A Penicillium fungus and a method for fermenting Atpenin A5
By optimizing the fermentation conditions of Penicillium sp. HDCC00055, the problem of low Atpenin A5 yield was solved, achieving efficient and safe fermentation production with a potency of 314 mg/L, suitable for industrial application.
Patent Information
- Application Number
- CN202210743649.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-28
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2042-06-28
AI Technical Summary
Existing technologies for Atpenin A5 involve low fermentation yields, lengthy chemical synthesis processes with low yields, and use of flammable and explosive reagents, posing safety concerns.
Aerobic fermentation of Penicillium sp. HDCC00055 in a specific nutrient medium was carried out to optimize fermentation conditions for increasing the yield of Atpenin A5, including selecting suitable assimilated carbon sources, nitrogen sources and inorganic salts, and controlling fermentation temperature, pH and aeration rate.
It achieves high-efficiency fermentation yield of Atpenin A5, with a potency of over 314 mg/L, making it suitable for industrial production and reducing production costs.
Smart Images

Figure CN117343844B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of industrial microbial fermentation technology, specifically to a Penicillium and a method for fermenting Atpenin A5. Background Technology
[0002] Atpenin A5 is a potent inhibitor of Complex II (succinate-ubiquinone oxidoreductase). Complex II is an important functional complex in the mitochondrial electron transport chain and has become a key target for agricultural fungicides, which play a vital role in the protection of plant pathogenic fungi. Respiratory system inhibitors based on Complex II are widely used worldwide for fungal diseases. These inhibitors inhibit fungal respiration by binding to the ubiquinone reduction site of Complex II, exhibiting a unique mode of action. They show no cross-resistance with other classes of fungicides such as benzimidazoles, strobilurins, and aminopyridines, thus becoming excellent candidates for improving fungicide resistance and enhancing disease control.
[0003] In 1988, Atpenin A5 was isolated from the metabolites of a strain of Penicillium sp. FO-125, which was isolated from soil by Kitasato Co., Ltd. of Japan. Atpenin A5 is an intracellular lipid-soluble antifungal antibiotic. During the screening of lipid metabolism microbial inhibitors, Hidetoshi Kumagai et al. discovered a series of antifungal antibiotics, atpenins, isolated from the culture medium of Penicillium FO-125. These atpenins contain three active components, A4, A5, and B, all of which have antifungal activity, especially against Trichophyton sp. fungi, with Atpenin A5 exhibiting the strongest antifungal activity.
[0004] Masaki Ohtaw et al., in their enantioselective total synthesis of atpenin A5, reported that atpenin A5 possesses outstanding activity, conducted a total synthesis study, and confirmed the structure of the synthesized product. However, chemical synthesis suffers from long reaction steps, low yields, high safety requirements, and no significant cost advantage. Satoshi Omura et al., in their ATPENINS, NEW ANTIFUNGAL ANTIBIOTICS PRODUCED BY PENICILLIUM SP., reported atpenin A5 yields of 1-3 mg / L.
[0005] To address the problems of low fermentation yield in existing technologies for obtaining Atpenin A5, and the long synthesis steps, low yield, and unsafe use of flammable and explosive reagents in chemical synthesis processes, this invention seeks a new microorganism that can obtain a high fermentation yield of Atpenin A5 through simple fermentation, thereby achieving a lower production cost for Atpenin A5. Summary of the Invention
[0006] To address the shortcomings of existing methods for preparing Atpenin A5, one objective of this invention is to provide a *Penicillium* sp. HDCC00055 deposited at the China General Microbiological Culture Collection Center (CGMCC) (Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGMCC NO.23056, deposit date July 26, 2021, and registered, proving its viability.
[0007] Another objective of this invention is to provide the use of Penicillium sp. HDCC00055 in the preparation of Atpenin A5 or pharmaceutical compositions containing Atpenin A5.
[0008] The present invention also provides a method for preparing Atpenin A5, which includes aerobic fermentation of Penicillium sp. HDCC00055 in a nutrient medium containing an assimilated carbon source and / or nitrogen source.
[0009] In a preferred embodiment, the assimilable carbon source is selected from one or any combination of glucose, glycerol, sorbitol, sucrose, maltose, dextrin, and starch, with glucose, glycerol, and sorbitol being preferred.
[0010] In a preferred embodiment, the assimilable nitrogen source is selected from one or any combination of soybean meal, cottonseed meal, corn gluten meal, corn flour, wheat germ powder, yeast extract, peptone, yeast extract, and corn steep liquor; preferably soybean meal or cottonseed meal.
[0011] In a preferred embodiment, the nutrient culture medium further includes inorganic salts, which are selected from one or any combination of ammonium sulfate, potassium dihydrogen phosphate, magnesium sulfate, potassium chloride, and calcium chloride.
[0012] In a preferred embodiment, the nutrient culture medium contains:
[0013] Glucose 0-4%
[0014] Sorbitol 1-9%
[0015] Starch 0-3%
[0016] Yeast extract 0-3%
[0017] Peptone 0-3%
[0018] Ammonium sulfate 0-1.5%
[0019] Potassium dihydrogen phosphate 0.1-0.5%
[0020] Magnesium sulfate 0.05–0.2%
[0021] Potassium chloride 0.05-0.15%
[0022] Calcium chloride 0.05-0.15%
[0023] In a preferred embodiment, the temperature of the aerobic fermentation is 23–30°C, preferably 25–27°C; the pH of the culture medium is 5.0–7.0, preferably 5.0–6.0; the culture time is 96–144 hours, preferably 96–120 hours; and the aeration rate is 0.5–1.2 vvm, preferably 0.8–1.0 vvm.
[0024] In a preferred embodiment, the Penicillium sp. HDCC00055 is cultured by inoculating the nutrient medium with seed liquid for fermentation.
[0025] The seed solution is obtained by culturing the Penicillium sp. HDCC00055 according to claim 1 in a seed culture medium.
[0026] In a preferred embodiment, the seed culture medium contains:
[0027] glucose 2-6%
[0028] Ammonium sulfate 0.8-1.5%
[0029] Potassium dihydrogen phosphate 0.02–0.1%
[0030] Magnesium sulfate 0.02–0.1%
[0031] In a preferred embodiment, the conditions for seed culture are as follows: the temperature for seed culture is 23–30°C, preferably 25–27°C; the pH of the culture medium is 5.0–7.0, preferably 5.0–6.0; and the culture time is 24–72 hours, preferably 30–40 hours.
[0032] In a preferred embodiment, the key control index for the seed culture medium during transplantation is pH 2.5–4.0.
[0033] Atpenin A5 of this invention was detected by HPLC under the following conditions:
[0034] The conditions for the liquid chromatography method used in the Atpenin A5 potency assay of this invention are as follows:
[0035] The HPLC detection method is as follows:
[0036] Column: C18 4.6*250mm 5um
[0037] Column temperature: 35℃
[0038] Injection volume: 5ul
[0039] Mobile phase: A (water): B (0.1% formic acid acetonitrile solution) = 65:35
[0040] Flow rate: 1.0 ml / min.
[0041] The main biological characteristics of *Penicillium sp.* HDCC00055 (CGMCC NO.23056) described in this invention are as follows: colonies are perfectly round with neat edges, abundant central spores, a dark green surface, white aerial hyphae at the edges, slightly raised edges, and a light yellow reverse side. There is no exudate or soluble pigment. Under a microscope, the hyphae are coarse and reticulate, producing multicellular conidiophores at the apex. The conidia are broom-shaped and stain well.
[0042] The Penicillium sp. HDCC00055 (CGMCC NO.23056) strain described in this invention is a novel Atpenin A5 producing strain with high production capacity. Its ability to accumulate Atpenin A5 through fermentation is significantly improved compared to other strains in the prior art, and the Atpenin A5 titer can reach more than 314 mg / L, which is convenient for industrial production. Attached Figure Description
[0043] Figure 1 This is a colony characteristic diagram of the strain Penicillium sp. HDCC00055 (CGMCC NO.23056).
[0044] Figure 2 The original production strain, Penicillium sp. ATP-434, was isolated and extracted from the bacterial cells after fermentation culture, and the Atpenin A5 spectrum was detected by HPLC. Detailed Implementation
[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0046] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available products that can be purchased on the market.
[0047] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention.
[0048] Example 1: Source of the strain
[0049] Soil samples were taken from Linghu Scenic Area in Anqing, Anhui Province, my country. These samples were added to 50 mL of sterile water and shaken at 250 rpm for 10 min to obtain a soil bacterial stock solution. 1 mL of this stock solution was inoculated into PDB medium containing 50 mg / L penicillin and incubated overnight at 25°C and 250 rpm. The solution was then sequentially diluted with sterile water to obtain four different concentrations: 10⁻², 10⁻³, 10⁻⁴, and 10⁻⁵. 100 μL of each concentration was spread onto PDA plates containing 50 mg / L penicillin and incubated at 25°C for 4 days. After colony growth, plates containing single colonies of appropriate concentrations were selected. Round, blue-spore-rich single colonies were picked from these plates and streaked onto PDA plates for purification. The purified strains were then used to prepare PDA slant bacterial cultures. Spore suspensions were prepared from slant culture and inoculated onto PDA plates coated with *Candida albicans* using the filter paper disc method. The plates were incubated at 25°C for 5 days, and the presence of *Penicillium* growth and a clear inhibition zone was observed. *Penicillium* colonies with large inhibition zones were selected, and colonies and bottom agar medium were excavated using an 8mm punch and added to 10ml centrifuge tubes. 1ml of anhydrous ethanol was added, and the mixture was shaken with three glass beads for 30 minutes. After centrifugation, the supernatant was filtered and analyzed by HPLC. Strains and samples with the same retention time as the Atpenin A5 reference standard were retained. Further molecular weight determination was performed using LCMS, ultimately yielding the original production strain for Atpenin A5 (original number ATP-434).
[0050] Example 2: Screening of high-yield Atpenin A5 strains
[0051] Using the original bacterial strain (ATP-434) as the starting strain, 0.1 ml of glycerol was inoculated onto a PDA slant and incubated at 25°C for 7 days. Fresh bacterial spores were washed off with pH 6.5 phosphate buffer, and the mixture was shaken with glass beads to obtain a spore suspension. The spore suspension was mixed with an equal volume of 860 μg / ml NTG stock solution and incubated on a shaker at 25°C for 30 min to induce mutagenesis. The mutagenic solution was transferred to a centrifuge tube, centrifuged at 14000 rpm, and the supernatant was discarded. The suspension was resuspended in 0.1% sodium thiosulfate solution, and this centrifugation and washing process was repeated three times, followed by serial dilutions. Different dilutions were plated onto PDA plates and incubated at 25°C for 3 days to obtain single colonies. Single colonies were isolated and inoculated one-to-one onto fresh PDA plates, incubated at 25°C for 5 days to obtain purified single colonies. A small amount of spores from each single colony were scraped off with an inoculation spatula and inoculated into a liquid primary screening fermentation medium, then stirred and incubated on a shaker at 25°C and 250 rpm for 5 days to obtain the primary screening fermentation broth. 2 ml of the fermentation broth was soaked in 2 ml of anhydrous ethanol, sonicated for 30 min, centrifuged, filtered, and analyzed by HPLC. The highest-producing strain was selected as *Penicillium* sp. HDCC00055 (CGMCC NO. 23056).
[0052] The initial screening fermentation medium consisted of 40 g / L glucose, 20 g / L soybean meal, 0.7% ammonium sulfate, 1 g / L sodium chloride, and pH 6.0.
[0053] The HPLC detection method is as follows:
[0054] Column: C18 4.6*250mm 5um
[0055] Column temperature: 35℃
[0056] Injection volume: 5ul
[0057] Mobile phase: A (water): B (0.1% formic acid acetonitrile solution) = 65:35
[0058] Flow rate: 1.0 ml / min.
[0059] Example 3: Morphological examination and 18S rDNA identification of high-yielding Atpenin A5 strain (CGMCC NO.23056)
[0060] Glycerol tubes containing CGMCC NO.23056 strain were diluted and spread onto PDA plates, then incubated at 25℃ for 3 days. Colonies were perfectly round with neat edges, abundant central spores, a dark green surface, and slightly raised white aerial hyphae at the edges. The reverse side was pale yellow, with no exudate or soluble pigment. Microscopic observation revealed coarse, reticulate hyphae producing multicellular conidiophores at the apex. The conidia were broom-shaped and stained well. pH tests showed the optimal growth pH range for this strain was 4.0–6.0, and temperature tests showed the optimal growth temperature range was 23–28℃.
[0061] Example 4: Strain Identification
[0062] The 18S rDNA sequence analysis of *Penicillium sp.* HDCC00055 (CGMCC NO.23056) was performed according to the relevant content in *Molecular Cloning: A Laboratory Manual*. Bacterial cells were collected, and total DNA was extracted using a fungal DNA extraction kit.
[0063] PCR amplification was performed using universal primers (BioRad, USA, PTC200 amplification instrument). The PCR products were identified by 0.9% agarose gel electrophoresis. Purification and recovery were performed using the AxyPrep gel recovery kit. The purified products were identified by the Institute of Biotechnology, Zhejiang University of Technology, for 18S rDNA sequencing.
[0064] The universal primer sequence is as follows: NS1 GTAGTCATATGCTTGTCTC
[0065] NS6 GCATCACAGACCTGTTATTGCCTC
[0066] The 18S rDNA sequence (SEQ ID NO:1) of strain (Penicillium sp.) HDCC00055 was collated and compared with the homologous sequences of related species and genera in the GenBank database using BLAST. The strain was finally identified as Penicillium sp.
[0067] The 18S rDNA sequence (SEQ ID NO:1) and BLAST alignment results of this bacterial strain are shown in Table 1 (only type strains with high homology are listed in the table):
[0068] Table 1. Homology between strain (Penicillium sp.) HDCC00055 and typical type strain
[0069]
[0070]
[0071] Example 5: Preparation of Atpenin A5 by shake-flask fermentation
[0072] Glycerol tubes containing CGMCC strain NO.23056 were streaked onto PDA slant culture medium and incubated at 25℃ for 3-5 days to obtain slant spores. A small amount of spores was scraped off with an inoculation spatula and inoculated into liquid seed culture medium. The medium was incubated at 25℃ for 40 hours to obtain shake flask seed culture. The seed culture was transplanted when the pH reached 2.5-4.0, with a fermentation transplanting volume of 5%. After transplanting, the shake flask fermentation was placed at 25℃ and shaken on a shaker at 250 rpm for 120 hours. 1 ml of the fermentation broth was soaked in anhydrous ethanol, centrifuged, and filtered. The supernatant was analyzed by HPLC. The titer of Atpenin A5 in this batch of fermentation broth was 396 mg / L.
[0073] The seed culture medium consisted of: 2% glucose, 0.8% ammonium sulfate, 0.02% potassium dihydrogen phosphate, 0.1% magnesium sulfate, and pH 6.0.
[0074] The fermentation medium consisted of: 9% sorbitol, 3% starch, 3% yeast extract, 1.5% ammonium sulfate, 0.5% potassium dihydrogen phosphate, 0.05% magnesium sulfate, 0.15% potassium chloride, 0.05% calcium chloride, and pH 6.0.
[0075] Example 6: Preparation of Atpenin A5 by shake-flask fermentation
[0076] Glycerol tubes containing CGMCC strain NO.23056 were streaked onto PDA slant culture medium and incubated at 25℃ for 3-5 days to obtain slant spores. A small amount of spores was scraped off with an inoculation spatula and inoculated into liquid seed culture medium. The medium was then incubated at 27℃ for 30 hours to obtain a shake flask seed culture. The seed culture was transplanted when the pH reached 2.5-4.0, with a fermentation transplanting volume of 20%. After transplanting, the shake flask fermentation was placed at 27℃ and shaken on a shaker at 250 rpm for 96 hours. 1 ml of the fermentation broth was soaked in anhydrous ethanol, centrifuged, and filtered. The supernatant was analyzed by HPLC. The titer of Atpenin A5 in this batch of fermentation broth was 412 mg / L.
[0077] The seed culture medium consisted of: 6% glucose, 1.5% ammonium sulfate, 0.1% potassium dihydrogen phosphate, 0.02% magnesium sulfate, and pH 5.0.
[0078] The fermentation medium consisted of: 4% glucose, 1% sorbitol, 3% peptone, 0.1% potassium dihydrogen phosphate, 0.2% magnesium sulfate, 0.05% potassium chloride, 0.15% calcium chloride, and pH 5.0.
[0079] Example 7: Preparation of Atpenin A5 50L tank fermentation
[0080] Glycerol tubes containing CGMCC strain NO.23056 were streaked onto PDA slant agar plates and incubated at 25°C for 3-5 days to obtain slant spores. A small amount of spores was scraped off with an inoculation spatula and inoculated into liquid seed culture medium. The plates were then incubated at 27°C for 40 hours to obtain the primary shake-flask seed culture. The primary shake-flask seed culture was inoculated at a ratio of 0.05% into a seed tank containing 10L of liquid culture medium. The temperature was set at 27°C, the tank pressure at 0.05MPa, and the air flow rate at 1vvm. Initial stirring was at 100rpm, and dissolved oxygen was controlled to ≥40% with the stirring linkage. The incubation period was 30 hours. Transplanting was performed when the pH of the secondary seed culture reached between 2.5 and 4.0. The secondary seed culture was inoculated at a ratio of 10% into a fermenter containing 30L of liquid fermentation medium. The temperature was set at 26°C, the tank pressure at 0.05MPa, and the air flow rate at 1vvm. Initial stirring was at 100rpm. Once the dissolved oxygen dropped below 20%, the stirring linkage was activated, and dissolved oxygen was controlled to ≥10%. After 24 hours of fermentation, the pH was controlled with alkaline water to maintain it between 5.0 and 6.0. Samples were taken daily after 24 hours of fermentation to test the potency. Specifically, 1 ml of the fermentation broth was soaked in anhydrous ethanol, centrifuged, filtered, and then analyzed by HPLC. Ultimately, the potency of Atpenin A5 in the fermentation broth reached 418 mg / L.
[0081] The seed culture medium consisted of: 4% glucose, 1.0% ammonium sulfate, 0.1% potassium dihydrogen phosphate, 0.1% magnesium sulfate, and pH 6.0.
[0082] The fermentation medium consisted of: 2% glucose, 6% sorbitol, 2% corn starch, 1% yeast extract, 2% peptone, 0.5% potassium dihydrogen phosphate, 0.2% magnesium sulfate, 0.15% potassium chloride, 0.15% calcium chloride, and pH 6.0. sequence list <110> Zhejiang Hunda Biotechnology Co., Ltd. <120> A Penicillium fungus and a method for fermenting Atpenin A5 <130> P0102022060594 <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 576 <212> DNA <213> Artificial Sequence <400> 1 atttccgtag gggaacctgc ggaaggatca ttaccgagtg agttccctct gacctcccac 60 ccgtgtttat tttaccttgt tgcttacgcg agcctgcctt cgggctgccg gggggcatct 120 gcccccgggt ccgcgctcgc cggagacacc tcgaactctg tctgaagatt gtagtctgag 180 acaaaatata aattatttaa aactatcaac aacggatctc ttggttccgg catcgatgaa 240 agacgcagcg aaatgcgata cgtaatgtga attgcagaat tcagtgaatc atcgagtctt 300 tgaacctaca ttgcgccctc tggtattccg gagcccatgc ctgtccgagc gtcattgctg 360 ccctcaagca cggcttgtgt gttgggctcc gtcctccttc tggggggacg ggcccgaaag 420 gcagcggcgg caccgcgtcc ggtcctcgag cgtatggggc tttgtcaccc gctctgtagg 480 actggccggc gcctgccgat caaccaaact tttttccagg ttgacctcgg atcaggtagg 540 gatacccgct gaacttaagc atatcaataa ttgccg 576
Claims
1. A Penicillium sp. Penicillium sp. )HDCC00055 deposited with the China General Microbiological Culture Collection Center (CGMCC) on July 26, 2021, and assigned accession number CGMCC NO.23056.
2. The Penicillium according to claim 1 ( Penicillium sp. HDCC00055 is used in the preparation of Atpenin A5 or pharmaceutical compositions containing Atpenin A5.
3. A fermentation broth containing the Penicillium sp. HDCC00055 as described in claim 1.
4. A method for preparing Atpenin A5, characterized in that: This includes preparation by fermentation using Penicillium sp. HDCC00055 as described in claim 1.
5. The method according to claim 4, characterized in that: The fermentation process involves aerobic fermentation in a nutrient medium containing an assimilated carbon source and / or nitrogen source.
6. The method according to claim 5, characterized in that: The assimilable carbon source is selected from one or any combination of glucose, glycerol, sorbitol, sucrose, maltose, dextrin, and starch.
7. The method according to claim 6, characterized in that: The assimilable carbon source is one or any combination of glucose, starch, or sorbitol.
8. The method according to claim 5, characterized in that: The assimilable nitrogen source is selected from one or any combination of soybean meal, cottonseed meal, corn gluten meal, corn flour, wheat germ powder, yeast extract, peptone, yeast extract, and corn steep liquor.
9. The method according to claim 8, characterized in that: The assimilable nitrogen source is one or a combination of soybean meal, cottonseed meal, or any combination thereof.
10. The method according to claim 5, characterized in that: The nutrient culture medium also includes inorganic salts, which are one or any combination of ammonium sulfate, potassium dihydrogen phosphate, magnesium sulfate, potassium chloride, and calcium chloride.
11. The method according to claim 5, characterized in that: The nutrient culture medium contains: glucose 0-4%, sorbitol 1-9%, starch 0-3%, yeast extract 0-3%, peptone 0-3%, ammonium sulfate 0-1.5%, potassium dihydrogen phosphate 0.1-0.5%, magnesium sulfate 0.05-0.2%, potassium chloride 0.05-0.15%, and calcium chloride 0.05-0.15%.
12. The method according to claim 5, characterized in that: The aerobic fermentation temperature is 23~30℃; the culture medium pH is 5.0~7.0; the culture time is 96~144 hours; and the aeration rate is 0.5~1.2 vvm.
13. The method according to claim 12, characterized in that: The temperature for the aerobic fermentation is 25~27℃.
14. The method according to claim 12, characterized in that: The pH of the culture medium for aerobic fermentation is 5.0~6.
0.
15. The method according to claim 12, characterized in that: The aerobic fermentation process takes 96 to 120 hours.
16. The method according to claim 12, characterized in that: The aeration rate for the aerobic fermentation is 0.8~1.0 vvm.
17. The method according to any one of claims 4-16, characterized in that: The Penicillium ( Penicillium sp. HDCC00055 was cultured by inoculating the nutrient medium with seed liquid for fermentation. The seed solution is the Penicillium fungus described in claim 1 (… Penicillium sp. HDCC00055 was obtained by seed culture in seed culture medium.
18. The method according to claim 17, characterized in that: The seed culture medium contains 2-6% glucose, 0.8-1.5% ammonium sulfate, 0.02-0.1% potassium dihydrogen phosphate, and 0.02-0.1% magnesium sulfate.
19. The method as described in claim 17, characterized in that: The conditions for seed culture are as follows: seed culture temperature is 23~30℃; culture medium pH is 5.0~7.0; culture time is 24~72 hours.
20. The method as described in claim 19, characterized in that: The conditions for seed culture are: seed culture temperature of 25~27℃.
21. The method as described in claim 19, characterized in that: The conditions for seed culture are: the pH of the culture medium is 5.0~6.
0.
22. The method as described in claim 19, characterized in that: The conditions for seed culture are: culture time of 30-40 hours.
23. The method according to claim 19, characterized in that: The key control index for the seed culture medium during transplantation is pH 2.5~4.0.
Citation Information
Patent Citations
Bacterial strain for producing chicamycin compound and application of bacterial strain
CN117721042A
Method for preparing Atpenin A5
CN117925745A