening.
[0154] 2. Results of virus infection experiment
[0155] After adding the recombinant lentivirus packaged with pCDH-EF1-LUC-P2A-copGFP-T2A-Puro at MOI gradients of 5, 10, 15, and 20 for 72 hours, the cell state was normal. When MOI was 10, the cell fluorescence efficiency could reach 90%, as Figure 3 shown.
[0156] 3. Results of formal drug screening experiment
[0157] After 48 hours of drug screening with 0.5 μg Puromymic on Y79 / pCDH-LUC-copGFP cells, the survival rate of the cells reached over 90%, and the fluorescence efficiency reached over 90%. The screening pictures are as Figure 4 shown.
[0158] 4. Cell cryopreservation
[0159] Four monoclonal cell lines of Y79 / pCDH-LUC-copGFP, namely 1, 2, 3, and 4, and Y79 cells were subjected to Q-PCR to detect the expression of Luciferase and copGFP genes. After determining the gene expression, two cell lines with higher expression of Luciferase and copGFP genes, Y79 / pCDH-LUC-cop GFP-clone3 / 4, were selected for amplification culture of the corresponding monoclonal cells. The cell state and fluorescence were normal. The pictures before cell cryopreservation are as Figure 5 shown.
[0160] II. Method for detecting gene overexpression by qRT-PCR
[0161] 1. Materials
[0162] 1.1 Instrument and equipment
[0163] 1) Pipettes with various ranges;
[0164] 2) Real-time fluorescence quantitative PCR instrument;
[0165] 3) Small high-speed centrifuge;
[0166] 4) Microcentrifuge;
[0167] 5) Ultra-micro spectrophotometer.
[0168] 1.2 Consumables
[0169] 1) Tips with various specifications;
[0170] 2) 1.5 mL EP tubes (Axygen, MCT-150-C);
[0171] 3) 0.2 mL PCR thin-walled eight-strip tubes (Axygen, PCR-0208-C);
[0172] 4) 0.2 mL PCR eight-strip tube flat caps (Axygen, PCR-2CP-RT-C);
[0173] 5) Latex gloves (domestic);
[0174] 6) Disposable masks (domestic).
[0175] 1.3 Reagents
[0176] 1) Trizol Reagent;
[0177] 2) Absolute ethanol (domestic analytical grade);
[0178] 3) DEPC-treated water;
[0179] 4) Reverse transcription kit (Transgen Biotech, AU311)
[0180] 5) SYBR Green Realtime PCR MasterMix;
[0181] 6) Primer solutions for 100p Luciferase and copGFP;
[0182] 7) Primer solution for internal reference GAPDH.
[0183] The primer sequences for qPCR are shown in Table 7.
[0184] Table 7 Primer Sequences
[0185]
[0186] 2. Experimental Methods
[0187] 2.1 RNA Extraction
[0188] 1) Take a certain amount of Y79 / pCDH-LUC-copGFP-Clone1 / 2 / 3 / 4 cloned cells for RNA extraction;
[0189] 2) Discard the culture medium, wash the cells once with 1 mL of PBS, then add 1 mL of Trizol, pipette the cells repeatedly, and let stand at room temperature for 5 minutes to lyse the cells;
[0190] 3) After 5 minutes, add 0.2 times the volume of chloroform, shake for 15 seconds, and let stand at room temperature for 5 minutes;
[0191] 4) Centrifuge at 12,000 rpm for 10 minutes;
[0192] 5) Aspirate the upper aqueous phase into a new EP tube, then add an equal volume of 75% ethanol and invert to mix well;
[0193] 6) Transfer the mixture to an adsorption column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate in the collection tube;
[0194] 7) Add 600 μL of protein removal solution to the centrifuge column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate in the collection tube;
[0195] 8) Add 600 μL of washing solution to the centrifuge column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate in the collection tube;
[0196] 9) Repeat the previous step;
[0197] 10) Centrifuge empty at 12,000 rpm for 2 min;
[0198] 11) Place the adsorption column in a 1.5 mL EP tube for 2 - 3 min to fully remove the residual ethanol;
[0199] 12) Add 50 μL of DEPC water, cover the lid, and let it stand at room temperature for 3 min to dissolve the RNA precipitate;
[0200] 13) Centrifuge at 12,000 rpm for 2 min;
[0201] 14) Measure the concentration and purity of the extracted RNA using a ultra - micro spectrophotometer and store at - 80 °C.
[0202] 2.2 Reverse transcription
[0203] 1) According to the kit requirements, the reaction system is shown in Table 8.
[0204] Table 8 Reverse transcription reaction system
[0205]
[0206]
[0207] 2) Reaction conditions:
[0208] 50 °C for 30 min;
[0209] 85 °C for 5 s;
[0210] 15 °C ∞.
[0211] 2.3 q - PCR detection of gene expression level
[0212] 1) The reaction system is shown in Table 9.
[0213] Table 9 Reaction system for q-PCR detection
[0214] Component Concentration Added volume Final concentration SYBR Green Realtime PCR Master 2× 10 μL 1× Forward primer 10 μM 0.8 μL 0.4 μM Reverse primer 10 μM 0.8 μL 0.4 μM Sample solution 2 μL <![CDATA[ddH2O]]> 4 μL Total volume 20 μL
[0215] 2) Reaction conditions and melting curve analysis:
[0216] Reaction conditions: 95°C for 10 min; 95°C for 30 s, 60°C for 1 min, 40 cycles; 95°C for 1 min, 55°C for 30 s, 95°C for 30 s.
[0217] III. Experimental results
[0218] 1. The melting curve is shown in Figure 6 .
[0219] 2. The results of overexpression analysis of the target genes Luciferase and copGFP are shown in Table 10.
[0220] Table 10 Expression results of Luciferase and copGFP
[0221]
[0222] It can be seen from the qPCR results that compared with the Y79 blank cells, the Luciferase and copGFP genes are overexpressed in the Y79-pCDH-LUC-Clone 1 / 2 / 3 / 4 stable transfected clones. Among them, the overexpression levels of the Luciferase and copGFP genes in Y79-pCDH-LUC-Clone 3 and Y79-pCDH-LUC-Clone4 are relatively high. Therefore, these two cell lines are selected as the modeling cells.
[0223] Example 2
[0224] A method for constructing a mouse model of retinoblastoma
[0225] 1. Description of animal and cell sources
[0226] Animals: BALB / c-nu mice, 4 - 6 weeks old, 15 - 25 g, female, 6 mice. Quality attribute: The purchased batch is negative for mycoplasma contamination detection and sterility detection.
[0227] Cells: Y79 / luciferase+CopGFP gene overexpressing monoclonal stable transfected cell line (CELL-2022030) (Y-79 / pCDH-luciferase+CopGFP-puro-Clone3). Used after cell culture proliferation and counting.
[0228] 2. Instruments, reagents and consumables
[0229] 1.5 mL EP tubes, DMEM medium, Gibco fetal bovine serum, optical inverted microscope, 37°C 5% CO2 cell culture incubator, biosafety cabinet, electronic balance, sodium pentobarbital, proparacaine hydrochloride eye drops, antibiotics, 33G ophthalmic needle, insulin needle, fluorescence microscope, slit lamp.
[0230] 3. Operating procedures
[0231] (1) Anesthetize the animal with sodium pentobarbital and perform local surface anesthesia by instilling 1 - 2 drops of mydriatic, proparacaine hydrochloride eye drops.
[0232] (2) Open the eyelid by hand, protrude the eye to expose the eye diameter for convenient injection, and operate under a stereomicroscope or surgical microscope. Keep the protruded eye in position until the injection is completed. To firmly hold the eyeball, place the finger on the outer side of the orbital margin for fixation to prevent needle displacement during injection. Expose the upper nasal area of the eye.
[0233] (3) Use an insulin needle to puncture the sclera in the upper nasal area of the eyeball. A small amount of vitreous humor will drain from the posterior chamber through the puncture hole. Avoid contacting the eye muscles and blood vessels. Use a 33G ophthalmic needle to insert through the pre-puncture hole into the vitreous body at a 45° angle, inject 3 μL of the solution into the vitreous body, and hold it in place for a few seconds, then gently remove the needle. Avoid contacting the lens and intraocular tissues.
[0234] (4) After intravitreal injection, instill ofloxacin eye drops, and provide a warming pad for the animal to keep warm during this period. After the operation, place it in an incubator until the animal fully wakes up.
[0235] (5) Observe the animals daily after inoculation, including: appearance, signs, behavioral activities, glandular secretions, respiration, fecal characteristics, diet, animal death, etc. Weigh the animals twice a week. Perform a slit lamp examination and fluorescence examination once before modeling and approximately once a week after modeling. Dissect the eyeballs grossly, perform HE staining, and observe the tumor metastasis situation.
[0236] The tumor growth was observed with a slit lamp, and the results were as follows:
[0237] The tumors in all 6 mice grew normally. The tumor formation rate was 100%. The observation results of the eyeballs are shown in Figure 7 .
[0238] a is before the injection of tumor cells. The eyeball is clear and transparent, the blood vessels are evenly clear, and the pupil is round with a clear boundary.
[0239] b is 3D after the injection of tumor cells. A gray cloud-like substance appears, accounting for about 1 / 2. There is little hyperplasia of blood vessels, and the majority of blood vessel directions remain unchanged. The eyeball is clear but not transparent, and the pupil is round with a slightly changed but clear boundary.
[0240] 7 days after the injection of c tumor cells, it accounts for about 1 / 2. The gray cloud-like substance turns white, resembling leukocoria. There is more blood vessel proliferation, and the direction of most blood vessels remains unchanged. The eyeball is clear but not transparent, and the pupil is irregular with a clear boundary.
[0241] 11 days after the injection of d tumor cells, the mass area increases and turns white, accounting for about 3 / 4. The gray cloud-like substance turns white more severely, and there is more blood vessel proliferation. The direction of most blood vessels remains unchanged. The eyeball is clear but not transparent, and the pupil is irregular with a clear boundary.
[0242] 15 days after the injection of e tumor cells, the mass increases and turns white, occupying the entire eyeball. It is a white cloud-like substance. The direction of most blood vessels is irregular, and the direction of a few blood vessels remains unchanged. The eyeball is clear but not transparent, and the pupil is irregular with a clear boundary.
[0243] 19 days after the injection of f tumor cells, the mass covers the entire eyeball, showing uniform white, accompanied by irregular blood vessel growth. Almost no normal blood vessels can be seen. The eyeball is clear but not transparent, and the pupil is irregular with a blurred boundary.
[0244] 23 days after the injection of g tumor cells, the mass covers the entire eyeball, showing uniform white. The eyeball bulges, accompanied by irregular blood vessel growth. The blood vessels are uneven in thickness, and there are no normal blood vessels. The eyeball is clear but not transparent, and the pupil disappears.
[0245] 27 days after the injection of h tumor cells, the mass covers the entire eyeball, showing uniform white. The eyeball continues to bulge and protrude, accompanied by irregular blood vessel growth. The blood vessels are uneven in thickness, and there are no normal blood vessels. The eyeball is clear but not transparent, the pupil disappears, and local avascular areas begin to appear.
[0246] 31 days after the injection of i tumor cells, the mass covers the entire eyeball, and the uniform white deepens. The eyeball continues to bulge and protrude, accompanied by irregular blood vessel growth. The blood vessels are uneven in thickness, and there are no normal blood vessels. The eyeball is clear but not transparent, the pupil disappears, and the local avascular areas increase in number and size.
[0247] 35 days after the injection of j tumor cells, the mass covers the entire eyeball, and the uniform white deepens. The eyeball continues to bulge and protrude, accompanied by irregular blood vessel growth. The blood vessels are uneven in thickness, and there are no normal blood vessels. The eyeball is clear but not transparent, the pupil disappears, the local avascular areas increase in number and size, and there is a tendency for local white substances to protrude outward.
[0248] 39 days after the injection of k tumor cells, the mass covers the entire eyeball, and the uniform white deepens. The eyeball continues to bulge and protrude, accompanied by irregular blood vessel growth. The blood vessels are uneven in thickness, and there is local blood exudation. There are no normal blood vessels. The eyeball is clear but not transparent, the pupil disappears, the local avascular areas increase in number and size, and local white substances protrude.
[0249] 49 days after the injection of tumor cells, the eyeball protruded, the tumor protruded outside the orbit, blood vessels ruptured and a large amount of blood oozed out, the blood vessels thickened, there were no normal blood vessels, the eyeball was turbid, and the pupil disappeared.
[0250] The flux was monitored by fluorescence imaging, and the results are shown in Table 11 and Figure 8 .
[0251] Table 11 Fluorescence intensity after transplantation of retinoblastoma cells at different times
[0252]
[0253]
[0254] The growth of the tumor was quantitatively evaluated by fluorescence imaging. The results showed that the tumor gradually increased in size and the fluorescence intensity gradually increased after transplantation of retinoblastoma cells at different times, which was basically consistent with the observation of tumor growth by slit lamp.
[0255] The results of HE staining are shown in Figure 9 . Figure 9 In Figure A, the staining result of the left eye (control) is as follows: the structures of the cornea, choroid, iris, sclera, and conjunctiva are normal and clearly visible, and the lens is normal. The structure of the conjunctival mucosa layer is complete, the epithelial cells are arranged neatly, goblet cells are abundant, and there is no necrosis and inflammatory cell infiltration in the mucosa layer and submucosa layer, and no tumor metastasis is seen (H-E staining, 40×). Figure 9 In Figure B, the staining result of the right eye (model eye) is as follows: tumor cells proliferate into clusters, the morphological differences of tumor cells are very large, the tumor grows in a mass-like manner, contains rosette tumor cells, the cell sizes are uneven, round, oval or irregular, there are large vesicular nuclei or deeply stained small nuclei, and abundant mitotic figures can be seen. The retinal structure is damaged and there is focal light-stained granular necrosis, and tumor cells also grow in the sclera and choroid (HE staining, 100×).
[0256] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A method for constructing a mouse model of retinoblastoma, characterized in that, Comprising the following steps: Relieve the pressure of the mouse sclera and inject retinoblastoma cells into the vitreous body; The method for relieving the pressure of the mouse sclera is to puncture the sclera in the upper nasal area of the eyeball and expel part of the vitreous body from the puncture hole; The retinoblastoma cells are a monoclonal stable transfected cell line with overexpression of Y79 / luciferase+CopGFP genes.
2. The construction method according to claim 1, wherein The retinoblastoma cells are injected in the form of a suspension; the injection volume of the retinoblastoma cell suspension is 2.8-3.2 μL; The density of the retinoblastoma cell suspension is (1.0 - 1.5)×10 7 / mL.
3. The construction method according to claim 1, characterized in that The nucleotide sequence of the luciferase gene is shown in SEQ ID NO:
1.
4. The construction method according to claim 1, wherein The nucleotide sequence of the CopGFP gene is shown in SEQ ID NO:
2.
5. The construction method according to claim 1, characterized in that The injection is performed using a 33G ophthalmic needle; After the injection is completed, keep the 33G ophthalmic needle at the injection position for several seconds.
6. The construction method according to claim 1, characterized in that After the injection, it also includes dropping ofloxacin eye drops into the mouse eyes.
Citation Information
Patent Citations
Method for modeling intraocular retinoblastoma
RU2709147C1