Attenuated Pseudomonas aeruginosa engineered bacteria and construction method and application thereof

Abstract

The present invention relates to an attenuated Pseudomonas aeruginosa engineered bacterium and a construction method and application thereof, and the engineered bacterium is obtained by knocking out the psl, mexT genes, and one or more genes among pilA, fliC, algD, phzA2G2, and qscR in Pseudomonas aeruginosa. The present invention constructs a plurality of different knockout combination recombinant bacteria by inhibiting the expression of psl, pilA, fliC, algD, phzA1G1, phzA2G2, mexT, and qscR genes in Pseudomonas aeruginosa. Compared with Pseudomonas aeruginosa as a starting strain, the total rhamnolipid production of the recombinant bacteria is increased to varying degrees, the toxicity level is reduced, and some recombinant bacteria increase the proportion of dirhamnolipid in the product.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to genetic modification of a strain of Pseudomonas aeruginosa JLDR7 with high production of dirhamnolipid to reduce the strain toxicity and make it more suitable for industrial production. Background Art

[0002] Pseudomonas aeruginosa, also known as Pseudomonas aeruginosa, is an environmental microorganism that is widely distributed in natural environments such as water and soil. It is also a conditional pathogen. The pathogenicity of Pseudomonas aeruginosa stems from the fact that it contains a variety of virulence factors, including biofilms, pili, flagella, brown algae polysaccharides, pyocyanin, etc. Fimbrial protein (PilA) is an important structural monomer that makes up pili. It adheres to the surface of different hosts by mediating the movement of strains and initiates host infection. Pili are also related to different patterns of biofilm production and multidrug resistance. The flagella of Pseudomonas aeruginosa are mainly composed of flagellin (FliC) and other matrix components. The FliC protein in the flagellum binds to the membrane glycolipids on the surface of lung epithelial cells, causing lung lesions.

[0003] Another important reason why Pseudomonas aeruginosa can cause infection is that it is very easy to form biofilm. Biofilm can wrap microorganisms in it and resist the removal of microorganisms by antibiotics or immune cells. Extracellular polysaccharides Psl and Alginate are important components of the extracellular polymer matrix, which can promote the adhesion of bacterial cells on the surface of the medium and maintain the biofilm structure. The acetyl groups contained in brown algae polysaccharides give it high viscosity, enhance the persistence of bacterial adhesion in the lungs, and remove the reactive oxygen released by activated macrophages and neutrophils, protecting Pseudomonas aeruginosa from the host's phagocytosis in the lungs, causing lung inflammation. Pyocyanin (PCN) is a blue-green, active redox secondary metabolite produced by Pseudomonas aeruginosa. It not only makes the colony appear blue-green, but also is a pathogenic factor and pro-inflammatory mediator. After entering the host cell, pyocyanin will inhibit the respiratory chain, change the intracellular redox level and cause oxidative damage to the host.

[0004] The conditional pathogenicity of Pseudomonas aeruginosa limits its application in the industrial production of rhamnolipids. In order to reduce the virulence level of the strain, its typical virulence factors pili (pilA), flagella (fliC), biofilm polysaccharide (psl), fucoidan (algD) and pyocyanin (phzA1G1, phzA2G2) were selected as gene knockout targets to transform the strain. Knocking out the quorum sensing inhibitory genes (mexT, qscR) upregulated the quorum sensing levels of the strain LasR / LasI and RhlR / RhlI, thereby improving the production level of rhamnolipids. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects of the above-mentioned prior art and provide a method for reducing the virulence level of the strain and increasing the rhamnolipid production by regulating the transcription level of virulence factors and quorum sensing inhibitors.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0007] A attenuated Pseudomonas aeruginosa engineered bacterium is obtained by knocking out the psl and mexT genes and one or more genes among pilA, fliC, algD, phzA2G2 and qscR in Pseudomonas aeruginosa.

[0008] The present invention achieves the reduction of virulence level and the improvement of quorum sensing level by inactivating one or more of virulence factors PilA, FliC, Psl, Alginate, Pyocyanin, MexT and QscR. PilA, FliC, Psl, Alginate, Pyocyanin are representative virulence factors in Pseudomonas aeruginosa, which are involved in regulating the adaptation and drug resistance of Pseudomonas aeruginosa to the environment, and MexT and QscR inhibit the levels of LasR / LasI and RhlR / RhlI in the quorum sensing system. Through different gene knockout combinations, the production of rhamnolipid is higher than that of the original strain, and the virulence level relative to the original strain is also significantly reduced.

[0009] As a preferred embodiment, the psl and mexT genes in Pseudomonas aeruginosa are knocked out;

[0010] or knocking out the psl, mexT, and pilA genes in Pseudomonas aeruginosa;

[0011] or knocking out the psl, mexT, pilA, and fliC genes in Pseudomonas aeruginosa;

[0012] or knocking out the psl, mexT, pilA, fliC, algD, phzA2G2, and qscR genes in Pseudomonas aeruginosa;

[0013] Or knock out the psl, mexT, pilA, fliC, algD, phzA1G1, phzA2G2, and qscR genes in Pseudomonas aeruginosa to obtain the engineered bacteria.

[0014] As a preferred embodiment, the psl and mexT genes in Pseudomonas aeruginosa are knocked out;

[0015] or knocking out the psl, mexT, and pilA genes in Pseudomonas aeruginosa;

[0016] Or the psl, mexT, pilA, fliC, algD, phzA2G2, and qscR genes in Pseudomonas aeruginosa are knocked out to obtain the engineered bacteria.

[0017] The three engineered bacteria constructed in this embodiment have reduced virulence levels and increased rhamnolipid production, and the proportion of dirhamnolipids in the products is also higher than that of the original strains.

[0018] As a preferred embodiment, the Pseudomonas aeruginosa is Pseudomonas aeruginosa JLDR7. The Pseudomonas aeruginosa used in the present invention may be a wild strain of Pseudomonas aeruginosa JLDR7 or other Pseudomonas aeruginosa that can produce rhamnolipids or has the potential to produce rhamnolipids. There is no particular limitation on the strain to which the strain belongs. It may be a wild strain of Pseudomonas aeruginosa or a strain obtained by artificial or natural mutation or transformation. Theoretically, it can also be achieved by using rhamnolipid-producing strains of other species, such as rhamnolipid-producing strains of the genus Pseudomonas. Pseudomonas aeruginosa JLDR7 is a preferred example.

[0019] The second object of the present invention is to provide a method for constructing the attenuated Pseudomonas aeruginosa engineered bacteria, comprising:

[0020] 1) Amplify the upstream and downstream arms of the psl gene;

[0021] 2) Recombining the upstream and downstream arms with the linearized vector to construct a recombinant plasmid with psl knockout;

[0022] 3) transforming the recombinant plasmid into Pseudomonas aeruginosa, and obtaining a psl-deficient strain after homologous exchange and screening;

[0023] 4) Knock out other genes in the same way.

[0024] The third object of the present invention is to provide the use of the attenuated Pseudomonas aeruginosa engineered bacteria in fermentation to produce rhamnolipids.

[0025] As a preferred embodiment, during shake flask culture, the attenuated Pseudomonas aeruginosa engineered bacteria ferments and produces rhamnolipids using glycerol as a carbon source.

[0026] As a preferred embodiment, during the scale-up culture in the fermenter, the attenuated Pseudomonas aeruginosa engineered bacteria uses rapeseed oil as a carbon source to ferment and produce rhamnolipids.

[0027] As a preferred embodiment, when the fermenter is scaled up for culture, the attenuated Pseudomonas aeruginosa engineered bacteria uses an inorganic nitrogen source as a carbon source to ferment and produce rhamnolipid.

[0028] As a preferred embodiment, after the attenuated engineered Pseudomonas aeruginosa is cultured as a seed in a nutrient broth medium, the seed liquid is inoculated into a fermentation medium for fermentation culture.

[0029] At present, in the research on the production of rhamnolipids by Pseudomonas aeruginosa, most of them start from the rhamnolipid metabolic pathway and its byproduct competition pathway for genetic engineering modification, and many modifications can only be anchored at one or two points for modification, and the effect of increasing the production of rhamnolipids is limited. The present invention constructs recombinant bacteria JLDR7-1~JLDR7-7 by inhibiting the expression of psl, pilA, fliC, algD, phzA1G1, phzA2G2, mexT, and qscR genes in Pseudomonas aeruginosa. Compared with Pseudomonas aeruginosa as the starting strain, the total rhamnolipid production of the recombinant bacteria is increased to varying degrees, the toxicity level is reduced, and some recombinant bacteria increase the proportion of di-rhamnolipids in the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is an agarose gel image of each modified strain JLDR7-1 to JLDR7-7 obtained after knocking out the psl, pilA, fliC, algD, phzA1G1, phzA2G2, mexT, and qscR genes; in the figure, M: DNA Marker; lanes 1 to 2: primers pslA-UF and pslA-DR amplify wild strain JLDR7 and strain JLDR7-1; lanes 3 to 4: primers mexT-UF and mexT-DR amplify JLDR7 and JLDR7-2; lanes 5 to 6: primers pilA- Lanes 7-8: primers fliC-UF and fliC-DR amplified JLDR7 and JLDR7-4; lanes 9-10: primers qscR-F and phzA2G2-R amplified JLDR7 and JLDR7-5; lanes 11-12: primers algD-UF and algD-DR amplified JLDR7 and JLDR7-6; lanes 13-14: primers phzA1G1-F and phzA1G1-R amplified JLDR7 and JLDR7-7.

[0031] Figure 2 These are the survival curves of the modified strains JLDR7-1 to JLDR7-7 infected with G. mellonella after knocking out the psl, pilA, fliC, algD, phzA1G1, phzA2G2, mexT, and qscR genes; A: PAO1; B: JLDR7; C: JLDR7-1; D: JLDR7-2; E: JLDR7-3; F: LDR7-4; G: JLDR7-5; H: JLDR7-6; I: JLDR7-7.

[0032] Figure 3 It is the total rhamnolipid concentration synthesized by the modified strains JLDR7-1 to JLDR7-7 and the wild-type strain JLDR7.

[0033] Figure 4 This is a graph showing the concentration of dirhamnolipid synthesized by the modified strains JLDR7-1 to JLDR7-7 and the wild-type strain JLDR7.

[0034] Figure 5 This is a graph showing the concentration of dirhamnolipid synthesized by the modified strains JLDR7-1 to JLDR7-7 and the wild-type strain JLDR7. DETAILED DESCRIPTION

[0035] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0036] The experimental methods for which detailed conditions are not specified in the following examples are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0037] Unless otherwise specified, the experimental materials used in the examples of the present invention can be obtained from commercial channels.

[0038] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0039] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0040] In the following examples, Pseudomonas aeruginosa JLDR7 can be found in the reference (Transcription-associated fluorescence-activated droplet sorting for di-rhamnolipid hyperproducers. ACSS Synthetic Biology. 2022, 11: 1992-2000.) and is available to the public from Nanjing University of Technology. The applicant promises to release biological materials to the public within 20 years from the date of application.

[0041] pEX18Gm and E. coli S17-1 were purchased from commercial channels.

[0042] Example 1

[0043] This example is used to illustrate the knockout of genes to obtain recombinant strains JLDR7-1 to JLDR7-7.

[0044] The gene knockout in the present invention adopts a traceless knockout technology, specifically using the homologous upstream and downstream arms of the gene to be knocked out for homologous double exchange. Taking the knockout gene psl as an example, the knockout principle and process of other genes are similar. The gene psl deleted by JLDR7Δpsl has a site of PA2231 (www.pseudomonas.com) on the genome of Pseudomonas aeruginosa JLDR7. The construction of JLDR7Δpsl refers to the construction method of PAO1Δpsl, and the reference document Precision-engineering thePseudomonas aeruginosa genome with two-step allelic exchange.Nature Protocol, 2015, 10(11): 1820-1841. The knockout plasmid is pEX18Gm, and the fragment of the 38th-1437bp of the coding region of the gene is knocked out. Primers are designed according to the psl gene sequence to amplify its upstream and downstream homologous fragments. The primers used for homologous arm amplification are as follows:

[0045] psl_KO_UF:5'-tatgaccatgattacgaattcAGCCCCCCAGGTCGGACC-3'

[0046] psl_KO_UR:5'-cgatgaacatCGTGATCGGCAGAGCAAA-3'

[0047] psl_KO_DF:5'-tcctatgcccACGCCGTCGCCCCGCT-3'

[0048] psl_KO_DR:5'-acgacggccagtgccaagcttCAGGTAGCCTTGGGCCGCGA-3'

[0049] The lengths of the upstream and downstream homologous fragments amplified by PCR are 501bp and 500bp respectively. Then, the homologous fragments are connected to the linearized vector by enzyme cutting by homologous recombination connection method to construct a plasmid pEX18Gm-psl. After it is transformed into E.coli S17-1, the plasmid is introduced into Pseudomonas aeruginosa JLDR7 by the method of biparental conjugation, and integrated into the Pseudomonas aeruginosa JLDR7 genome by homologous single exchange. Then the single exchange strain is screened in LBNS medium supplemented with 10% sucrose to perform homologous double exchange, so that some strains will lack the psl gene, and some strains will recover mutation to the wild type, and then verified by colony PCR to select the deletion mutant strain. Colony PCR uses psl_KO_UF and psl_KO_DR as forward and reverse primers for verification.

[0050] The results are as follows Figure 1 As shown, the deletion mutant was amplified to obtain a fragment of about 1000 bp (lane 1) due to the deletion of most fragments of the psl gene; the recovery mutant obtained a fragment of about 2440 bp, which was consistent with the wild-type strain (lane 2). The recombinant strain with psl gene deletion was selected and named JLDR7-1.

[0051] The knockout of other genes except using different primers, its operation process is exactly the same as the knockout process of psl gene. Therefore, the present invention lists the primers of all gene knockouts, and the specific process of its knockout is no longer repeated.

[0052] Table 1. Primers for gene knockout used in the present invention (without homology arms on the vector)

[0053] Primer Name Primer Sequence (5’-3’) psl_KO_UF AGCCCCCCAGGTCGGACC psl_KO_UR CGTGATCGGCAGAGCAAA psl_KO_DF ACGCCGTCGCCCCGCT psl_KO_DR CAGGTAGCCTTGGGCCGCGA mexT_KO_UF TAGGCCACCAGCAGGCCG mexT_KO_UR GTCGTTATTGATAATGGCT mexT_KO_DF GCCCTCCGGCAGCTA mexT_KO_DR CTGGTGAAGAAAGGCGAC pilA_KO_UF TGTTGGCGGACCAGCTTTT pilA_KO_UR GAATCTCTCCGTTGATTATGTATAGGC pilA_KO_DF GGTGATCGAAGGTGGCTTGTTTAGCC pilA_KO_DR TTGCCGAGGCCCGGCGCATAGCACCCG fliC_KO_UF ACCTGGCCGATGCAGACGCCAA fliC_KO_UR TCCAAAGGACCTATTTCGGTTACCTG fliC_KO_DF GCCCGGGAACGGTCACTC fliC_KO_DR AGGGCAAGCACCATGCCAAGTCGTTCAA qscR_KO_UF ATGCATGATGAGAGAGAGGGATATC qscR_KO_UR TACGCCATCGGCCTGCTCAACTGA <![CDATA[phzA2G2_KO_DF]]> ATGCGAGAGTACCAACGGTTGAAAGGGT <![CDATA[phzA2G2_KO_DR]]> TCAGGTGGGAATACCGTCACGTTTTATT algD_KO_UF AGTGGCCATTGGCAGGCATTTAA algD_KO_UR CGCATTCACCTCGATTGTTTGT algD_KO_DF CGGGCCGCCCCCTGGCCCCGTGA algD_KO_DR GGTAGCCGCTGTCGATGGCTTCGCG <![CDATA[phzA1G1_KO_UF]]> AGCTACCTGGCGGTGCTGGAGAACCA <![CDATA[phzA1G1_KO_UR]]> GAATTGACCAAGGCCATCCTGCAG <![CDATA[phzA1G1_KO_DF]]> GCACAACGTGCGGATCTTCGA <![CDATA[phzA1G1_KO_DR]]> CCAGAAATGATTGGGGTCGTCGGTTCCGA

[0054] Example 2

[0055] Detection of virulence levels of JLDR7-1~JLDR7-7 and the starting strain JLDR7

[0056] Single colonies of JLDR7-1 to JLDR7-7 and the starting strain JLDR7 were inoculated into 5 mL LB liquid medium, respectively, and cultured at 37°C and 200 rpm overnight. The bacterial liquid was transferred to 5 mL LB liquid medium at a 1% inoculation volume and cultured until the absorbance OD 600 0.15 (0.5 McFarland concentration, 1.5×10 8 CFU / mL), at which time the bacterial suspension is in the logarithmic growth phase. Use sterile saline to dilute each bacterial suspension to a concentration of 5 CFU / mL, 5×10 CFU / mL, and 5×10 2 CFU / mL, 5×10 3 CFU / mL, 5×104 CFU / mL.

[0057] The larvae of G. wax moth were purchased from Tianjin Kaide Ruixing Co., Ltd., China, and stored at 4°C in the dark. The larvae of G. wax moth selected in this experiment were about 20 mm in length, healthy cream-yellow in color, without obvious gray-black spots on the body, and weighed about 250 mg. Using a Hamilton microinjector with a range of 25 μL, 10 μL of bacterial solution diluted to the corresponding concentration was accurately aspirated, and the hind legs of the larvae were uniformly selected as the injection site. The larvae were randomly divided into 11 groups (groups 1-9 were experimental groups of PAO1, JLDR7, and JLDR7-1~JLDR7-7, and groups 10 and 11 were control groups). Experimental groups 1-9, each group was divided into 5 bacterial solution injection concentrations (5 CFU / mL, 5×10 CFU / mL, 5×10 2 CFU / mL, 5×10 3 CFU / mL, 5×10 4 CFU / mL), and 10 wax moth larvae were prepared for each bacterial concentration as injection experimental subjects. Control group 10 was injected with 10μL sterile PBS solution as a control, and control group 11 was not treated with any treatment and served as a blank control. After grouping, the larvae were placed in a marked culture dish, and moist filter paper was laid in the culture dish. Each larva was injected as required. The 11 groups of wax moth larvae were put back into the culture dish and incubated at 37°C for 120h. The state of the larvae was observed every 12h, and the number of survivors and deaths was recorded (death manifestations: no activity of the insect body, no reaction when touched). According to the survival rate and mortality rate of the larvae in each period, the larval survival curve was drawn using Graphpad 8.0 software, and the median lethal concentration LD of each bacterial solution was calculated. 50 , LD 50 The lower the value, the lower the virulence level of the strain. As shown in Table 2, the results show that the virulence levels of the strains after the above gene deletions are lower than those of the wild-type strain JLDR7, among which the virulence level of strain JLDR7-6 is the lowest. This shows that the gene knockout sites selected in the present invention can effectively reduce the virulence level of Pseudomonas aeruginosa.

[0058] Table 2. Virulence level determination of modified strains JLDR7-1 to JLDR7-7 and wild-type strain JLDR7

[0059]

[0060]

[0061] Example 3

[0062] Comparison of rhamnolipid production between JLDR7-1~JLDR7-7 and the starting strain JLDR7

[0063] The single colonies of JLDR7-1 to JLDR7-7 and the starting strain JLDR7 were inoculated into 50 mL of RON fermentation medium with glycerol as the carbon source (glycerol 20 g / L, yeast powder 3 g / L, NaNO36 g / L, KH2PO41 g / L, Na2HPO41 g / L, CaCl20.1 g / L, MgSO4·7H2O 0.1 g / L), and cultured at 37°C and 200 rpm for 2 days to obtain the culture fluids of JLDR7-1 to JLDR7-7 and JLDR7, respectively. 40 mL of the culture fluids of JLDR7-1 to JLDR7-7 and JLDR7 were taken, centrifuged at 5000 rpm for 10 min, and the supernatants of each strain were obtained, and the supernatants were adjusted to pH 2 with concentrated hydrochloric acid. Then, an equal volume of chloroform / methanol (v:v=2:1) ​​solution was added, and the mixture was vortexed at high speed for 1 min. The mixture was extracted twice, and the collected organic phases were combined and evaporated in vacuo to finally obtain a paste extract.

[0064] The fermentation results are as follows Figure 3 As shown, the total rhamnolipid production of JLDR7 measured by the anthrone sulfate method was 7.89 g / L, and the rhamnolipid production of other modified strains did not decrease. The rhamnolipid production of the modified strains JLDR7-2 and JLDR7-5 were 19.17 g / L and 19.65 g / L, respectively, indicating that the deletion of mexT and qscR genes increased the rhamnolipid production of the engineered strains.

[0065] In addition, if Figure 4 As shown, the ability of some strains to synthesize di-rhamnolipids was improved after knockout transformation. Compared with the wild-type JLDR7, the di-RLs ratio (86.74%) of strain JLDR7-6 increased by 3.74%, and the total RLs production (18.89 g / L) increased by 1 g / L. Its virulence level was the lowest (108), making it an attenuated strain with high di-rhamnolipid production among the transformed strains.

[0066] Example 4

[0067] Rhamnolipid fermentation of JLDR7-6 with the lowest virulence level.

[0068] A single colony of the JLDR7-6 strain was inoculated into 5 mL of nutrient broth medium (Oxoid Company), and cultured overnight at 37°C and 200 rpm to obtain a culture solution of JLDR7-6. The culture solution was inoculated into 100 mL of nutrient broth medium at 37°C and 200 rpm for 2.5 h to obtain a seed culture solution of JLDR7-6. The seed solution was inoculated into a 2L fermenter (fermentation medium: rapeseed oil 60 g / L, NaNO36 g / L, yeast extract 3 g / L, KH2PO41 g / L, Na2HPO41 g / L, CaCl2·2H2O 0.1 g / L, MgSO40.1 g / L, pH 7.0) at an inoculum of 5% and fermented for 5 days. Every 24 hours, 10 mL of the fermentation broth of JLDR7-6 was taken and centrifuged at 12000 rpm for 2 minutes to obtain the supernatant of the strain, and its residual oil rate and rhamnolipid production were measured. The specific method for residual oil determination is as follows: 700 μL of the supernatant fermentation broth was added with 700 μL of n-hexane, and high-speed vortex was shaken for 1 minute, the organic phase was collected, and evaporated at room temperature to finally obtain the oily extract and weigh it, and the residual oil (g / L) = (the weight of the centrifuge tube containing the residual oil) (g) - Net weight of centrifuge tube (g) / Fermentation broth sampling volume (L) ). The rhamnolipid concentration was measured every 24 hours. Figure 5 As shown, the rhamnolipid concentration on the 5th day measured by the anthrone sulfate method was 85.077 g / L, indicating that the modified strain JLDR7-6 not only has a reduced virulence level, but also has a high rhamnolipid production level, and is a strain with industrial production potential.

Claims

1. An attenuated Pseudomonas aeruginosa engineered bacterium, characterized in that: Knockout of Pseudomonas aeruginosa psl、mexT Gene; or knocking out the psl、mexT , pilA Gene; or knocking out the psl、mexT , pilA , fC Gene; or knocking out the psl、mexT , pilA , fC Gene, oeLh 2 G 2 , QUR Gene; or knocking out the psl、mexT , pilA , fC , aD , oeLh 2 G 2 , QUR Gene; or knocking out psl、mexT , pilA , fC , aD , oeLh 1 G 1 ,phzA 2 G 2 , QUR Gene, to obtain the engineered bacteria; The Pseudomonas aeruginosa is Pseudomonas aeruginosa JLDR7.

2. The method for constructing the attenuated Pseudomonas aeruginosa engineered bacteria according to claim 1, characterized in that: include: 1) Amplification psl Upstream and downstream arms of a gene; 2) Recombining the upstream and downstream arms and the linearized vector to construct psl Knockout recombinant plasmid; 3) The recombinant plasmid is transformed into Pseudomonas aeruginosa, and after homologous exchange and screening, the recombinant plasmid is obtained. psl missing strains; 4) Knock out other genes in the same way.

3. Use of the attenuated Pseudomonas aeruginosa engineered bacteria according to claim 1 in fermentation to produce rhamnolipids.

4. The use according to claim 3, characterized in that: During shake flask culture, the attenuated Pseudomonas aeruginosa engineered bacteria ferments and produces rhamnolipid using glycerol as a carbon source.

5. The use according to claim 3, characterized in that: When the fermenter is scaled up for culture, the attenuated Pseudomonas aeruginosa engineered bacteria ferments and produces rhamnolipids using rapeseed oil as a carbon source.

6. The use according to claim 3, characterized in that: After the attenuated Pseudomonas aeruginosa engineered bacteria are cultured as seeds in a nutrient broth medium, the seed liquid is inoculated into a fermentation medium for fermentation culture.

Images