Use of FOXO1 in the prevention and treatment of calcific aortic valve disease

Abstract

This invention belongs to the field of biomedical technology, specifically disclosing the use of FOXO1 in the prevention and treatment of calcific aortic valve disease. It mainly involves the application of FOXO1 or its expression-promoting agents in the prevention and treatment of calcific aortic valve disease, and the application of FOXO1 in the preparation of animal models of calcific aortic valve disease. This invention increases or maintains FOXO1 expression to maintain the binding of FOXO1 to Runx2, and further maintains the normal valvular mechanism levels, thereby preventing and alleviating the occurrence of calcific aortic valve disease. Simultaneously, this invention also provides a new animal model for the study of calcific aortic valve disease, facilitating subsequent research on this condition.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to the use of FOXO1 in the prevention and treatment of calcified aortic valve disease. Background Technology

[0002] With the aging of the global population, calcific aortic valve disease (CAVD) has gradually become the most common valvular heart disease, seriously endangering human health. Currently, the only effective treatment for CAVD in clinical practice is aortic valve replacement surgery, but it has disadvantages such as high risk, heavy economic burden, and many complications. Existing artificial valve replacements all have certain limitations. However, all clinical trials have not yet found drugs that can effectively treat and prevent CAVD. Therefore, studying the pathogenesis of CAVD and finding therapeutic targets is of great clinical significance.

[0003] The pathogenesis of CAVD is currently believed to be related to factors such as mechanical stimulation, endothelial injury, lipid deposition, and inflammation. Under the stimulation of multiple factors, the expression of osteoblast-related proteins such as Runx2 and OPN in valvular interstitial cells increases, leading to osteoblast-like differentiation of cells, promoting calcium salt deposition, and ultimately resulting in valvular calcification. Therefore, the osteoblast-like differentiation process of valvular interstitial cells plays an important role, and in-depth research on the mechanism of this process is of great significance.

[0004] The osteoblast-like differentiation of valvular interstitial cells involves multiple signaling pathways, among which Runx2 is considered a major transcriptional regulator of osteoblast formation. The PI3K-AKT signaling pathway is one of the key pathways for osteoblast differentiation, and it can mediate Runx2-mediated vascular calcification. FOXO1, as an important downstream molecule of the PI3K-AKT signaling pathway, has been shown to play an important role in various disease areas. FOXO1 can interact with Runx2 protein and participate in atherosclerosis and vascular calcification, but the role of FOXO1 in valvular calcification disease remains unclear. Summary of the Invention

[0005] To address the aforementioned issues, this invention provides the use of FOXO1 in the prevention and treatment of calcified aortic valve disease. It mainly clarifies the treatable pathways for valvular calcification by verifying the role of FOXO1 in valvular calcification, supplements and improves the treatment methods for valvular calcification, and provides a new method for preparing disease models for valvular calcification.

[0006] To solve the above problems, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention relates toThe application of FOXO1 or FOXO1 expression promoters in the prevention and treatment of calcific aortic valve disease. FOXO1 acts directly to prevent and treat calcific aortic valve disease, while FOXO1 expression promoters work by promoting FOXO1 expression. Prevention and treatment both aim to maintain the body's normal function and prevent or alleviate disease progression.

[0008] The effect of FOXO1 or its expression-promoting agents is at least one of the following:

[0009] 1) Inhibit Runx2 and OPN expression.

[0010] 2) Inhibits osteoblast-like differentiation of aortic valve interstitial cells.

[0011] 3) Increases the binding of FOXO1 to Runx2 protein and promotes Runx2 ubiquitination and degradation.

[0012] Regarding the FOXO1 expression-enhancing agent, the FOXO1 expression-enhancing agent is at least one of FOXO1 overexpressing adenovirus, FOXO1 overexpressing adeno-associated virus, and FOXO1 overexpressing chronic viral vector. The FOXO1 overexpressing adenovirus can be prepared by existing methods, which are conventional methods in the field and will not be elaborated on here. Specifically, it can be human ORF pre-prepared adenovirus, FOXO1 overexpressing adeno-associated virus (AAV), or FOXO1 overexpressing chronic viral vector (LV-CA-FOXO1). All of these methods increase FOXO1 expression and exert their effects by enhancing FOXO1 expression.

[0013] The second aspect of the present invention relates to The application of FOXO1 in the preparation of biological models of calcified aortic valves, wherein FOXO1 is an inhibitory target. FOXO1 provides a target for the preparation of biological models of calcified aortic valves, thereby enabling the acquisition of such models. The biological model can be an animal model or a cell model.

[0014] In specific applications, when FOXO1 is used as a target, the application is the use of FOXO1 inhibitors in the preparation of animal models of calcified aortic valves. By inhibiting FOXO1 expression, the expression of FOXO1 in the animal model is suppressed, and the binding of FOXO1 to Runx2 is reduced by inhibiting FOXO1 expression, while promoting the expression of Runx2 and OPN.

[0015] More specifically, biological models can be cell models or animal models. In addition to cell models, the most commonly used biological model is the C57 strain of ApoE and LDLR gene-deficient mice fed a high-fat Western diet. In recent years, some new animal models have emerged, including: PCSK9-AAV8 injected C57 strain mice fed a high-fat Western diet; and the aortic valve guidewire injury model, etc.

[0016] In biological models, the inhibitors of FOXO1 exert their effects in at least one of the following ways, and through corresponding regulatory mechanisms, ultimately lead to calcific aortic valve disease:

[0017] 1) Inhibit FOXO1 binding to Runx2,

[0018] 2) Suppress the ubiquitination modification of Runx2.

[0019] 3) Promotes osteoblast-like differentiation of valvular interstitial cells.

[0020] 4) Increases calcium salt deposition in the aortic valve.

[0021] 5) Increases collagen formation in the aortic valve.

[0022] Regarding FOXO1 inhibitors, the FOXO1 inhibitors are at least FOXO1-specific small molecule inhibitors or other feasible inhibitors (such as siRNA or shRNA, which can be specifically designed using existing methods), all of which can inhibit FOXO1 expression and reduce the inhibitory effect of FOXO1 on Runx2. The FOXO1-specific small molecule inhibitor can be AS1842856, CAS No.: 836620-48-5. For example, shRNA can be a FoxO1 interfering adenovirus (Sh-FoxO1), and siRNA can specifically be siFOXO1-s: 5'-GCGCCGACUUCAUGAGCAAdTdT-3', siFOXO1-as: 5'-UUGCUCAUGAAGUCGGCGCdTdT-3', etc.

[0023] In terms of animal models, they can serve as research models, allowing for further reconstruction and study of calcified aortic valve disease, thus facilitating a deeper understanding of the disease. Common forms of animal models include mouse models or other suitable animal models.

[0024] The beneficial effects of this invention are:

[0025] By increasing or maintaining FOXO1 expression to preserve the binding of FOXO1 to Runx2 and further maintaining the normal valvular function levels, this invention aims to prevent and alleviate the occurrence of calcific aortic valve disease. Simultaneously, this invention provides a new animal model for the study of calcific aortic valve disease, facilitating subsequent research on this condition. Attached Figure Description

[0026] Figure 1 The results showed that FOXO1 expression was downregulated in calcified aortic valves;

[0027] Figure 2 FOXO1 showed that it inhibited osteoblast-like differentiation of aortic valve interstitial cells;

[0028] Figure 3 The results showed that AS1842856 activates FOXO1 phosphorylation, which promotes osteoblast-like differentiation of valvular interstitial cells.

[0029] Figure 4 The AS1842856 strain exacerbated aortic valve calcification in ApoEKO mice fed a high-fat diet.

[0030] Figure 5 The study showed that FOXO1 binds to Runx2 and promotes its ubiquitination and degradation. AS1842856 inhibits FOXO1 binding to Runx2 and inhibits the ubiquitination modification of Runx2 by activating FOXO1 phosphorylation. Detailed Implementation

[0031] The invention will now be further described with reference to the accompanying drawings.

[0032] Experimental methods

[0033] 1. Collection of aortic valve tissue samples

[0034] In accordance with the Declaration of Helsinki and with the approval of the Ethics Committee of Tongji Medical College, Huazhong University of Science and Technology, all tissue specimens in this study were collected after obtaining informed consent from the surgical patients and obtaining their signed informed consent forms. Control valve tissue specimens were collected from patients who underwent heart transplantation surgery at the Department of Cardiac and Vascular Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, and whose aortic valves showed no significant lesions. Calcified valve tissue specimens were collected from patients who underwent aortic valve replacement surgery. All of the above valve specimens were natural tricuspid aortic valves.

[0035] Aortic valve tissue collection strictly adhered to aseptic principles. During the procedure, three aortic valve pieces were cut off and immediately rinsed with sterile cold saline. One valve was immediately placed in a cryovial and stored in liquid nitrogen for use in ice cutting, RNA and protein extraction, etc.; one valve was fixed in paraformaldehyde solution for embedding and immunohistochemical staining; and one valve was placed in sterile DMEM for primary AVIC extraction.

[0036] 2. Western blot (WB) assay

[0037] (I) Extraction of proteins from human aortic valve tissue

[0038] (1) Wash the ceramic mortar and pestle with clean water, pour in a small amount of 95% alcohol and ignite it, and burn for several minutes until the flame is almost gone to remove any remaining mixed protein.

[0039] (2) After the mortar and pestle have returned to room temperature, the aortic valve tissue is placed in and ground repeatedly with the grinding rod. During this process, liquid nitrogen is poured into the mortar several times to keep the aortic valve tissue frozen solid.

[0040] (3) After the aortic valve tissue is thoroughly ground into powder, the powder is transferred to a sterile 1.5 ml EP tube and weighed. Freshly prepared RIPA mixture is added to the EP tube at a ratio of 100 μL protein lysis buffer per 20 mg of valve tissue, wherein the ratio of RIPA lysis buffer to protease inhibitor is 100:1. Shake thoroughly to mix well.

[0041] (4) Place the above EP tube in an ice bath environment and use an ultrasonic cell disruptor at 8% power, with an interval of 2 seconds, for 10 seconds, for a total of 8-10 times.

[0042] (5) After balancing the ultrasonic EP tube, place it in a high-speed centrifuge and centrifuge at 4°C and 12,000 rpm for 15 min.

[0043] (6) After centrifugation, carefully transfer the supernatant from the EP tube to a new, pre-cooled 1.5 mL EP tube using a pipette to obtain the total protein sample from the tissue. Record the total volume of the protein solution. The sample can be used for subsequent protein experiments or stored at -80°C for long-term preservation.

[0044] (II) Extraction of total protein from human aortic valve interstitial cells

[0045] (1) Discard the culture medium in the culture plate or culture dish, add pre-cooled PBS along the side wall with a pipette, gently shake and wash, repeat 3 times and then discard the PBS.

[0046] (2) Prepare RIPA mixture at a ratio of RIPA: protein phosphatase inhibitor = 100:1. After pre-cooling, add 120 μL per well to a six-well plate containing cell samples. Gently shake to mix and place on ice for 30 minutes to allow for complete lysis.

[0047] (3) After drying and pre-cooling the washed cell scraper, scrape the cells from the well plate and transfer the cell suspension to a pre-cooled sterile 1.5mL EP tube.

[0048] (4) Place the above EP tube in an ice bath environment and use an ultrasonic cell disruptor at 6% power, with an interval of 2 seconds and a working time of 1 second, for a total of 8-10 ultrasonic cycles.

[0049] (5) After sonicating, the protein lysis buffer was balanced and placed in a pre-cooled high-speed centrifuge and centrifuged at 4°C and 12,000 rpm for 15 min.

[0050] (6) After centrifugation, carefully transfer the supernatant from the EP tube to a new, pre-chilled 1.5 mL EP tube using a pipette to obtain the total protein sample from the cells. Record the total volume of the protein solution. The sample can be used for subsequent protein experiments or stored at -80°C for long-term storage.

[0051] (III) SDS-PAGE electrophoresis

[0052] (1) Use the Bio-rad vertical electrophoresis apparatus and install the electrophoresis gel according to the instructions.

[0053] (2) Design the protein loading sequence according to the experimental requirements, and add 3 μL of Pre-Stained Protein Standard Marker to each of the two loading wells of the protein sample.

[0054] (3) After the sample is applied, add electrophoresis solution to the outer tank of the electrophoresis apparatus until the liquid level exceeds the indicator line of the outer tank. Cover the electrophoresis apparatus and set the voltage to 100-160V. Electrophoresis will be performed after 30-60 minutes.

[0055] (4) In this experiment, based on the instructions for different concentrations of pre-mixed adhesive, the pre-mixed adhesive with a concentration of 8%, 10% or 4-20% was mainly selected.

[0056] (iv) SDS-PAGE transfer

[0057] (1) In this experiment, a 0.2 μm pore size PVDF membrane from Millipore was selected. The PVDF membrane was cut to a suitable size according to the experimental requirements, immersed in methanol for 30 seconds to activate it, and then taken out and immersed in the equilibration solution for 30 seconds.

[0058] (3) Take the required number of sponge pads, open the transfer clamp, and place the sponge pads in the appropriate position on the transfer clamp.

[0059] (4) Place the soaked PVDF membrane on a sponge pad.

[0060] (5) After rinsing the gel plate with pure water (to clean the electrophoresis solution around the gel), pry it open, take out the gel and cover the surface of the PVDF membrane, with the gel on the side containing the larger protein molecular weight as close as possible to the bottom of the transfer clamp.

[0061] (6) Gently remove air bubbles between the PVDF membrane and gel using the degassing roller, which has been moistened with pure water. Then place a sponge pad on the gel, close the transfer clamp, and place it in the rapid transfer apparatus. The transfer system, from positive to negative, is as follows: positive electrode, sponge, PVDF membrane, gel, sponge, negative electrode. After correct installation, start the program to begin the transfer.

[0062] (7) Set different transfer programs according to the molecular weight of the target protein (10 minutes for proteins with a molecular weight of less than 20 kDa; 16 minutes and 30 seconds for proteins with a molecular weight between 20 and 180 kDa; and 21 minutes for proteins with a molecular weight of more than 180 kDa).

[0063] (8) After the transfer is completed, remove the transfer clamp and quickly put the PVDF membrane into the rapid sealing solution for sealing. Shake slowly on a shaker at room temperature for 10-15 minutes.

[0064] (V) Antibody incubation

[0065] (1) After sealing, remove the PVDF membrane and wash it three times with the prepared TBST solution on a shaker for 10 minutes each time.

[0066] (2) After washing, according to the position of the protein marker and the molecular weight of the target protein, cut the PDVF membrane into several strips of appropriate width, put them into centrifuge tubes containing primary antibody, and place them in a 4°C refrigerator and shake slowly overnight.

[0067] (3) After overnight incubation with the primary antibody, the band was removed and placed in TBST solution. It was then shaken rapidly on a shaker at room temperature for 10 minutes each time.

[0068] (4) After washing, discard the TBST solution and place the strip in freshly prepared secondary antibody solution. Incubate at room temperature with slow shaking for 1 hour. The secondary antibody solution is prepared according to the dilution ratio in the instructions (mix the TBST solution containing 5% skim milk powder with HRP-labeled anti-mouse IgG or anti-rabbit IgG, and make sure that the species of the secondary antibody corresponds to that of the primary antibody).

[0069] (5) After the secondary antibody incubation is completed, discard the liquid, place the strip in TBST solution, shake it rapidly on a shaker, and repeat the washing process 3 times, 10 minutes each time.

[0070] (vi) Chemiluminescence

[0071] Exposure experiments were performed using the Suzhou Xinsaimei ultrasensitive ECL kit, prepared by mixing solution A and solution B in a 1:1 ratio before use. After spreading the strips flat, developer was evenly added to the top of the strips and incubated for 1 minute. The incubated strips were then placed in a Shanghai Qinxiang chemiluminescence analyzer to collect optical signals. Data were collected and analyzed for grayscale values ​​using ImageJ software.

[0072] 3.Real-time quantitative PCR (RT-qPCR)

[0073] (I) Reverse transcription

[0074] The preparation system for the reverse transcription kit is as follows:

[0075]

[0076] The reverse transcription reaction was performed using a gene amplification instrument at 37 degrees Celsius for 15 minutes, 85 degrees Celsius for 5 seconds, and maintained at 4 degrees Celsius. The resulting cDNA product can be used immediately for qPCR or stored at -20 degrees Celsius.

[0077] (II) Real-time PCR

[0078] Real-time PCR experiments were performed using TB Green. TM Premix Ex Taq TM Prepare the PCR reaction solution according to the table below (operate on ice throughout):

[0079]

[0080] Perform PCR reactions using a real-time quantitative qPCR instrument under the following conditions:

[0081]

[0082] The primer sequences involved in this experiment are as follows:

[0083] Homo RUNX2 GGCGGGTAACGATGAAAAT Homo RUNX2 GAGGCGGTCAGAGAACAA Homo OPN ATTCTGGAAGTTCTGAGGA Homo OPN CTAGGAGATTCTGCTTCTG Homo FOXO1 ACGAGTGGATGGTCAAGAG Homo FOXO1 TCTTGCCACCCTCTGGATTG Homo GAPDH TCAAGAAGGTGGTGAAGCA Homo GAPDH TCAAAGGTGGAGGAGTGGG

[0084] 4. Isolation and culture of human aortic valve interstitial cells

[0085] (1) Place the valve retrieved from the operating room in a clean bench (note the aseptic operation) and remove the DMEM high-glucose culture medium from the centrifuge tube.

[0086] (2) Transfer the valve to a six-well cell culture plate, pour in enough sterile PBS containing double antibiotics into each well, and repeatedly blow and rinse gently for 1 minute with a pipette or Pasteur pipette. Then transfer the valve to another well and continue rinsing. Repeat 5 times.

[0087] (3) After washing the valve, transfer it to a sterile 15mL centrifuge tube, add 10mL of type I collagenase, and incubate overnight at 37℃.

[0088] (4) Take out the 15mL centrifuge tube containing the digested cell turbidity and centrifuge at 1000rpm for 5 minutes at room temperature.

[0089] (5) After centrifugation, remove the supernatant, then add 3 mL of high-glucose DMEM medium containing 10% fetal bovine serum (FBS), resuspend the cells and transfer them to a sterile T25 cell culture flask, and place them flat in a 37°C incubator.

[0090] (6) When the cells have grown to cover more than 70% of the surface area, passage the cells. Discard the culture medium, add 1-2 mL of sterile PBS, and gently shake to wash 3 times. Discard the PBS, add 1 mL of 0.25% EDTA-containing trypsin solution, digest for 1 minute, then discard the trypsin solution, add 6 mL of high-glucose DMEM culture medium containing 10% FBS and pipette to completely remove the cells. After observing under a microscope that no cells have adhered, aliquot the cell solution into new sterile T25 or six-well plates as needed.

[0091] (7) Depending on the experimental requirements, P2-P4 generation cells are usually selected for intervention and experimental operations.

[0092] 5. Alizarin Red staining

[0093] (1) After digesting P2-P3 generation AVICs from the culture flask, they were seeded into a 12-well cell culture plate. After 24 hours of seeding, they were observed under a microscope. When the cells reached 60-70% confluence, intervention was performed according to experimental requirements.

[0094] (2) After cell intervention, remove the cell culture plate and place it in a sterile laminar flow hood. Discard the culture medium, add 0.5-1 ml of sterile PBS to each well, gently shake and wash twice, and add 1 ml of osteogenic induction differentiation medium OM to each well. Incubate in a 37°C incubator.

[0095] (3) Change the medium every 3 days (after intervention, osteogenic induction differentiation medium OM was used for all medium changes) and culture for 21 days.

[0096] (4) Remove the cell culture plate, discard the culture medium, add 0.5-1 mL of PBS to each well, gently shake and wash 3 times, discard the PBS, add 1 mL of 4% paraformaldehyde fixative to each well, and let it stand for 15 minutes to fix.

[0097] (5) After fixation, remove the fixative, add 0.5-1 mL of double-distilled water to each well, and gently shake to wash 3 times.

[0098] (6) Prepare 0.2% alizarin red dye solution.

[0099] (7) Add 500 μL of 0.2% Alizarin Red staining solution to each well of the cell culture plate and incubate at room temperature for 30 minutes.

[0100] (8) After incubation, remove the alizarin red staining solution, add 0.5-1 mL of double-distilled water to each well, and gently shake to wash 5-6 times until the eluent changes from red to transparent and colorless.

[0101] (9) Observe under a microscope and take photos for record.

[0102] 6. Calcium content

[0103] This experiment used the CalciμMC-testWako detection kit. The steps are briefly described below:

[0104] (1) Wash the cells cultured in the test plate for 2 weeks with TBS, then add 0.6N HCl to the 12-well plate for 24 hours, and collect the HCl supernatant containing calcium ions.

[0105] (2) Calcium content was tested according to the instructions. After gentle washing with TBS, the remaining cells at the bottom of the six-well plate were lysed with 0.1N NaOH solution containing 0.1% SDS and the total protein was extracted.

[0106] (3) The protein concentration was determined using a BSA kit, and the calcium content was standardized to the protein content.

[0107] 7. Animal Model Establishment and Grouping

[0108] Twelve 8-week-old male ApoEKO mice were selected and divided into two groups (n=6 per group): (1) ApoEKO mice fed with saline (ApoEKO group); (2) ApoEKO mice treated with the drug (ApoE KO+AS1842856 group, 10 mg / kg, administered by gavage twice a week for 24 weeks). Initially, the mice were fed a normal diet. After acclimatizing, both groups were switched to a high-fat / high-cholesterol Western diet and fed continuously for 24 weeks. Echocardiography was then performed to assess the corresponding cardiac structure and function indicators. The procedures were strictly followed according to the guidelines established by the Animal Experiment Center of Huazhong University of Science and Technology and obtained animal ethics approval.

[0109] Results Analysis

[0110] 1. FOXO1 expression is downregulated in calcified aortic valves. Figure 1 )

[0111] Calcified and normal aortic valve tissues were collected, and calcium salt deposits in the valves were identified by Vonkossa and Alizarin Red staining. Figure 1 Immunohistochemical staining revealed that FOXO1 was highly expressed in normal aortic valves, but its expression was significantly reduced in calcified valves. Figure 1 B). Protein and mRNA were extracted from the collected valve tissue, and Western blot analysis revealed that the expression of osteogenic molecules Runx2 and OPN was upregulated in calcified valve tissue, while the expression of FOXO1 was significantly reduced. Figure 1 .CD), and immunofluorescence staining revealed that FOXO1 co-localized with the stromal cell marker Vimentin. Figure 1 The presence of FOXO1 (E) indicates that FOXO1 is mainly expressed in the interstitial cells of normal valves.

[0112] 2. FOXO1 inhibits osteoblast-like differentiation of aortic valve interstitial cells ( Figure 2 )

[0113] Intervention of valvular interstitial cells with adenovirus overexpressing FOXO1 showed that FOXO1 overexpression inhibited Runx2 and OPN expression. Figure 2 Alizarin Red staining results showed that overexpression of FOXO1 could inhibit the formation of calcium salt deposition in valvular interstitial cells. Figure 2 .B). Using siRNA to knock down FOXO1, Western blot results showed that knocking down FOXO1 promoted Runx2 and OPN expression. Figure 2 Alizarin Red staining results showed that knocking down FOXO1 promoted calcium salt deposition in valvular interstitial cells. Figure 2 .D).

[0114] 3. AS1842856 activates FOXO1 phosphorylation, promoting osteoblast-like differentiation of valvular interstitial cells. Figure 3 )

[0115] Valvular interstitial cells were treated with the FOXO1-specific small molecule inhibitor AS1842856 at concentration gradients of 0, 0.5, 1, 3, 5, and 10 μM. Western blot results showed that AS1842856 gradually upregulated FOXO1 phosphorylation levels, while Runx2 and OPN expression were significantly upregulated. Figure 3 .AB), and can exacerbate the formation of calcium salt deposits in valvular interstitial cells ( ). Figure 4 .D).

[0116] 4. AS1842856 exacerbated aortic valve calcification in ApoEKO mice fed a high-fat diet.

[0117] Twelve 8-week-old male ApoEKO mice were randomly divided into two groups: a control group (gavage with saline twice weekly for 24 weeks, n=6) and an experimental group (gavage with AS1842856 (10 mg / kg) twice weekly for 24 weeks, n=6). Both groups were fed a high-fat Western diet for 24 weeks. The peak transvalvular flow velocity of the aortic valve was measured by ultrasound in both groups. The results showed that the peak transvalvular flow velocity and transvalvular pressure gradient in the experimental group were significantly higher than those in the control group. Figure 4 .AB). Immunohistochemical staining results showed that p-FOXO1 expression was significantly upregulated in the aortic valve of the experimental group ( ). Figure 4 Vonkossa staining results showed that AS1842856 significantly increased calcium salt deposition in the aortic valve. Figure 4 Masson staining results showed that AS1842856 increased aortic valve collagen formation. Figure 4 .E).

[0118] 5. FOXO1 binds to Runx2 and promotes its ubiquitination and degradation. AS1842856 inhibits FOXO1 binding to Runx2 and suppresses the ubiquitination modification of Runx2 by activating FOXO1 phosphorylation.

[0119] CO-IP experiments demonstrated that FOXO1 can bind to Runx2 protein. Figure 5 (A) After inhibiting the proteasome with MG132, overexpression of FOXO1 did not reduce FOXO1 expression levels. Figure 5 (B) After overexpression of FOXO1, CHX was used to inhibit cellular protein synthesis, and it was found that the expression level of Runx2 decreased more rapidly. Figure 5 The results (.C) suggest that FOXO1 downregulates Runx2 expression via proteasome degradation. After pulling down Runx2 protein using IP experiments, Western blot analysis revealed increased ubiquitination levels in Runx2 protein after FOXO1 overexpression. However, using AS1842856 showed increased FOXO1 phosphorylation levels but decreased FOXO1-Runx2 binding levels, indicating a significant decrease in Runx2 protein ubiquitination. Figure 5 .G).

[0120] This study found that FOXO1 can inhibit osteoblastic differentiation of aortic valve cells induced by osteomyelitis (OM), and its specific small molecule inhibitor AS1842856 can promote the phosphorylation level of FOXO1, inhibit the binding of FOXO1 to Runx2 thereby reducing the ubiquitination level of Runx2, preventing Runx2 degradation, upregulating Runx2 expression, promoting osteoblastic differentiation of aortic valve interstitial cells, and promoting aortic valve calcification in mice. This molecular mechanism has not been reported in calcific aortic valve disease and may provide a new potential target and therapeutic approach for the treatment of this disease.

[0121] Those skilled in the art will appreciate that various modifications to the above embodiments can be made without departing from the overall spirit and concept of the present invention. All such modifications fall within the protection scope of the present invention. The protection scheme of the present invention is defined by the appended claims.

Claims

1. Application of FOXO1-overexpressing adenovirus in the preparation of drugs for the prevention and treatment of calcified aortic valve disease.

2. The application according to claim 1, wherein, The effects of FOXO1-overexpressing adenovirus are manifested in at least one of the following ways: 1) Inhibit Runx2 and OPN expression. 2) Inhibits osteoblast-like differentiation of aortic valve interstitial cells. 3) Increases the binding of FOXO1 to Runx2 protein and promotes Runx2 ubiquitination and degradation.

Images