Optimized genetically engineered bacteria for producing 5-methyluridine and application thereof

By modifying the metabolic pathways of Escherichia coli and introducing specific genes, an optimized genetically engineered strain, E. coli GYJ23, was constructed, solving the problems of long production time, high cost, and heavy pollution in the production of 5-methyluridine, and achieving efficient and green production and increased yield.

CN116948935BActive Publication Date: 2026-06-26WUHAN UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
WUHAN UNIV
Filing Date
2023-07-27
Publication Date
2026-06-26

Smart Images

  • Figure CN116948935B_ABST
    Figure CN116948935B_ABST
Patent Text Reader

Abstract

The application provides an optimized 5-methyluridine-producing genetically engineered bacterium and application thereof, and the preparation method comprises the following steps: knocking out purR, argR, pepA, pgi and ung genes in E.coli GYJ7 (patent application number: 202210021004) in sequence to obtain a strain E.coli GYJ12; replacing a pyrH gene in the GYJ12 with a homologous gene xsze in situ to obtain a strain E.coli GYJ23; obtaining an expression vector of PolB; and transforming the expression vector of PolB into the strain GYJ23 to obtain the optimized 5-methyluridine-producing genetically engineered bacterium. The application improves the production efficiency, is simple to operate and has few by-products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to an optimized 5-methyluridine genetically engineered strain and its applications. Background Technology

[0002] AIDS is a major infectious disease caused by an RNA virus that threatens human health. Among existing AIDS treatments, alovudine, stavudine (d4T), and zidovudine (AZT) are first-line drugs in combination therapy for AIDS. 5-Methyluridine (5-MU) is an important intermediate in the synthesis of the anti-AIDS drugs alovudine, stavudine (d4T), zidovudine (AZT), and similar anti-AIDS drugs; in addition, 5-methyluridine is also used as a biomarker for cancer diagnosis.

[0003] Currently, the main industrial methods for producing 5-methyluridine are enzymatic synthesis and chemical synthesis. Enzymatic synthesis suffers from numerous problems, including long processing times, stringent reaction conditions, and low yields. Chemical synthesis, commonly used in industrial production, also has drawbacks such as high production costs, numerous reaction steps, and significant chemical pollution. Therefore, developing a genetically engineered bacterium to produce 5-methyluridine would revolutionize the industrial production of this product. Its high efficiency, green production, and low cost would greatly solve the aforementioned technical problems.

[0004] Previously, a genetically engineered bacterium producing 5-methyluridine (patent application number: 202210021004) has been produced. In order to further improve its production efficiency, it is necessary to optimize and modify the technology to further improve the efficiency of the genetically engineered bacterium producing this product and better promote its industrial application. Summary of the Invention

[0005] The purpose of this invention is to provide an optimized genetically engineered bacterium that produces 5-methyluridine and its application, further utilizing the microbial metabolic capacity to biosynthesize 5-methyluridine, thereby improving product production efficiency and reducing the production cost of a series of anti-AIDS drugs that use 5-methyluridine as an important raw material. The operation is simple and produces few byproducts.

[0006] In a first aspect of the present invention, an optimized genetically engineered bacterium producing 5-methyluridine is provided, the method for preparing the genetically engineered bacterium comprising:

[0007] The strain E. coli GYJ12 was obtained by sequentially knocking out the purR, argR, pepA, pgi and ung genes in E. coli GYJ7;

[0008] The strain E.coli GYJ23 was obtained by in situ replacing the pyrH gene in E.coli GYJ12 with the homologous gene xsze from the nematopathogenic bacterium Xenorhabdusszentirmaii DSM 16338.

[0009] The expression vector of PolB was obtained, wherein polB is a methyltransferase gene derived from Streptomyces cacaoivar. asoensis;

[0010] The expression vector of PolB was transformed into the strain E. coli GYJ23 to obtain an optimized genetically engineered bacterium that produces 5-methyluridine.

[0011] Furthermore, the amino acid sequence of the PolB is shown in SEQ ID NO.1.

[0012] Furthermore, the nucleotide sequence of the gene polB is optimized according to the codon preference of E. coli, and the optimized sequence is shown in SEQ ID NO.2; the nucleotide sequence of xsze is shown in SEQ ID NO.3.

[0013] Further, the process of obtaining strain E. coli GYJ12 by sequentially knocking out the purR, argR, pepA, pgi, and ung genes in E. coli GYJ7 specifically includes:

[0014] Using *E. coli* GYJ7 as a template, PCR amplification was performed using primers F1 and R1 for the left arm and primers F2 and R2 for the right arm to obtain the first homologous left arm and the first homologous right arm. The first homologous left arm was digested with SalI / EcoRI, and the first homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the first homologous left and right arms. pKOV-kan was digested with BamHI and SalI and the vector linear fragment was recovered. The linear fragments of the first homologous left and right arms and the vector linear fragment were ligated to obtain a positive clone, thus successfully constructing the knockout plasmid pYL44. This plasmid was then transformed into *E. coli* GYJ7, and the mutant strain *E. coli* GYJ8 was obtained through homologous recombination screening.

[0015] Using the mutant strain E. coli GYJ8 as a template, PCR amplification was performed using primers F3 and R3 for the left arm and primers F4 and R4 for the right arm to obtain the second homologous left arm and the second homologous right arm, respectively. The second homologous left arm was digested with SalI / EcoRI, and the second homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the second homologous left and right arms. pKOV-kan was digested with BamHI and SalI and then recovered to obtain the vector linear fragment. The linear fragments of the second homologous left and right arms and the vector linear fragment were ligated to obtain a positive clone, thus successfully constructing the knockout plasmid pYL45. This plasmid was then transformed into E. coli GYJ8, and the mutant strain E. coli GYJ9 was obtained through homologous recombination screening.

[0016] Using the mutant strain E. coli GYJ9 as a template, PCR amplification was performed using primers F5 and R5 for the left arm and primers F6 and R6 for the right arm to obtain the third homologous left arm and the third homologous right arm, respectively. The third homologous left arm was digested with SalI / EcoRI, and the third homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the third homologous left and right arms. pKOV-kan was digested with BamHI and SalI and the vector linear fragment was recovered. The linear fragments of the third homologous left and right arms and the vector linear fragment were ligated to obtain a positive clone, thus successfully constructing the knockout plasmid pYL46. This plasmid was then transformed into E. coli GYJ9, and the mutant strain E. coli GYJ10 was obtained through homologous recombination screening.

[0017] Using the mutant strain E. coli GYJ10 as a template, PCR amplification was performed using primers F7 and R7 for the left arm and primers F8 and R8 for the right arm to obtain the fourth homologous left arm and the fourth homologous right arm, respectively. The fourth homologous left arm was digested with SalI / EcoRI, and the fourth homologous right arm was digested with BglII / EcoRI to obtain linear fragments of the fourth homologous left and right arms. pKOV-kan was digested with BglII and SalI and the vector linear fragment was recovered. The linear fragments of the fourth homologous left and right arms and the vector linear fragment were ligated to obtain a positive clone, thus successfully constructing the knockout plasmid pYL47. This plasmid was then transformed into E. coli GYJ10, and the mutant strain E. coli GYJ11 was obtained through homologous recombination screening.

[0018] Using the mutant strain E. coli GYJ11 as a template, PCR amplification was performed using primers F9 and R9 for the left arm and primers F10 and R10 for the right arm to obtain the fifth homologous left arm and the fifth homologous right arm, respectively. The fifth homologous left arm was digested with SalI / EcoRI, and the fifth homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the fifth homologous left and right arms. pKOV-kan was digested with BamHI and SalI and then recovered to obtain the vector linear fragment. The linear fragments of the fifth homologous left and right arms and the vector linear fragment were ligated to obtain a positive clone, thus successfully constructing the knockout plasmid pYL48. This plasmid was then transformed into E. coli GYJ11, and the mutant strain E. coli GYJ12 was obtained through homologous recombination screening.

[0019] Furthermore, by replacing the pyrH gene in situ in E. coli GYJ12 with the homologous gene xsze from the nematopathogenic bacterium Xenorhabdus szentirmaii DSM 16338, strain E. coli GYJ23 was obtained, which specifically includes:

[0020] Using the mutant strain E. coli GYJ12 as a template, PCR amplification was performed using primers F11 and R11 for the left arm and primers F12 and R12 for the right arm to obtain the sixth homologous left arm and the sixth homologous right arm, respectively. Using the total DNA of Xenorhabdus szentirmaii DSM16338 as a template, PCR amplification was performed using primers F13 and R13 for the xsze gene to obtain the xsze nucleic acid fragment. The linear fragments of the sixth homologous left arm, the sixth homologous right arm, the xsze gene, and the pKOV-kan vector were digested with BamHI and SalI and the resulting vector linear fragment was recovered. The four fragments were then Gibson spliced ​​to obtain a positive clone, thus successfully constructing the knockout plasmid pYL57. This plasmid was then transformed into E. coli GYJ12, and the mutant strain E. coli GYJ23 was obtained through homologous recombination screening.

[0021] The nucleotide sequences of primers F1, R1, F2, R2, F3, R3, F4, R4, F5, R5, F6, R6, F7, R7, F8, R8, F9, R9, F10, R10, F11, R11, F12, R12, F13, and R13 are shown in SEQ ID NO.4-SEQ ID NO.29, respectively.

[0022] Furthermore, the method for obtaining the expression vector of PolB specifically includes:

[0023] Using the synthesized and optimized polB gene fragment as a template, primers F14 and R14 were used for amplification to obtain the DNA fragment of the polB gene; the vector pET28a was digested with NdeI and EcoRI and then ligated with the DNA fragment of the polB gene to obtain the expression plasmid pYL04.

[0024] The nucleotide sequences of primers F13 and R13 are shown in SEQ ID NO.30-SEQ ID NO.31, respectively.

[0025] In a second aspect of the invention, an optimized genetically engineered bacterium producing 5-methyluridine is provided for use in the production of 5-methyluridine. The co-transformation of polB and the phoA gene encoding dephosphorylase is replaced by transforming E. coli GYJ23 with a single polB gene, thereby utilizing the dephosphorylase already present in E. coli to further reduce the cellular stress that may be caused by gene overexpression.

[0026] In a third aspect of the invention, a method for producing 5-methyluridine is provided, the method comprising:

[0027] The optimized genetically engineered bacterium producing 5-methyluridine was seed cultured in LB medium to obtain seed culture.

[0028] The seed culture was transferred to a fermentation medium, and IPTG and kanamycin antibiotics were added simultaneously for fermentation culture to obtain a fermentation broth.

[0029] The fermentation broth was post-treated to obtain 5-methyluridine.

[0030] Furthermore, the fermentation medium formulation (g / L) contains the following components: 60g glycerol, 0.4g magnesium sulfate heptahydrate, 10g calcium carbonate, 10g yeast extract, 14.8g soy protein, and 10mL of a 100× trace element solution.

[0031] Furthermore, the pH during the fermentation culture is maintained between 6.5 and 7.5, the final concentration of IPTG added during the fermentation culture is 0.3 ± 0.05 mM, the final concentration of kanamycin antibiotic is 50 ± 2 μg / mL, the temperature during the fermentation culture is maintained at 30℃ ± 2℃, and the fermentation culture cycle is 72 h to 96 h.

[0032] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0033] This invention provides an optimized genetically engineered bacterium for producing 5-methyluridine and its application. The engineered bacterium further modifies the metabolic pathway of *E. coli*. Using the genetically engineered bacterium *E. coli* GYJ7 obtained in previous work as the starting strain (patent application number: 202210021004), the *purR*, *argR*, *pepA*, *pgi*, and *ung* genes in *E. coli* GYJ7 were knocked out sequentially to obtain strain *E. coli* GYJ12. The *pyrH* gene in *E. coli* GYJ12 was replaced in situ with the homologous gene *xsze* from *Xenorhabdus szentirmaii* DSM 16338 to obtain strain *E. coli* GYJ23. Then, the gene *polB*, which encodes a methyltransferase from *Streptomyces cacaoi* var. *asoensis*, was transformed into *E. coli* GYJ23 to obtain an engineered bacterium that can optimize the production of 5-methyluridine. The genetically engineered bacteria used to produce 5-methyluridine, through optimization of the culture medium and culture conditions, ultimately enabled the synthetically modified *E. coli* to produce 5-methyluridine at concentrations exceeding 1.0 g / L. This invention is an improvement upon existing technologies (patent application number: 202210021004), and plays a positive role in promoting the green and efficient industrial production of nucleoside drugs through microbial factories. It has broad market prospects and brings significant economic and social benefits. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0035] Figure 1 The chemical structure of 5-methyluridine;

[0036] Figure 2 This is a schematic diagram illustrating further modifications to Escherichia coli GYJ7;

[0037] Figure 3 PCR validation and sequencing peak shape of the GYJ8 mutant strain

[0038] Figure 4 PCR validation and sequencing peak shape of the GYJ9 mutant strain

[0039] Figure 5 PCR validation and sequencing peak shape of the GYJ10 mutant strain

[0040] Figure 6 PCR validation and sequencing peak shape of the GYJ11 mutant strain

[0041] Figure 7 PCR validation and sequencing peak shape of the GYJ12 mutant strain

[0042] Figure 8 Sequencing peak shape of the GYJ23 mutant strain

[0043] Figure 9 HPLC chromatograms of 5-methyluridine standard and fermentation broth of 5-methyluridine engineered strain E. coli GYJ23 / pYL04; Std, 5-methyluridine standard; GYJ23 / pYL04, HPLC analysis results of fermentation broth of pYL04 transformed into E. coli GYJ23 mutant strain.

[0044] Figure 10 To optimize the LC-MS detection of the fermentation broth of the engineered strain E. coli GYJ23 / pYL04 for the production of 5-methyluridine.

[0045] Figure 11 A bar chart showing the fermentation yield of E. coli GYJ23 / pYL04. Detailed Implementation

[0046] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0047] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0048] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0049] The following will provide a detailed description of an optimized genetically engineered bacterium producing 5-methyluridine and its applications, in conjunction with embodiments and experimental data.

[0050] Example 1: Genetically engineered bacteria for producing 5-methyluridine and its preparation method

[0051] I. By sequentially knocking out the purR, argR, pepA, pgi, and ung genes in E. coli GYJ7 (strain GYJ7 in patent application number: 202210021004), strain E. coli GYJ12 was obtained.

[0052] 1. Metabolic engineering techniques were used to modify the metabolic pathway of *E. coli* GYJ7, and the transcriptional regulator purR of the carAB gene was deleted in the same frame to construct the mutant strain *E. coli* GYJ8, specifically including:

[0053] This experiment utilizes the temperature sensitivity and high sucrose lethality of pKOV-kan. The BamHI and SalI restriction sites on the pKOV-kan vector (published by Lalioti et al. in *Nucleic Acids Research*, Vol. 29, No. 3, 2001, p. 14) facilitate the construction of the knockout vector. Primers for the homologous left and right arms of the target gene rihC to be knocked out were designed using Primer Premier 5 primer design software (F1, R1 for the left arm, F2, R2 for the right arm). PCR amplification using the primers yielded the homologous left and right arms. The recovered left and right arms were digested with their respective enzymes to obtain linear fragments with sticky ends. The pKOV-kan was then digested with BamHI and SalI, and the linear fragments were recovered. The homologous left and right arms and the vector fragments were ligated together to obtain a positive clone, thus successfully constructing the knockout plasmid pYL44.

[0054] The constructed knockout vector calcium was transformed into *E. coli* GYJ7. During transformation, the culture was incubated at 30°C with shaking. The cultured bacterial suspension was then placed on kanamycin-resistant (LA) plates. Single colonies were picked and placed in finger flasks containing 5 mL of LB liquid medium and incubated at 30°C with shaking. The incubated suspension was diluted and spread onto normal LA solid medium containing kanamycin. Incubation was carried out at 40°C until single colonies appeared. Cells were picked for PCR verification. Non-single-exchange single colonies were selected and placed in finger flasks containing 6 mL of LB liquid medium (without antibiotics). The finger flasks were incubated at 40°C with shaking for 16 hours. The incubated suspension was diluted and spread onto LA solid plates containing 10% sucrose without antibiotics. Incubation was carried out overnight at 40°C until single colonies appeared. Single clones were selected, and the same single clone was streaked onto high-sucrose plates and kanamycin-resistant plates for resistance verification. The plates were then incubated at 40°C. Single clones that grew on 10% sucrose LA solids but not on kanamycin-resistant plates were screened for PCR verification. At this point, the PCR product consisted of only one band the same size as the plasmid band. Several verified single clones were inoculated (without antibiotics), incubated at 37°C in a shaker for 8 hours, and the strain was preserved to obtain the mutant strain E. coli GYJ8.

[0055] 2. Based on the modification of E. coli GYJ8, the transcriptional regulator argR of the carAB gene was deleted in the same frame to construct the mutant strain E. coli GYJ9, which specifically includes:

[0056] Using the mutant strain E. coli GYJ8 as a template, PCR amplification was performed using primers F3 and R3 for the left arm and primers F4 and R4 for the right arm to obtain the second homologous left arm and the second homologous right arm, respectively. The second homologous left arm was digested with SalI / EcoRI, and the second homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the second homologous left and right arms. pKOV-kan was digested with BamHI and SalI and then recovered to obtain the vector linear fragment. The linear fragments of the second homologous left and right arms and the vector linear fragment were ligated to obtain a positive clone, thus successfully constructing the knockout plasmid pYL45. This plasmid was then transformed into E. coli GYJ8, and the mutant strain E. coli GYJ9 was obtained using the above screening method.

[0057] 3. Based on the modification of E. coli GYJ9, the carAB gene transcription factor pepA was deleted in the same frame to construct the mutant strain E. coli GYJ10, which specifically includes:

[0058] Using the mutant strain E. coli GYJ9 as a template, PCR amplification was performed using primers F5 and R5 for the left arm and primers F6 and R6 for the right arm to obtain the third homologous left arm and the third homologous right arm, respectively. The third homologous left arm was digested with SalI / EcoRI, and the third homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the third homologous left and right arms. pKOV-kan was digested with BamHI and SalI and then recovered to obtain the vector linear fragment. The linear fragments of the third homologous left and right arms and the vector linear fragment were ligated to obtain a positive clone, thus successfully constructing the knockout plasmid pYL46. This plasmid was then transformed into E. coli GYJ9, and the mutant strain E. coli GYJ10 was obtained using the above screening method.

[0059] 4. Based on the modification of E. coli GYJ10, the glucose-6-phosphate isomerization gene pgi was deleted in the same frame to construct the mutant strain E. coli GYJ11, which specifically includes:

[0060] Using the mutant strain E. coli GYJ10 as a template, PCR amplification was performed using primers F7 and R7 for the left arm and primers F8 and R8 for the right arm to obtain the fourth homologous left arm and the fourth homologous right arm, respectively. The fourth homologous left arm was digested with SalI / EcoRI, and the fourth homologous right arm was digested with BglII / EcoRI to obtain linear fragments of the fourth homologous left and right arms. pKOV-kan was digested with BglII and SalI and the vector linear fragment was recovered. The linear fragments of the fourth homologous left and right arms and the vector linear fragment were ligated to obtain a positive clone, thus successfully constructing the knockout plasmid pYL47. This plasmid was then transformed into E. coli GYJ10, and the mutant strain E. coli GYJ11 was obtained using the above screening method.

[0061] 5. Based on the modification of E. coli GYJ11, the ung gene encoding uracil-DNA glycosylase was deleted in the same frame to construct the mutant strain E. coli GYJ12, specifically including:

[0062] Using the mutant strain E. coli GYJ11 as a template, PCR amplification was performed using primers F9 and R9 for the left arm and primers F10 and R10 for the right arm to obtain the fifth homologous left arm and the fifth homologous right arm, respectively. The fifth homologous left arm was digested with SalI / EcoRI, and the fifth homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the fifth homologous left and right arms. pKOV-kan was digested with BamHI and SalI and then recovered to obtain the vector linear fragment. The linear fragments of the fifth homologous left and right arms and the vector linear fragment were ligated together to obtain a positive clone, thus successfully constructing the knockout plasmid pYL42. This plasmid was then transformed into E. coli GYJ11, and the mutant strain E. coli GYJ12 was obtained using the above screening method.

[0063] 6. The strain E. coli GYJ23 was obtained by replacing the pyrH gene in situ in E. coli GYJ12 with the homologous gene xsze from the nematopathogenic bacterium Xenorhabdusszentirmaii DSM 16338, specifically including:

[0064] Using the mutant strain E. coli GYJ12 as a template, PCR amplification was performed using primers F11 and R11 for the left arm and primers F12 and R12 for the right arm to obtain the sixth homologous left arm and the sixth homologous right arm, respectively. Using the total DNA of Xenorhabdus szentirmaii DSM16338 as a template, PCR amplification was performed using primers F13 and R13 for the xsze gene to obtain the xsze nucleic acid fragment (Seq ID NO. 3). The linear fragments of the sixth homologous left arm, the sixth homologous right arm, the xsze gene, and the pKOV-kan vector were digested with BamHI and SalI, and the resulting vector linear fragment was recovered. The four fragments were then Gibson spliced ​​to obtain a positive clone, thus successfully constructing the knockout plasmid pYL57, which was then transformed into E. coli GYJ12. Using the above screening method, the mutant strain E. coli GYJ23 was obtained.

[0065] Table 1 - Primers used to construct mutant strains GYJ8-GYJ12 and GYJ23

[0066]

[0067]

[0068] II. Obtaining the expression vector of PolB

[0069] The DNA fragment of the polB gene (SEQ ID NO.2) (primers F14 and R14) was amplified using high-fidelity KOD enzyme and digested with NdeI and EcoRI enzymes in the vector pET28a. The polB fragment has an EcoRI restriction endonuclease site at the 3' end and an NdeI restriction endonuclease site at the 5' end. Then, it was ligated with T4 ligase (NEB) and the amplified fragment was cloned into the pET28a vector to construct the expression plasmid pYL04.

[0070] Table 2 - Primers used for the PolB expression vector

[0071] Primer name 5’-3’ F14 GTCCATATGGAAAGTCCGCGTATT(SEQ ID NO.30) R14 GGAATTCTTACGGGCTAACGCGACC(SEQ ID NO.31)

[0072] III. Obtaining Optimized Genetically Engineered Bacteria Producing 5-Methyluridine

[0073] The expression vector of PolB was transformed into competent cells of the strain E.coli GYJ23 to obtain an optimized genetically engineered bacterium that produces 5-methyluridine.

[0074] Example 2: Method for producing 5-methyluridine

[0075] 1. Formulation of seed culture medium and fermentation culture medium

[0076] The fermentation seed culture was Luria-Bertani (LB) medium (1L) containing the following components: 10g tryptone, 5g sodium chloride, and 5g yeast extract.

[0077] The fermentation medium formula (1L) contains the following components: 60g glycerol, 0.4g magnesium sulfate heptahydrate, 10g calcium carbonate, 10g yeast extract, 14.8g soy protein, and 10mL of a solution of 100× (4g / L ZnCl2, 20g / L FeCl3·6H2O, 1g / L MnCl2·4H2O, 1g / L Na2B4O7·10H2O, 1g / L (NH4)6Mo7O2·4H2O).

[0078] 2. Fermentation culture of genetically engineered strains producing 5-methyluridine

[0079] Competent cells were prepared from mutant strains E. coli GYJ8, E. coli GYJ9, E. coli GYJ10, E. coli GYJ11, E. coli GYJ12, and E. coli GYJ23. The expression vector pYL04 calcium of PolB was transferred into the mutant strains. Positive clones were selected and cultured in LB medium at 37°C for 8 hours. The OD600 of the bacterial culture was then measured. Based on the OD value, 10% of the culture was transferred to the fermentation medium at a uniform inoculum. IPTG and kanamycin antibiotic at a final concentration of 0.3 mmol / L were added simultaneously, and fermentation was carried out at 30°C for 72-96 hours.

[0080] 3. Post-treatment methods for fermentation broth

[0081] The fermentation broth was first adjusted to pH 3-4 with oxalic acid, then centrifuged at 12000 rpm for 20 min, and the supernatant was collected. The supernatant was filtered through a 0.22 μm aqueous membrane and analyzed by high-performance liquid chromatography (HPLC) or LC / HRMS. Using a 5-methyluridine standard as a reference, the 5-methyluridine fermentation unit yield in the fermentation broth was calculated. The HPLC chromatogram of the E. coli GYJ23 / pYL04 fermentation broth, compared with the standard, showed that the 5-methyluridine fermentation unit yield in shake-flask fermentation could reach 1.06 g / L.

[0082] Table 3

[0083] Group 24h 48h 72h 96h 1 417.90 510.92 967.69 1030.88 2 425.99 530.57 951.61 1092.67 3 390.50 621.25 922.16 1051.13 Average yield 411.46 554.25 947.15 1058.23

[0084] 4. HPLC Detection Method for 5-Methyluridine Analysis and Potency Determination

[0085] High-performance liquid chromatography (HPLC-UV) method: The chromatographic column was Diamonsil, 5 μm, 4.6 × 250 mm. The mobile phase consisted of deionized water and methanol with 0.15% trifluoroacetic acid added. The flow rate was 0.4 mL / min, the detection wavelength was 254 nm, and the column temperature was kept constant at 30 °C.

[0086] Table 4

[0087]

[0088] LC / HRMS detection method: The mobile phase consisted of 0.15% trifluoroacetic acid in deionized water and mass spectrometry-grade methanol. The mass spectrometry detection mode was positive ion mode, the flow rate was 0.5 mL / min, the spray pressure was 30 psi, and the drying gas temperature was 275 °C.

[0089] Table 5

[0090]

[0091] As can be seen from the above, the optimized genetically engineered bacteria for producing 5-methyluridine of the present invention can further improve the production efficiency of 5-methyluridine, control production costs, and is simple to operate with fewer by-products.

[0092] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

[0093] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0094] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0095] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A genetically engineered bacterium producing 5-methyluridine, wherein the preparation method of the genetically engineered bacterium includes: By sequentially knocking out E. coli E. coli GYJ7 purR , argR , pepA , pgi and ung Genes, obtaining strains E. coli GYJ12; then the strain was... E. coli GYJ12 pyrH In situ gene replacement with nematode pathogens Xenorhabdus szentirmaii Homologous genes in DSM 16338 xsze Obtain strain E. coli GYJ23; By sequentially knocking out E. coli E. coli BL21(DE3) rihC, rihA, deoA, udp, tdk and rihB Genes were obtained to obtain strain GYJ7; xsze The nucleotide sequence is shown in SEQ ID NO.3; Obtain the expression vector for PolB, wherein polB Derived from Streptomyces Streptomyces cacaoi var. asoensis The methyltransferase gene in PolB, the amino acid sequence of which is shown in SEQ ID NO.1; The expression vector of PolB was transformed into the strain. E. coli Genetically engineered bacteria producing 5-methyluridine were obtained from GYJ23.

2. The genetically engineered bacterium producing 5-methyluridine according to claim 1, characterized in that, The process involves sequentially knocking out E. coli. E. coli GYJ7 purR , argR , pepA , pgi and ung Genes, obtaining strains E. coli GYJ12; then the strain was... E. coli GYJ12 pyrH In situ gene replacement with nematode pathogens Xenorhabdus szentirmaii Homologous genes in DSM 16338 xsze Obtain strain E. coli GYJ23 includes: With Escherichia coli E. coli Using GYJ7 as a template, PCR amplification was performed using primers F1 and R1 for the left arm and primers F2 and R2 for the right arm to obtain the first homologous left arm and the first homologous right arm, respectively. The first homologous left arm was digested with SalI / EcoRI, and the first homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the first homologous left and right arms. pKOV-kan was digested with BamHI and SalI and the vector linear fragment was recovered. The linear fragments of the first homologous left and right arms and the vector linear fragment were ligated to obtain positive clones, thus successfully constructing the knockout plasmid pYL44, which was then transformed into E. coli. E. coli In GYJ7, mutant strains were obtained through homologous recombination screening. E. coli GYJ8; With the mutant strain E. coli Using GYJ8 as a template, PCR amplification was performed using primers F3 and R3 for the left arm and primers F4 and R4 for the right arm to obtain the second homologous left and right arms. The second homologous left arm was digested with SalI / EcoRI, and the second homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the second homologous left and right arms. pKOV-kan was digested with BamHI and SalI and the vector linear fragment was recovered. The linear fragments of the second homologous left and right arms and the vector linear fragment were ligated to obtain positive clones, thus successfully constructing the knockout plasmid pYL45, which was then transformed into E. coli. E. coli In GYJ8, mutant strains were obtained through homologous recombination screening. E. coli GYJ9; With the mutant strain E. coli Using GYJ9 as a template, PCR amplification was performed using primers F5 and R5 for the left arm and primers F6 and R6 for the right arm to obtain the third homologous left and right arms. The third homologous left arm was digested with SalI / EcoRI, and the third homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the left and right arms. pKOV-kan was digested with BamHI and SalI, and the vector linear fragment was recovered. The linear fragments of the third homologous left and right arms and the vector linear fragment were ligated together to obtain a positive clone, thus successfully constructing the knockout plasmid pYL46, which was then transformed into E. coli. E. coli In GYJ9, mutant strains were obtained through homologous recombination screening. E. coli GYJ10; With the mutant strain E. coli Using GYJ10 as a template, PCR amplification was performed using primers F7 and R7 for the left arm and primers F8 and R8 for the right arm to obtain the fourth homologous left and right arms. The fourth homologous left arm was digested with SalI / EcoRI, and the fourth homologous right arm was digested with BglII / EcoRI to obtain linear fragments of the left and right homologous arms. pKOV-kan was digested with BglII and SalI, and the vector linear fragment was recovered. The linear fragments of the fourth homologous arms and the vector linear fragment were ligated together to obtain a positive clone, thus successfully constructing the knockout plasmid pYL47, which was then transformed into E. coli. E. coli In GYJ10, mutant strains were obtained through homologous recombination screening. E. coli GYJ11; With the mutant strain E. coli Using GYJ11 as a template, PCR amplification was performed using primers F9 and R9 for the left arm and F10 and R10 for the right arm to obtain the fifth homologous left and right arms. The fifth homologous left arm was digested with SalI / EcoRI, and the fifth homologous right arm was digested with BamHI / EcoRI to obtain linear fragments of the left and right homologous arms. pKOV-kan was digested with BamHI and SalI, and the vector linear fragment was recovered. The linear fragments of the fifth homologous arms and the vector linear fragment were ligated together to obtain a positive clone, thus successfully constructing the knockout plasmid pYL48, which was then transformed into *E. coli*. E. coli In GYJ11, mutant strains were obtained through homologous recombination screening. E. coli GYJ12; With the mutant strain E. coli Using GYJ12 as a template, PCR amplification was performed using primers F11 and R11 for the left arm and primers F12 and R12 for the right arm to obtain the sixth homologous left arm and the sixth homologous right arm; Xenorhabdus szentirmaii Using total DNA from DSM16338 as a template, through... xsze Gene primers F13 and R13 were used for PCR amplification to obtain xsze Nucleic acid fragments, including the linear fragments of the sixth homologous left arm and the sixth homologous right arm. xsze The linear gene fragment and the pKOV-kan vector were digested with BamHI and SalI, and the resulting vector linear fragment was recovered. The four fragments were then Gibson spliced ​​to obtain positive clones, thus successfully constructing the knockout plasmid pYL57. This plasmid was subsequently transformed into *E. coli*. E. coli In GYJ12, mutant strains were obtained through homologous recombination screening. E. coli GYJ23; The nucleotide sequences of primers F1, R1, F2, R2, F3, R3, F4, R4, F5, R5, F6, R6, F7, R7, F8, R8, F9, R9, F10, R10, F11, R11, F12, R12, F13, and R13 are shown in SEQ ID NO.4-SEQ ID NO.29, respectively.

3. The genetically engineered bacterium producing 5-methyluridine according to claim 1, characterized in that, The aforementioned gene polB The nucleotide sequence was optimized according to the codon preference of *E. coli*, and the optimized gene... polB The nucleotide sequence is shown in SEQ ID NO:

2.

4. A genetically engineered bacterium producing 5-methyluridine according to claim 1 or 3, characterized in that, The expression vector for obtaining PolB specifically includes: by polB Using a gene fragment as a template, primers F14 and R14 are used for amplification to obtain... polB DNA fragments of the gene; the vector pET28a was digested with NdeI and EcoRI and then... polB The DNA fragment of the gene was ligated to obtain the expression vector pYL04 of PolB; wherein the nucleotide sequences of the primers F14 and R14 are shown in SEQ ID NO.30-SEQ ID NO.31 respectively.

5. The use of the genetically engineered bacterium producing 5-methyluridine as described in any one of claims 1-4 in the production of 5-methyluridine.

6. A method for producing 5-methyluridine, characterized in that, The method includes: The genetically engineered bacteria producing 5-methyluridine as described in any one of claims 1-5 are seed cultured in LB medium to obtain seed liquid; The seed culture was transferred to a fermentation medium, and IPTG and kanamycin antibiotics were added simultaneously for fermentation culture to obtain a fermentation broth. The fermentation broth was post-treated to obtain 5-methyluridine.

7. A method for producing 5-methyluridine according to claim 6, characterized in that, The fermentation medium contains the following components: glycerol 60±2 g / L, magnesium sulfate heptahydrate 0.4±0.1 g / L, calcium carbonate 10±1 g / L, yeast extract 10±1 g / L, soybean peptone 14.8±1 g / L, and a trace element 100× solution 10 mL / L.

8. A method for producing 5-methyluridine according to claim 6, characterized in that, The pH of the fermentation culture is maintained between 6.5 and 7.5, the final concentration of IPTG added in the fermentation culture is 0.3 ± 0.05 mM, the final concentration of kanamycin antibiotic is 50 ± 2 μg / mL, the temperature of the fermentation culture is maintained at 30 ℃ ± 2 ℃, and the fermentation culture period is 72 h to 96 h.