Crocodile-derived Aeromonas dhakensis phoBR and kdpE gene deletion strains, complemented strains, and their construction methods and applications

Abstract

The present invention discloses a phoBR and kdpE gene deletion strain, a complementary strain of Aeromonas dhakensis from crocodiles, and their construction methods and applications. The phoBR and kdpE gene deletion strain is obtained by simultaneously deleting the phoBR and kdpE genes on the basis of the wild strain of Aeromonas dhakensis; the complementary strain is obtained by complementarily expressing the kdpE gene on the basis of the gene deletion strain. Experiments prove that the genetic stability of the phoBR and kdpE gene deletion strain and its complementary strain is good. Compared with the wild strain and the ΔphoBR deletion strain, the growth of the ΔphoBRΔkdpE deletion strain is not different, but its sensitivity to antimicrobial peptides is enhanced. The immunoprotection test shows that the immunoprotection rates of the ΔphoBRΔkdpE deletion strain and its complementary strain are 43.30% and 55.60% respectively. The present invention provides a technical means for the research of attenuated live vaccines against Aeromonas dhakensis in crocodiles.

Description

Technical Field

[0001] The present invention relates to a phoBR and kdpE gene deletion strain of Aeromonas dhakensis derived from crocodiles and its complementary strain, and also relates to the construction method and application of the deletion strain and the complementary strain. The present invention belongs to the field of biotechnology. Background Art

[0002] Crocodiles are animals belonging to the order Crocodilia of the class Reptilia. Currently, three families, namely Crocodylidae, Gavialidae, and Alligatoridae, have been discovered in the world. Crocodile farming brings high edible, medicinal, and economic values (Tang Liang, 2007; Xiao Kun, 2014; Wang Ping, 2011; Lu Qiao, 2011). Currently, due to its excellent geographical and climatic environment, Hainan has multiple crocodile farms and has become a major crocodile farming province in China (Chen Haiyan, 2011), and the main farming variety is the Siamese crocodile. The Siamese crocodile is considered to be one of the crocodilians with the least research and the most endangered in the world (Bezuijen et al., 2013; Thorbjarnarson et al., 1992; Sam et al., 2015).

[0003] Crocodiles will eat a variety of prey, including not only various animals but also rotten meat (Daltry et al., 2003), and there are various pathogens in their living environment, but wild crocodiles are rarely found to be infected by bacteria or viruses (Jeyamogan et al., 2017), which is attributed to their powerful immune system. Crocodile blood has good antibacterial (Merchant et al., 2004), anti-tumor (Geng Di et al., 2012), and antioxidant (Huang Heping et al., 2014) effects. Relevant studies have found that the serum of crocodiles can produce effective antibacterial activity against Gram-negative bacteria such as Klebsiella pneumoniae, Salmonella typhimurium, and Pseudomonas aeruginosa (Leelawongtawon et al., 2010).

[0004] Aeromonas dhakensis is a pathogenic bacterium of a new emerging infectious disease that is prevalent in tropical and subtropical regions and infects humans and animals. There have been reports of human and animal infections by this bacterium in tropical and subtropical regions. In 2016, our laboratory also isolated this bacterium from diseased juvenile crocodiles in a crocodile farm in Hainan, and its harm to the crocodile farming industry is becoming increasingly serious (Wang Aiyuan, 2019).

[0005] Current research has found that young alligators are usually killed after Aeromonas infection (Turutoglu et al., 2004; Turutoglu et al., 2005; Thongkamkoon et al., 2018). Co-infection with Aeromonas sobria and Chlamydia causes systemic diseases in alligators, especially damage to the liver and spleen; after infection with Aeromonas hydrophila, it can lead to septicemia in alligators; the symptoms after Aeromonas dhakensis infection are similar, causing outbreaks of bacteremia in alligator populations, as well as symptoms such as liver hemorrhage and pulmonary embolism (Guo et al., 2018; Pu et al., 2019; Rehman et al., 2019). In 2016, a large number of young alligators died due to Aeromonas dhakensis infection in the alligator farming industry in Hainan, resulting in huge economic losses (Pu et al., 2019). Therefore, the research on alligator etiology and prevention is of great significance. Summary of the Invention

[0006] One of the purposes of the present invention is to provide an Aeromonas dhakensis phoBR and kdpE gene deletion strain and its complementary strain derived from alligators.

[0007] Another purpose of the present invention is to provide a method for constructing the above-mentioned gene deletion strain and its complementary strain.

[0008] A third purpose of the present invention is to provide the application of the above-mentioned gene deletion strain and its complementary strain.

[0009] In order to achieve the above purposes, the present invention adopts the following technical means:

[0010] An Aeromonas dhakensis phoBR and kdpE gene deletion strain or its complementary strain derived from alligators proposed by the present invention, wherein the Aeromonas dhakensis phoBR and kdpE gene deletion strain is obtained by simultaneously deleting the phoBR and kdpE genes on the basis of the wild strain of Aeromonas dhakensis, named ΔphoBRΔkdpE; the complementary strain is obtained by complementing and expressing the kdpE gene on the basis of the Aeromonas dhakensis phoBR and kdpE gene deletion strain, named ΔphoBRΔkdpE+CkdpE.

[0011] Preferably, the complementary strain constitutively expresses kdpE.

[0012] Preferably, the wild strain of Aeromonas dhakensis is A.dhakensis C160501.

[0013] Furthermore, the present invention also proposes a method for constructing the Aeromonas dhakensis phoBR and kdpE gene deletion strain or its complementary strain derived from alligators, including the following steps:

[0014] (1) Design primers and send them to the company for synthesis. The primer sequences are as follows:

[0015] kdpE up-F: GCTCTAGAACCCTGTCGGTCTATTTTCTGG

[0016] kdpE up-R: CGAGCTGGAGGTTGATGATGTTTCACGTGG

[0017] kdpE down-F: TCAACCTCCAGCTCGCTGAT

[0018] kdpE down-R: CGAGCTCAACCGGGACAGACCGAC

[0019] ΔkdpE-F: TGGTTATCTCGGGGTATTTG

[0020] ΔkdpE-R: CTGTCTCCCACGATTTGAA

[0021] F0: ACCAGGCCATCACCTTCTTTA

[0022] R0: AGTTGCTGCATGGACAGGCC

[0023] pRE112-F: ACCGTAACACGCCACATCTT

[0024] pRE112-R: GCTTCCCTGCTGTTTTGTGG

[0025] kdpEDB-F: TCAGCTGCCGATAAAGCGGTAGCCG

[0026] kdpEDB-R: ATGGCTCACATACTGGTCATCGACGACG

[0027] kdpEDQ-F: ACAAAATATTAACGCTCAGCTGCCGATAAAGCGG

[0028] kdpEDQ-R: ACACAGGAAACAGCTATGGCTCACATACTGGTCATC

[0029] pBBR1MCS-2Δ(lacZα)-F: AGCTGTTTCCTGTGTGAAATTG

[0030] pBBR1MCS-2Δ(lacZα)-R: GCGTTAATATTTTGTTAAAATTCGCG

[0031] pBBR-F: TATTTAACGACCCTGCCCTG

[0032] pBBR-R: ATCTCATGCTGGAGTTCTTCG

[0033] 2kdpE-F: CTCTAGAGCTGCCGATAAAGCGGT

[0034] 2kdpE-R: GCGAGCTCATGGCTCACATACTGGT

[0035] (2) Genomic DNA extraction of Aeromonas dhakensis wild strain

[0036] Culture the activated and identified Aeromonas dhakensis wild strain at 37°C, and select a bacterial DNA extraction kit to extract the bacterial DNA genome;

[0037] (3) PCR amplification, purification and recovery of target fragments

[0038] 1) Amplification of upstream and downstream homologous arms of kdpE gene

[0039] Using Aeromonas dhakensis wild strain as a template, and primers: kdpE up-F / R and kdpE down-F / R, amplify the upstream and downstream homologous fragments of the kdpE gene respectively;

[0040] 2) Purification and recovery of PCR amplified fragments

[0041] After PCR, use 1% agarose gel electrophoresis to detect. If the size of the obtained band is consistent with the size of the target band, cut the gel block with the target band, and then use a gel extraction / DNA purification kit for purification and recovery;

[0042] (4) Fusion of upstream and downstream homologous arms of kdpE gene

[0043] According to the principle of complementary base pairing, use overlap PCR to overlap and splice the upstream and downstream homologous fragments of the kdpE gene, then use primers kdpE up-F / kdpE down-R to amplify the fused fragment, and then perform purification and recovery of the PCR product;

[0044] (5) Construction of pRE112-ΔkdpE knockout plasmid

[0045] 1) Extraction of pRE112 plasmid

[0046] Escherichia coli WM3064 containing the pRE112 plasmid was taken out from a -80°C refrigerator, activated and cultured in LB liquid medium containing 50 μg / mL chloramphenicol, and then the plasmid was extracted using the plasmid DNA mini extraction kit from Novoprotein;

[0047] 2) Double digestion of the fusion fragment and pRE112 plasmid

[0048] The purified and recovered fusion fragment and pRE112 plasmid were double digested using the restriction endonucleases FastDiges XbaⅠ and FastDigest SacⅠ respectively, and the target products were recovered and purified by gel cutting;

[0049] 3) Ligation reaction

[0050] The upstream and downstream fusion fragments and pRE112 plasmid that had been recovered and purified after double digestion were ligated with T4 ligase to obtain the recombinant plasmid pRE112-ΔkdpE;

[0051] (6) Transformation of the pRE112-ΔkdpE recombinant plasmid

[0052] The ligation solution was added to an EP tube containing Escherichia coli WM3064 competent cells, and the pRE112-ΔkdpE recombinant plasmid was transformed into Escherichia coli WM3064 competent cells;

[0053] (7) Verification of the pRE112-ΔkdpE recombinant plasmid

[0054] 1) Colony PCR was performed on the colonies using the amplification primers kdpE up-F / kdpE down-R of the fusion fragment to verify that the grown colonies were positive clones containing the pRE112-ΔkdpE recombinant plasmid;

[0055] 2) Double digestion identification: The plasmid of the strain with the correct band obtained by colony PCR was extracted, subjected to double digestion identification, and after the identification band sizes were consistent by gel electrophoresis, the bands were purified and recovered and sent to a sequencing company for sequencing;

[0056] (8) Construction of the ΔphoBRΔkdpE deletion strain

[0057] 1) Conjugation transfer

[0058] The Aeromonas dhakensis ΔphoBR deletion strain stored in a -80°C refrigerator and Escherichia coli WM3064 containing the pRE112-ΔkdpE recombinant plasmid were activated, and the obtained Escherichia coli WM3064 containing the recombinant plasmid pRE112-ΔkdpE was co-cultured with the Aeromonas dhakensis ΔphoBR deletion strain. During this period, conjugation transfer occurred, and the recombinant plasmid was transferred from the Escherichia coli cells into the Aeromonas dhakensis ΔphoBR deletion strain;

[0059] Using the primers pRE112-F / R redesigned with the recombinant plasmid as the template, colony PCR identification was performed on the grown single colonies. The sizes of the identification bands after gel electrophoresis were consistent. The bands were purified, recovered, and sent for sequencing.

[0060] 2) Screening for deletion strains

[0061] Take 100 μL of the Aeromonas dhakensis ΔphoBR deletion strain containing the pRE112-kdpE recombinant plasmid cultured overnight and add 900 μL of fresh LB liquid medium; take 100 μL of the diluted bacterial solution and spread it on an LB solid plate containing 20% sucrose, and incubate it upside down at 37 °C for 12 hours; use the primers kdpE up-F / kdpE down-R for colony PCR identification, expand the correct strains, and properly preserve the bacterial strains.

[0062] (9) Construction of the Aeromonas dhakensis complementation strain ΔphoBRΔkdpE+CkdpE

[0063] 1) Amplification of the kdpE gene fragment

[0064] Using the Aeromonas dhakensis wild strain C160501 DNA as the template, the kdpE gene fragment was amplified using the primers kdpEDB-F / R and purified and recovered.

[0065] 2) Seamless cloning

[0066] After extracting the plasmid pBBR1MCS-2, it was digested with ScaI alone, purified, recovered, and preserved. Using the single-digested pBBR1MCS-2 as the template, it was amplified using the primers pBBR1MCS-2Δ(lacZα)-F / R. Then, a suitable-sized sequence was selected at each end of the linearized plasmid, and the selected sequences were ligated to both ends of the kdpE gene fragment through the redesigned primers kdpEDQ-F / R to obtain the kdpE bridging fragment, so that there was a complementary base pair between both ends of the kdpE gene fragment and the vector. Thus, the kdpE gene fragment was ligated to the vector by the method of seamless cloning.

[0067] 3) Transformation of the pBBR1MCS-2Δ(lacZα)-kdpE complementation plasmid

[0068] The pBBR1MCS-2Δ(lacZα)-kdpE complementation plasmid was transferred into the competent cells of Escherichia coli WM3064. Using the grown single colonies as the template, the positive clone strains were verified by PCR using the primers pBBR-F / R and kdpEDB-F / R respectively.

[0069] 4) Screening for complementation strains

[0070] Conjugation transfer was carried out between Escherichia coli WM3064 with the pBBR1MCS-2Δ(lacZα)-kdpE complementary plasmid and Aeromonas dhakensis ΔphoBRΔkdpE. Using the obtained single colony as a template, colony PCR verification was performed using the verification primers pBBR-F / R and the newly designed verification primers 2kdpE-F / R at both ends of kdpE to obtain the complementary strain ΔphoBRΔkdpE+CkdpE.

[0071] Furthermore, the present invention also proposes the application of the crocodile-derived Aeromonas dhakensis phoBR and kdpE gene deletion strains or their complementary strains in the preparation of drugs for treating or preventing diseases caused by Aeromonas dhakensis infection.

[0072] Among them, preferably, the drug is a vaccine.

[0073] Compared with the prior art, the beneficial effects of the present invention are

[0074] The present invention constructs for the first time the ΔphoBRΔkdpE deletion strain of Aeromonas dhakensis and its complementary strain, and the genetics of the deletion strain and its complementary strain are stable. Compared with the wild strain and the ΔphoBR deletion strain, the growth of the ΔphoBRΔkdpE deletion strain is not different, but its sensitivity to antimicrobial peptides is enhanced. Immunoprotection tests show that the immunoprotection rates of the ΔphoBRΔkdpE deletion strain and its complementary strain are 43.30% and 55.60% respectively. The present invention provides a technical means for the research of attenuated live vaccines against Aeromonas dhakensis disease in crocodiles. Description of the Drawings

[0075] Figure 1 Homologous fragment and ΔphoBR fusion fragment;

[0076] (a) 1: Upstream fragment; 2: Downstream fragment; M: DL 2000 Marker;

[0077] (b) 1: Fusion fragment; M: DL 5000 Marker;

[0078] Figure 2 Verification of double digestion;

[0079] 1: Intact plasmid; 2: pK18mobsacB plasmid after double digestion; 3: Fusion fragment after double digestion; 4: Fusion fragment; M: DL 5000 Marker;

[0080] Figure 3 PCR verification of the knockout plasmid;

[0081] 1 - 9: PCR products; M: DL 5000 Marker;

[0082] Figure 4Double digestion identification of the knockout plasmid;

[0083] 1: Double digestion fragments of pK18mobsacB-ΔphoBR plasmid; 2: Recombinant plasmid pK18mobsacB-ΔphoBR;

[0084] 3: pK18mobsacB plasmid; M: DL 5000 Marker;

[0085] Figure 5 PCR verification of the knockout strain;

[0086] 1: Knockout strain; 2: Wild strain; M: DL5000 bp;

[0087] Figure 6 Amplification of upstream and downstream homologous arm fragments;

[0088] M1: DL 2,000 Marker;

[0089] 1: Upstream homologous arm; 2: Downstream homologous arm;

[0090] Figure 7 PCR verification and double digestion of the fusion fragment;

[0091] M2: DL 5,000 Marker; 1: Homologous arm fusion fragment; 2: Purified product of double digestion of the fusion fragment

[0092] Figure 8 Double digestion of pRE112 plasmid;

[0093] M3: DL 15,000 Marker; 1: Intact plasmid; 2: Purified product of double digestion of the plasmid;

[0094] Figure 9 Verification of the recombinant plasmid;

[0095] M3: DL 15,000 Marker; 1: pRE112 plasmid; 2: pRE112-ΔkdpE recombinant plasmid; 3: Double digestion of the recombinant plasmid; 4: Colony PCR verification of the recombinant plasmid; M2: DL 5,000 Marker;

[0096] Figure 10 PCR verification of the knockout strain;

[0097] M2: DL 5,000 Marker; 1: Verification of ΔphoBRΔkdpE deletion strain with F0 / R0; 2: Verification of wild strain C160501 with F0 / R0; 3: Verification of ΔphoBRΔkdpE deletion strain with kdpE-F / R; 4: Verification of wild strain C160501 with kdpE-F / R;

[0098] Figure 11 Amplification of the kdpE bridging fragment and pBBR1MCS-2Δ(lacZα);

[0099] M1: DL 2,000 Marker; M2: DL 5,000 Marker; 1: kdpE bridging fragment; 2: pBBR1MCS-2Δ(lacZα);

[0100] Figure 12 Identification of the complementary plasmid;

[0101] M1: DL 2,000 Marker; (A): 1: Verification fragment of pBBR1MCS-2 plasmid; (B): 2: kdpE fragment;

[0102] Figure 13 Colony PCR of the complementary strain;

[0103] (A): M1: DL 2,000 Marker; 1: Verification fragment of pBBR1MCS-2 plasmid;

[0104] (B): M2: DL 5,000 Marker; 2: kdpE verification fragment;

[0105] Figure 14 Verification by colony PCR;

[0106] M2: DL 5,000 Marker; 1: Verification fragment of pBBR1MCS-2 plasmid;

[0107] Figure 15 Verification of the colony PCR of the deletion strain;

[0108] 1 - 8: PCR products of single colonies after 30 passages; M2: DL 5,000 Marker; 9: PCR product of the primary deletion strain colony;

[0109] 10: PCR product of the wild strain colony; 11: Negative control;

[0110] Figure 16 Difference in the survival rate of bacteria;

[0111] Figure 17 Zebrafish that died of abdominal bleeding. Detailed implementation manners

[0112] The present invention will be further described below through examples, and its purpose is only to better understand the research content of the present invention rather than to limit the protection scope of the present invention.

[0113] Example 1 Construction of the ΔphoBR Aeromonas dhakensis single mutant strain

[0114] 1 Materials and methods

[0115] 1.1 Experimental materials

[0116] 1.1.1 Strains

[0117] The wild strain of A. Dhakensis C160501 was isolated from farmed Siamese crocodiles in Hainan Province and is recorded in the literature (Pu, W., G. Guo, N. Yang, Q. Li, F. Yin, P. Wang, J. Zheng, and J. Zeng. "Three Species of Aeromonas (A. Dhakensis, A. Hydrophila and A. Jandaei) Isolated from Freshwater Crocodiles (Crocodylus Siamensis) with Pneumonia and Septicemia." Lett Appl Microbiol 68, no. 3 (2019): 212 - 18.), and is isolated and preserved by this laboratory.

[0118] 1.1.2 Experimental primers

[0119] The relevant primer sequences designed by Primer Premier 6.0 are shown in Table 1 and are all synthesized by a sequencing company.

[0120] Table 1 Primers of this example

[0121]

[0122] 1.2 Experimental methods

[0123] 1.2.1 Extraction of bacterial genome and total RNA

[0124] (1) Extraction of bacterial genomic DNA

[0125] A. Dhakensis C160501 was activated and cultured on a large scale, and then the bacterial genome was extracted according to the instructions of the bacterial genomic DNA extraction kit of Vazyme Company in the appendix.

[0126] (2) Extraction of bacterial total RNA

[0127] A. Dhakensis C160501 was cultured under phosphorus - limited conditions, and the bacterial liquid was collected at 3 h, 4 h, 5 h, 6 h and 8 h respectively. The bacterial cells were collected by centrifugation at 10,000 rpm for 1 min, and the total RNA was extracted with reference to the instructions of the bacterial RNA extraction kit of Vazyme Company. The specific steps are shown in the appendix.

[0128] 1.2.2 Extraction of bacterial plasmids

[0129] First, activate and expand the strain containing the plasmid under certain conditions, and then extract the plasmid according to the instruction manual of the plasmid extraction kit of Vazyme Company in the appendix.

[0130] 1.2.3 PCR amplification and purification recovery of the target fragment

[0131] Amplify the corresponding target fragment according to the PCR amplification system in Table 2-3 and the reaction conditions in Table 2-4, then perform agarose gel electrophoresis to identify the target band, cut out the correct fragment, and perform purification recovery with reference to the instruction manual of the gel recovery kit of Vazyme Company. The specific steps are shown in the appendix.

[0132] 1.2.4 Construction of the phoBR knockout plasmid

[0133] (1) PCR amplification of the upstream and downstream fragments of the phoBR gene

[0134] Using the genome of Aeromonas dhakensis C160501 as a template, perform PCR amplification of the upstream homologous fragment of the phoBR gene with primers F1 and R1, and at the same time amplify the downstream homologous fragment with primers F2 and R2, and then perform purification recovery respectively.

[0135] (2) Overlap extension PCR of the upstream and downstream fragments of the phoBR gene

[0136] Connect the upstream and downstream homologous fragments of the phoBR gene into a fusion fragment through overlap extension PCR, then add primers F1 and R2 to amplify the fusion fragment in large quantities, and finally perform purification recovery of the fusion fragment.

[0137] (3) Double digestion of the fusion fragment and the pK18mobsacB plasmid

[0138] Use the restriction endonucleases FastDigest EcoR I and FastDigest Hind III to perform double digestion on the purified and recovered fusion fragment and the pK18mobsacB plasmid, and finally cut the gel to purify and recover the target product.

[0139] (4) Ligation reaction

[0140] Use T4 DNA ligase to connect the purified and recovered pK18mobsacB plasmid and the upstream and downstream fusion fragments after double digestion. Mix the ligation solution and centrifuge quickly, and incubate in a constant temperature water bath at 22°C for 1.5 h.

[0141] (5) Transformation of the ligation solution

[0142] Using the heat shock method, the above ligation solution was heat shock transformed into the prepared Escherichia coli X6097 competent cells for 45 seconds. Then, 900 μL of LB liquid medium (50 μg / mL DAP) was added, and after culturing at 37 °C for 1 h, the supernatant was discarded by centrifugation. The remaining transformation products were spread on an LB plate (50 μg / mL Kan and 50 μg / mL DAP) and cultured overnight to screen for positive clones.

[0143] (6) Screening of positive clones

[0144] Pick a single colony from the transformed resistance plate and mix it with 8 μL of ddH2O. Store 5 μL of the bacterial solution at 4 °C temporarily. Heat the remaining 3 μL of the bacterial solution for 2 min to lyse the cells, and then perform PCR amplification using primers F1 and R2. The reaction system refers to Tables 2-3 and 2-4. Then, take 3 μL of the product to run a 1% agarose gel electrophoresis, and judge whether the fragment size is correct according to Marker DL 5000.

[0145] (7) Double digestion identification of the knockout plasmid

[0146] After expanding the culture of the temporarily stored bacterial solution with positive PCR verification, extract the knockout plasmid and perform double digestion verification. At the same time, use the pK18mobsacB plasmid and the positive plasmid as controls. Take 3 μL of the digested sample to run a 1% agarose gel electrophoresis, and judge whether the phoBR knockout plasmid is successfully constructed according to the fragment size.

[0147] 1.2.5 Construction of the ΔphoBR mutant strain

[0148] (1) Conjugal transfer

[0149] ① Activate and culture Aeromonas dhakensis C160501 and X6097 bacteria containing the knockout plasmid in 5 mL of LB liquid medium (50 μg / mL Amp) and 5 mL of LB liquid medium (50 μg / mL Kan and 50 μg / mL DAP) at 37 °C for about 12 h respectively. Then, take the bacterial solution and streak it on an LB plate, and then pick single colonies and add them to LB liquid medium respectively, and culture overnight at 37 °C.

[0150] ② Inoculate the bacterial solutions into fresh corresponding LB liquid media at a volume ratio of 1:50 respectively, and culture at 37 °C until the OD 600 value reaches between 0.4 and 0.6.

[0151] ③ Centrifuge 2 mL of the bacterial solution respectively, take the bacterial cells, and resuspend them in fresh LB liquid medium. Wash again.

[0152] ④ Mix Escherichia coli X6097 containing the knockout plasmid and strain C160501 at ratios of 1:1, 1:3, and 3:1 respectively, and spot them separately on a non-resistant LB plate and culture for one day.

[0153] ⑤ Scrape the bacterial lawns at the three points together with 2 mL of fresh LB medium, dilute to an appropriate concentration, take 50 μL and spread it on an LB plate (50 μg / mL Kan), and culture overnight.

[0154] ⑥ Identify positive colonies by PCR amplification using primers F3 and R3.

[0155] (2) Screening and identification of ΔphoBR mutant strains

[0156] ① Aeromonas dhakensis containing the knockout plasmid was cultured in LB liquid medium containing 50 μg / mL kanamycin at 37 °C for about 12 h.

[0157] ② Dilute the bacterial liquid by different multiples, take 30 μL and spread it on an LB plate (containing 20% sucrose and 50 μg / mL Amp), and culture overnight.

[0158] ③ Use specially designed primers F0 and R0 for colony PCR to verify whether the double crossover is successful.

[0159] ④ Inoculate the verified knockout strain into 5 mL of LB liquid medium (50 μg / mL Amp), and culture it for 12 h for expansion. Take a part of the bacterial liquid, add 30% glycerol, and store the bacterial strain at -80 °C. Another part is used to extract the genome, perform genomic PCR using primers F0 and R0, and send the PCR product to Guangzhou Tianyi Huiyuan Co., Ltd. for sequencing.

[0160] 2 Results and analysis

[0161] 2.1 Construction of ΔphoBR Aeromonas dhakensis mutant

[0162] 2.1.1 Amplification and fusion of upstream and downstream homologous fragments of phoBR

[0163] As Figure 1 shown, genomic PCR of C160501 was used to amplify the homologous fragments on both sides of the phoBR gene. Fragment 1 in Figure (a) is approximately 1027 bp, which is the upstream homologous fragment; fragment 2 is the downstream homologous fragment, with a size of 923 bp. Figure (b) shows the 1930 bp ΔphoBR fusion fragment formed by overlap extension PCR connecting the upstream and downstream homologous fragments, and the size of the target fragment is the same as expected.

[0164] 2.1.2 Double digestion of homologous fusion fragment and pK18mobsacB plasmid

[0165] The pK18mobsacB plasmid and the upstream and downstream fusion fragments were digested simultaneously with FastDigest EcoR I and FastDigest HindIII, and the digested products were recovered. As Figure 2As shown, band 1 represents the complete plasmid pK18mobsacB with a size of 5721 bp, band 2 represents the recovered product of the double-digested pK18mobsacB plasmid with a size of 5670 bp, band 4 represents the fused fragment of the upstream and downstream homologous arms of the phoBR gene with a size of 1934 bp, and band 3 represents the recovered product after double-digestion of the fused fragment of the upstream and downstream homologous arms of the phoBR gene with a size of 1928 bp, which is consistent with the expectation.

[0166] 2.1.3 Identification of the knockout plasmid

[0167] (1) Pick monoclonal colonies with appropriate size and morphology on the LB plate as templates, perform colony PCR using primers F1 and R2, and then verify the PCR products by 1% agarose gel electrophoresis. As Figure 3 shown, the sizes of the PCR product fragments in lanes 4, 7, 8, and 9 are all 1928 bp, which is in line with the expectation.

[0168] (2) Select the positive plasmid verified by colony PCR, and perform rapid double digestion of the plasmid with FastDigest EcoR I and FastDigest HindIII. As Figure 4 shown, the sizes of the bands obtained by double digestion in lane 1 are 1928 bp and 5670 bp, and lanes 2 and 3 are the pK18mobsacB-ΔphoBR recombinant plasmid and the pK18mobsacB plasmid, respectively.

[0169] 2.1.4 Identification of the ΔphoBR mutant strain

[0170] Use the specially designed specific primers F0 and R0 to identify the ΔphoBR mutant strain by colony PCR. As Figure 5 shown, band 1 is the PCR fragment corresponding to the ΔphoBR mutant strain with a size of 1315 bp; band 2 is the PCR fragment corresponding to the wild strain with a size of 3270 bp. It can be concluded that the fragment becomes shorter due to the deletion of the phoBR gene, which is the same as the expectation. Therefore, the construction of the Aeromonas dhakensis ΔphoBR mutant strain is successful.

[0171] Example 2 Construction of phoBR and kdpE gene deletion strains and complemented strains of Aeromonas dhakensis from crocodiles

[0172] 1 Materials and methods

[0173] 1.1 Experimental materials

[0174] 1.1.1 Model animals

[0175] The zebrafish, a model animal used in the study, was purchased from an aquarium in Haikou. Its body shape was basically uniform. It was raised in a flowing water tank at 28 - 29 °C for one week according to the Wester method (Wester, 1995). After the survival rate of the zebrafish stabilized, subsequent experiments were carried out.

[0176] 1.1.2 Experimental primers

[0177] Primers were designed using Primer Premier 6.0 and synthesized by a company. The sequences are shown in Table 2.

[0178] Table 2 Primers related to the experiment

[0179]

[0180]

[0181] 1.2 Experimental methods

[0182] 1.2.1 Strain activation

[0183] First, take the glycerol tube of Aeromonas dhakensis wild strain C160501 from the -80 °C environment, inoculate 10 μL into an LB liquid test tube, and culture it overnight at 37 °C. Then, dip the bacterial liquid with an inoculation loop and streak it on an LB solid petri dish for isolation and culture. Select single colonies on the streak and perform colony PCR identification using primers F0 / R0 before culturing.

[0184] 1.2.2 Genomic DNA extraction of Aeromonas dhakensis wild strain C160501

[0185] Culture the activated and identified Aeromonas dhakensis wild strain C160501 at 37 °C, and select the bacterial DNA extraction kit from Novoprotein to extract the bacterial genomic DNA.

[0186] 1.2.3 PCR amplification and purification recovery of the target fragment

[0187] (1) Amplification of the upstream and downstream homologous arms of the kdpE gene

[0188] Using A. dhakensis C160501 DNA as a template, and primers: kdpE up-F / R and kdpE down-F / R, amplify the upstream and downstream homologous fragments of the kdpE gene respectively.

[0189] (2) Purification and recovery of the PCR amplified fragment

[0190] After PCR is completed, use 1% agarose gel electrophoresis for inspection. If the size of the obtained band is consistent with the size of the target band, cut out the gel block with the target band, and then use the Novoprotein gel extraction / DNA purification kit for purification and recovery.

[0191] 1.2.4 Fusion of the upstream and downstream homologous arms of the kdpE gene

[0192] According to the principle of complementary base pairing, the upstream and downstream homologous fragments of the kdpE gene were overlapped and spliced using overlap PCR, and then the fused fragment was amplified using primers kdpE up-F / kdpE down-R, and then the PCR product was purified and recovered.

[0193] 1.2.5 Construction of the pRE112-ΔkdpE knockout plasmid

[0194] (1) Extraction of the pRE112 plasmid

[0195] Escherichia coli WM3064 containing the pRE112 plasmid was taken out from the -80 °C refrigerator, activated and cultured in LB liquid medium containing chloramphenicol (50 μg / mL), and then the plasmid was extracted using the plasmid DNA mini extraction kit from Novoprotein.

[0196] (2) Double digestion of the fused fragment and the pRE112 plasmid

[0197] The purified and recovered fused fragment and the pRE112 plasmid were double digested using the restriction endonucleases FastDiges XbaⅠ and FastDigest SacⅠ respectively. The fused fragment and the plasmid were respectively mixed with the restriction endonucleases, incubated in a 37 °C constant temperature water bath for 2 hours, then inactivated in a 65 °C water bath for 10 minutes, and stored on ice. Gel electrophoresis was used to judge the degree of digestion, and the target products with bands consistent with the expected results were selected and the target products were recovered and purified by cutting the gel.

[0198] (3) Ligation reaction

[0199] The upstream and downstream fused fragments and the pRE112 plasmid that had been recovered and purified after double digestion were ligated using T4 ligase to obtain the recombinant plasmid pRE112-ΔkdpE.

[0200] 1.2.6 Transformation of the pRE112-ΔkdpE recombinant plasmid

[0201] ① Take 5 μL of the ligation solution and add it to an EP tube containing 100 μL of Escherichia coli WM3064 competent cells (which have been ice-bathed on ice for 5 minutes), gently shake and mix, and then place it on ice that has been prepared in advance for 30 minutes.

[0202] ② Transfer the ice-bathed mixture to a preheated 42 °C constant temperature water bath, and use the heat shock method. After 50 - 60 seconds, immediately place it on ice for 2 - 3 minutes.

[0203] ③ Add 900 μL of LB liquid medium (containing 50 μg / mL of diaminopimelic acid) to the mixed solution, and take it out after incubating in a 37°C constant temperature shaker for 1.5 hours.

[0204] ④ Centrifuge the cultured bacterial solution at 6000 rpm for 6 minutes. After discarding 900 μL of the supernatant by aseptic operation, mix the bacterial cell pellet and the remaining supernatant and spread them on an LB solid plate containing 50 μg / mL of diaminopimelic acid and 50 μg / mL of chloramphenicol, and culture at 37°C for 12 hours.

[0205] 1.2.7 Verification of pRE112-ΔkdpE recombinant plasmid

[0206] (1) Colony PCR identification: Pick single colonies on the medium and streak them on an LB solid medium containing 50 μg / mL of diaminopimelic acid and 50 μg / mL of chloramphenicol to preserve the strains. Then dissolve part of the bacterial cells in 3 μL of sterilized deionized water, heat in a microwave oven for 5 - 8 minutes, and after cooling, add the amplification primers kdpE up-F / kdpE down-R for the fusion fragment to perform colony PCR on the colonies to verify that the grown colonies are positive clones containing the pRE112-ΔkdpE recombinant plasmid.

[0207] (2) Double digestion identification: Extract the plasmid of the strain with the correct band obtained by colony PCR, perform double digestion identification. After the identified band sizes are consistent by gel electrophoresis, purify and recover the band, and send it to a sequencing company for sequencing.

[0208] 1.2.8 Construction of ΔphoBRΔkdpE deletion strain

[0209] (1) Conjugation transfer

[0210] ① Activate the Aeromonas dhakensis ΔphoBR deletion strain stored in an -80°C refrigerator and Escherichia coli WM3064 containing the pRE112-ΔkdpE recombinant plasmid.

[0211] ② After activation, re-inoculate the two strains into a new medium and culture until the OD 600 value is 0.4 - 0.6.

[0212] ③ Take 1.5 mL of the bacterial solution from each of the two strains, centrifuge at 4000 rpm for 10 minutes, and discard the supernatant.

[0213] ④ Add 2 mL of fresh LB liquid medium to the tube and repeat ③.

[0214] ⑤ Take a certain amount of fresh LB liquid medium and add it to an EP tube containing Aeromonas dhakensis ΔphoBR deletion strain cells. Resuspend the cells, aspirate a part of the bacterial solution and add it to an EP tube containing Escherichia coli WM3064, and resuspend the cell pellet at the bottom of the tube. Ensure that the ratio of Aeromonas dhakensis ΔphoBR deletion strain to Escherichia coli WM3064 is 1:3, 1:1, and 3:1 respectively.

[0215] ⑥ Incubate the mixed bacterial solution statically at room temperature for 1 hour, then evenly drip the bacterial solution onto an LB solid medium containing 50 μg / mL 2,6-diaminopimelic acid, and incubate it upright overnight at 37 °C.

[0216] ⑦ Drop 1 mL of LB liquid medium onto the plate with large colonies growing, wash down the bacteria on the plate, dilute it 10 times, and then spread 50 μL on an LB solid petri dish (50 μg / mL chloramphenicol), and incubate it inverted overnight at 37 °C.

[0217] ⑧ Use the primers pRE112-F / R redesigned for the recombinant plasmid as a template to perform colony PCR identification on the grown single colonies. The sizes of the identified bands after gel electrophoresis are the same, then purify, recover and send for sequencing.

[0218] (2) Screening of deletion strains

[0219] ① Take 100 μL of the overnight cultured Aeromonas dhakensis ΔphoBR deletion strain containing the pRE112-kdpE recombinant plasmid and add it to 900 μL of fresh LB liquid medium (diluted tenfold).

[0220] ② Take 100 μL of the diluted bacterial solution and spread it on an LB solid petri dish (containing 20% sucrose), and incubate it inverted at 37 °C for 12 hours.

[0221] ③ Use the primers kdpE up-F / kdpE down-R to perform colony PCR identification. Amplify the correct strains and preserve the bacterial strains well.

[0222] 1.2.9 Construction of Aeromonas dhakensis ΔphoBRΔkdpE + CkdpE

[0223] (1) Amplification of kdpE gene fragment

[0224] Using the DNA of Aeromonas dhakensis wild strain C160501 as a template, amplify the kdpE gene fragment with the primers kdpEDB-F / R and purify and recover it.

[0225] (2) Seamless cloning

[0226] After extracting plasmid pBBR1MCS-2, it was digested with ScaI alone, purified, recovered and preserved. Using the single-digested pBBR1MCS-2 as a template, it was amplified with primers pBBR1MCS-2Δ(lacZα)-F / R. Then, a suitable-sized sequence was selected at each end of the linearized plasmid, and the selected sequence was ligated to both ends of the kdpE gene fragment through redesigned primers kdpEDQ-F / R to obtain a kdpE bridging fragment, so that there was a complementary base pair at both ends of the kdpE gene fragment and the vector. Thus, the kdpE gene fragment was ligated to the vector by seamless cloning method.

[0227] (3) Transformation of pBBR1MCS-2Δ(lacZα)-kdpE complementary plasmid

[0228] The pBBR1MCS-2Δ(lacZα)-kdpE complementary plasmid was transferred into competent cells of Escherichia coli WM3064. Using the grown single colonies as templates, positive clone strains were verified by PCR with primers pBBR-F / R and kdpEDB-F / R respectively.

[0229] (4) Screening of complementary strains

[0230] Conjugative transfer was carried out between Escherichia coli WM3064 containing pBBR1MCS-2Δ(lacZα)-kdpE complementary plasmid and ΔphoBRΔkdpE Aeromonas dhakensis. Using the obtained single colonies as templates, colony PCR verification was carried out with verification primers pBBR-F / R and redesigned verification primers 2kdpE-F / R at both ends of kdpE.

[0231] 1.2.10 Construction of ΔphoBRΔkdpE + pBBR1MCS-2 Aeromonas dhakensis

[0232] For Escherichia coli WM3064 containing pBBR1MCS-2 and ΔkdpEΔphoBR Aeromonas dhakensis, by means of conjugative transfer, ΔphoBRΔkdpE Aeromonas dhakensis containing empty plasmid pBBR1MCS-2 was obtained.

[0233] 1.2.11 Phenotypic analysis of deletion strains

[0234] (1) Genetic stability

[0235] The ΔphoBRΔkdpE deletion strain was inoculated into a 5 mL LB liquid test tube (50 μL / mL ampicillin) and cultured at 37°C for 8 hours. Then, 100 μL was taken out and inoculated into a new LB liquid medium (50 μL / mL ampicillin), and subcultured for 30 generations continuously. Every 10 generations, the outer primers ΔkdpE-F / R of the fusion homologous arm were used for verification. The wild strain C160501 was used as the positive control, and ddH2O was used as the negative control.

[0236] (2) Antimicrobial peptide sensitivity

[0237] Take wild strains, ΔphoBR deletion strains, ΔphoBRΔkdpE deletion strains, ΔphoBRΔkdpE + CkdpE complemented strains, and ΔphoBRΔkdpE + pBBR1MCS-2 deletion strains with an OD 600 value of about 0.5. Dilute the bacterial liquid to 1×10 5 CFU / mL. Use ddH2O to dilute the concentration of the antimicrobial peptide cOT1 (from crocodile) to 50 μg / mL, 100 μg / mL, and 200 μg / mL respectively. Take 100 μL of the bacterial liquid and different concentrations of the antimicrobial peptide and mix them evenly, then add them to a 96-well plate, with three replicates. After incubating at 30°C for 1 hour, dilute the bacterial liquid 1000 times with ddH2O, spread it on an LB solid medium, and perform colony counting after overnight culture at 37°C. The calculation formula for bacterial survival rate = number of colonies in the sample / number of colonies of the untreated strain.

[0238] 1.2.12 Zebrafish virulence test

[0239] (1) Virulence determination

[0240] Take 2 mL of the bacterial liquid of wild strains, ΔphoBR deletion strains, ΔphoBRΔkdpE deletion strains, ΔphoBRΔkdpE + CkdpE complemented strains, and ΔphoBRΔkdpE + pBBR1MCS-2 deletion strains respectively. After centrifugation, resuspend the bacterial cells with PBS solution and dilute to 1×10 8 CFU / mL. For each experimental group, there are 50 zebrafish. Inject 10 μL of the bacterial liquid into each fish, and the control group is 10 μL of PBS solution.

[0241] (2) Determination of the median lethal dose (LD 50 )

[0242] When the wild strain, ΔphoBR deletion strain, ΔphoBRΔkdpE deletion strain, ΔphoBRΔkdpE+CkdpE complemented strain, and ΔphoBRΔkdpE+pBBR1MCS-2 deletion strain were cultured to the mid-logarithmic phase, they were washed 3 times with PBS solution and diluted at gradient concentrations. A total of 208 zebrafish were selected for the experiment, with 8 fish in each group randomly. 10 μL of bacterial solution was injected into the abdomen, and the control group was 10 μL of PBS solution. The number of deaths in each group within 96 hours was recorded until no more deaths occurred. The median lethal dose of the wild strain and each deletion strain was calculated using the Bliss method (Finney, 1985).

[0243] 1.2.13 Zebrafish immune efficacy test

[0244] ① Centrifuge to collect the bacterial cells of the ΔphoBR deletion strain, ΔphoBRΔkdpE deletion strain, ΔphoBRΔkdpE+CkdpE complemented strain, and ΔphoBRΔkdpE+pBBR1MCS-2 deletion strain. After washing with PBS solution, dilute to 1×10 7 CFU / mL. There were 50 zebrafish in each group, 5 experimental groups and 1 control group. The experimental groups were 10 μL of bacterial solution, and the control group was 10 μL of PBS solution.

[0245] ② On the 15th day after immunization, 30 zebrafish were selected from each group, and 10 μL of 1.09×10 8 CFU / mL of the wild strain C160501 was injected into their abdomen. The number of deaths of zebrafish was recorded until the death situation was stable. Then the immune protection rate of the deletion strain was statistically analyzed. Bacteria were isolated and identified from the dead fish to determine that the death was caused by Aeromonas dhakensis.

[0246] 1.2.14 Data processing

[0247] Statistical analysis was performed using SPSS software to compare the variable differences between each deletion strain and the wild strain. The data were expressed as mean ± standard deviation. A p-value < 0.05 indicated a significant difference between groups.

[0248] 2 Result analysis

[0249] 2.1 Construction of Aeromonas dhakensis ΔphoBRΔkdpE

[0250] 2.1.1 Amplification of upstream and downstream homologous arms of the kdpE gene

[0251] Referring to the wild strain Aeromonas dhakensis C160501, primers kdpE up-F / R and kdpE down-F / R were designed. Using the wild strain C160501 as a template, the upstream and downstream homologous fragments of the kdpE gene were amplified respectively. The sizes of the amplified fragments were 1,023 bp for the upstream and 1,007 bp for the downstream. The amplified PCR products were verified by 1% agarose gel electrophoresis, and the results were correct( Figure 6 ).

[0252] 2.1.2 Fusion and double digestion of the upstream and downstream homologous arms of the kdpE gene

[0253] There was a 15-bp complementary sequence at the 3' end of the upstream fragment and the 5' end of the downstream fragment. An overlap PCR was used to obtain a 2,030-bp fusion fragment. The fusion fragment was double-digested with the restriction enzymes SacⅠ and XbaⅠ, and then the gel was cut and recovered. The results are shown in Figure 7 .

[0254] 2.1.3 Extraction and double digestion of the pRE112 plasmid

[0255] After extracting the pRE112 plasmid, it was double-digested with the same restriction enzymes XbaⅠ and SacⅠ as the fusion fragment, and the digested product was purified and recovered. The results are shown in Figure 8 .

[0256] 2.1.4 Transformation and identification of the pRE112-ΔkdpE recombinant plasmid

[0257] (1) Colony PCR verification

[0258] The upstream and downstream fusion fragments after double digestion and the pRE112 plasmid were ligated with T4 DNA ligase to construct a recombinant plasmid. Then, positive clones were obtained by heat shock transformation. The primers kdpE up-F / kdpE down-R were used for colony PCR identification, and the size was 2,030 bp, as shown in Figure 9 (lane 4).

[0259] (2) Double digestion verification

[0260] For the positive clones verified by colony PCR, after amplification culture, the recombinant plasmid was extracted and double-digested with the restriction enzymes XbaⅠ and SacⅠ for verification. The size of the recombinant plasmid fragment was 7,761 bp, and the sizes of the fragments after double digestion were 5,731 bp and 2,030 bp respectively. The electrophoresis gel verification is shown in Figure 9 .

[0261] 2.1.5 Identification of Aeromonas dhakensis ΔphoBRΔkdpE

[0262] (1) Identification of Aeromonas dhakensis containing the recombinant plasmid

[0263] After conjugative transfer of Δasd Escherichia coli containing the recombinant plasmid pRE112-ΔkdpE and Aeromonas dhakensis ΔphoBR, since the recombinant plasmid has a chloramphenicol resistance marker and Δasd Escherichia coli cannot grow on a medium without 2,6-diaminopimelic acid, the conjugated strains were initially screened in a medium containing chloramphenicol and without 2,6-diaminopimelic acid. Then, colony PCR was performed using the primers pRE112-F / R designed based on the pRE112 plasmid sequence to obtain colonies containing the recombinant plasmid, with a size of 1,076 bp, which was in line with the correct result.

[0264] (2) Identification of Aeromonas dhakensis ΔphoBRΔkdpE

[0265] After amplification of the positive colonies obtained by colony PCR, negative screening was carried out on an LB solid medium (containing 20% sucrose). Colony PCR was performed on the single colonies selected from the sucrose plates using the verification primers ΔkdpE-F / R designed based on the genomic sequences outside the upstream and downstream homologous arms of the kdpE gene. See Figure 10 , the wild strain C160501 amplified a 2,854-bp fragment, and the ΔphoBRΔkdpE deletion strain amplified a 2,173-bp fragment. Then, the verification primers F0 / R0 designed for Aeromonas dhakensis ΔphoBR were used to verify Aeromonas dhakensis ΔphoBRΔkdpE, and the amplified fragment size was 1,315 bp, while the fragment size using the wild strain as the template was 3,270 bp. This was in line with the expected results, and the construction of Aeromonas dhakensis ΔphoBRΔkdpE was completed.

[0266] 2.2 Construction of Aeromonas dhakensis ΔphoBRΔkdpE + CkdpE

[0267] 2.2.1 Construction of the complementation plasmid

[0268] Using the wild strain C160501 of Aeromonas dhakensis as a template, a 684-bp kdpE gene fragment was obtained with the primers kdpEDB-F / R. After linearizing the pBBR1MCS-2 plasmid using the primers pBBR1MCS-2Δ(lacZα)-F / R, a pBBR1MCS-2 fragment lacking lacZα with a size of 4,782 bp was obtained. A 15-bp sequence was selected at each end of the linearized plasmid, and the selected 15-bp sequence was ligated to both ends of the kdpE gene fragment using the primers kdpEDQ-F / R to obtain a kdpE bridging fragment with a size of 714 bp, such that there was a complementary base pair at both ends of the kdpE gene fragment and the vector. The results are shown in Figure 11 .

[0269] 2.2.2 Construction of the complementation strain

[0270] (1) Construction of Complementary Plasmid

[0271] The kdpE bridging fragment and the pBBR1MCS-2-Δ(lacZα) fragment were recombined by a seamless cloning kit, and then the recombinant product was transformed into competent Escherichia coli WM3064 cells by heat shock. Positive clone strains were verified by colony PCR using primers pBBR1-F / R and kdpEDB-F / R respectively. The results are shown in Figure 12 , with sizes of 1,286 bp and 684 bp respectively, ensuring successful recombination and entry of the recombinant product into competent cells, and the results were as expected.

[0272] (2) Construction of Complementary Strains

[0273] A conjugation transfer experiment was carried out on Escherichia coli WM3064 with pBBR1MCS-2Δ(lacZα)-kdpE complementary plasmid and Aeromonas dhakensis ΔphoBRΔkdpE. Colony PCR verification was performed using verification primers pBBR-F / R and the newly designed verification primers 2kdpE-F / R at both ends of kdpE, as shown in Figure 13 , with sizes of 1,286 bp and 2,173 bp respectively. The complementary strain Aeromonas dhakensis ΔphoBRΔkdpE+CkdpE was obtained.

[0274] 2.3 Construction of Aeromonas dhakensis ΔphoBRΔkdpE+pBBR1MCS-2

[0275] Escherichia coli WM3064 with pBBR1MCS-2 and Aeromonas dhakensis ΔkdpEΔphoBR were subjected to conjugation transfer, and screening was carried out using verification primer pBBR-F / R, as shown in Figure 14 , with a size of 969 bp. Aeromonas dhakensis ΔphoBRΔkdpE containing the pBBR1MCS-2 empty plasmid was obtained.

[0276] 2.4 Phenotypic Analysis of Deletion Strains

[0277] 2.4.1 Genetic Stability

[0278] After continuous blind passage of Aeromonas dhakensis ΔphoBRΔkdpE for 30 generations, the genetic stability of the deletion strain was detected using the outer primers ΔkdpE-F / R of the homologous arm. Figure 15 It can be seen that specific bands of 2173 bp can be amplified from all 8 randomly selected strains (lanes 1-8), which is consistent with the results of the primary deletion strain (lane 9). No bands were seen in the negative control without adding template (lane 11). This proves that the deletion strain can be stably inherited.

[0279] 2.4.2 Antimicrobial Peptide Sensitivity

[0280] The initial colony concentrations of the wild strain, ΔphoBR deletion strain, ΔphoBRΔkdpE deletion strain, ΔphoBR+CkdpE complemented strain, and ΔphoBRΔkdpE+pBBR1MCS-2 deletion strain were counted by the colony counting method, and the original colony concentrations were 2.73×10 5 CFU / mL, 4.22×10 5 CFU / mL, 4.57×10 5 CFU / mL, 3.42×10 5 CFU / mL, and 4.03×10 5 CFU / mL, respectively. The wild strain, ΔphoBR deletion strain, ΔphoBRΔkdpE deletion strain, ΔphoBR+CkdpE complemented strain, and ΔphoBRΔkdpE+pBBR1MCS-2 deletion strain were incubated with different concentrations of the crocodile-derived antimicrobial peptide cOT1, and the bacterial survival rate was calculated after colony counting (Table 3). The results ( Figure 16 ) showed that the bacterial survival rate of each group decreased with the increase in the concentration of the antimicrobial peptide. When incubated with a high concentration (final concentration 100 μg / mL) of cOT1, the survival rate of the wild strain was 11.93%, and the survival rates of the ΔphoBRΔkdpE deletion strain and the ΔphoBRΔkdpE+pBBR1MCS-2 deletion strain were only 0.01%, almost unable to survive. When the concentration of cOT1 was 25 μg / mL, the survival rates of the ΔphoBRΔkdpE deletion strain and the ΔphoBRΔkdpE+pBBR1MCS-2 deletion strain were 19.63% and 20.53%, respectively, which were significantly lower than those of the wild strain C160501 and the ΔphoBR deletion strain. It indicated that the deletion of the kdpE gene would significantly increase the sensitivity of Aeromonas dhakensis to the antimicrobial peptide.

[0281] Table 3 Bacterial survival rate (%)

[0282]

[0283] 2.5 Zebrafish virulence test

[0284] 2.5.1 Determination of virulence

[0285] To judge the virulence of the ΔphoBRΔkdpE deletion strain, 250 zebrafish were selected and randomly divided into five experimental groups. After injecting 10 μL of the bacterial solution into each zebrafish, the zebrafish with abdominal bleeding were recorded (such as Figure 17) The cumulative number of deaths. The results (Table 4) showed that the mortality rate of the wild strain was 60%, the mortality rate of the ΔphoBR deletion strain was 40%, while the cumulative mortality rate of the ΔphoBRΔkdpE deletion strain was 27%. The virulence of the ΔphoBRΔkdpE deletion strain was further attenuated, indicating that the deletion of the kdpE gene in Aeromonas dhakensis would affect other genes related to virulence expression.

[0286] Table 4 Virulence test

[0287]

[0288] 2.5.2 Median lethal dose (LD 50 ) determination

[0289] To further understand the change in the virulence of Aeromonas dhakensis after the deletion of the kdpE gene, we conducted an experiment on the median lethal dose using zebrafish. The experiment was divided into 25 experimental groups and one control group, with 8 fish in each group. The experimental results (Table 5) showed that the LD 50 value of the ΔphoBRΔkdpE deletion strain was 7.85×10 8 CFU / mL. Compared with the wild strain, the virulence decreased by 25.65 times, and compared with the ΔphoBR deletion strain, the virulence decreased by 3.33 times. This indicates that the deletion of the kdpE gene would change the virulence of Aeromonas dhakensis, and the expression of virulence-related factors of this bacterium may be regulated by the two-component signal transduction system KdpDE.

[0290] Table 5 Median lethal dose determination

[0291]

[0292] 2.6 Zebrafish immune efficacy test

[0293] 1×10 7 CFU / mL of the ΔphoBR deletion strain, ΔphoBRΔkdpE deletion strain, ΔphoBR+CkdpE complemented strain, and ΔphoBRΔkdpE deletion strain with empty plasmid pBBR1MCS-2 were respectively injected with 10 μL into zebrafish (the control group was injected with PBS solution). Then, on the 15th day after immunization, 10 μL of the wild strain C160501 bacterial solution with a concentration of 1.09×10 8 was used for challenge. Then, the number of dead zebrafish was recorded every day until no more deaths occurred. It can be seen (Table 6) that the mortality rate of the control group was 100%, the relative protection rate of the ΔphoBR deletion strain was 50%, and that of the ΔphoBRΔkdpE deletion strain was 43.3%. There was no significant difference in the relative protection rates between the two. This indicates that the immune protection effect of the ΔphoBRΔkdpE deletion strain was no different from that of the ΔphoBR deletion strain.

[0294] Table 6 Immunoprotection experiment

[0295]

Claims

1. Aeromonas dhakensis isolated from crocodiles ( A. dhakensis ) phoBR and kdpE gene deletion strain or its complementary strain, characterized in that, Aeromonas dhakaensis phoBR and kdpE The gene deletion strain is based on the wild-type Aeromonas dakar strain and lacks phoBR and kdpE The gene was obtained and named Δ pho BRΔ kdp E; The complement strain is the crocodile-derived Aeromonas dakar phoBR and kdpE Gene deletion strains based on complementation expression kdpE The gene was obtained and named Δ pho BRΔ kdp E+C kdp E, the wild strain of Aeromonas dakarensis is A. dhakensis C160501.

2. The Aeromonas dhakensis sourced from crocodile as described in claim 1 phoBR and kdpE the gene deletion strain or its complementary strain, characterized in that The described backfill strain is constitutively expressed kdp E 。 3. A method for constructing a gene deletion strain or its complementary strain of Aeromonas dhakensis sourced from crocodiles as described in claim 1 or 2, characterized in that, phoBR and kdpE the method comprises the steps of comprises the following steps: (1) Design primers and send them to a company for synthesis. The primer sequences are as follows: ； (2) Extract the genome of the wild strain of Aeromonas dhakensis Culture the wild strain of Aeromonas dhakensis that has been activated and identified at 37 °C, and select a bacterial DNA extraction kit to extract the bacterial DNA genome; (3) PCR amplification and purification recovery of the target fragment 1) kdp Amplification of homologous arms upstream and downstream of the E gene Using the wild strain of Aeromonas dhakensis as a template, primers were used: kdp E up-F / R and kdp E down-F / R were used to amplify the kdp upstream and downstream homologous fragments of the E gene, respectively; (2) Purification and recovery of the PCR amplification fragment After PCR is completed, use 1% agarose gel electrophoresis for inspection. If the size of the obtained result band is the same as that of the target band, cut off the gel block with the target band, and then use a gel recovery / DNA purification kit for purification and recovery; (4) kdp Fusion of homologous arms upstream and downstream of the E gene According to the principle of complementary base pairing, overlap PCR was used to kdp overlap and splice the upstream and downstream homologous fragments of gene E, and then primers kdp E up-F / kdp E down-R were used to amplify the fused fragment, and then the PCR product was purified and recovered; (5)pRE112-Δ kdp Construction of E knockout plasmid (1) Extract the pRE112 plasmid Take out Escherichia coli WM3064 containing the pRE112 plasmid from the -80 °C refrigerator. After activation and culture in an LB liquid medium containing 50 μg / mL chloramphenicol, use a plasmid DNA mini extraction kit from Novoprotein to extract the plasmid; (2) Double digestion of the fusion fragment and the pRE112 plasmid Use the restriction endonucleases FastDiges Xba Ⅰ and FastDigest Sac Ⅰ to perform double digestion on the purified and recovered fusion fragment and the pRE112 plasmid respectively, and cut and recover and purify the target products by gel electrophoresis respectively; (3) Ligation reaction The upstream and downstream fusion fragments and the pRE112 plasmid that had been recovered and purified after double digestion were ligated with T4 ligase to obtain the recombinant plasmid pRE112-Δ kdp E; (6) Transformation of the pRE112-ΔkdpE recombinant plasmid Take the ligation solution and add it to an EP tube containing Escherichia coli WM3064 competent cells, and transform the pRE112-ΔkdpE recombinant plasmid into Escherichia coli WM3064 competent cells; (7) pRE112-Δ kdp Verification of E recombinant plasmid 1) Use amplification primers for the fusion fragment kdp E up-F / kdp E down-R to perform colony PCR on the colonies to verify that the grown colonies are positive clones containing the pRE112-Δ kdp E recombinant plasmid; (2) Double digestion identification: Extract the plasmid of the strain with the correct band obtained by colony PCR, perform double digestion identification, and after the identification band sizes are the same by gel electrophoresis, purify and recover the band and send it to a sequencing company for sequencing; (8) Δ pho BRΔ kdp Construction of E deletion strain (1) Conjugal transfer Activate Aeromonas dhakensis Δ pho phoBR deletion strain stored in an -80 °C refrigerator and Escherichia coli WM3064 containing the pRE112-Δ kdp E recombinant plasmid. Co-culture the obtained Escherichia coli WM3064 containing the recombinant plasmid pRE112-Δ kdp E with the Aeromonas dhakensis ΔphoBR deletion strain. During this period, conjugative transfer occurs, transferring the recombinant plasmid from the Escherichia coli cells into the Aeromonas dhakensis ΔphoBR deletion strain; Use the primers pRE112-F / R redesigned with the recombinant plasmid as the template to perform colony PCR identification on the grown single colonies. After the identification band sizes are the same by gel electrophoresis, purify, recover and send for sequencing; (2) Screen for deletion strains Take 100 μL of Aeromonas dhakensis Δ dp BR deletion strain containing the pRE112-k pho E recombinant plasmid that has been cultured overnight, and add 900 μL of fresh LB liquid medium; take 100 μL of the diluted bacterial solution and spread it on an LB solid plate containing 20% sucrose, and culture it inverted at 37 °C for 12 hours; use the primers kdp E up-F / kdp E down-R for colony PCR identification, amplify the correct strains, and properly preserve the bacterial strains; (9)Complemented strain of Aeromonas dhakensis Δ pho BRΔ kdp E+C kdp Construction of E 1) kdp Amplification of E gene fragment Using the DNA of Aeromonas dhakensis wild strain C160501 as a template, primers kdp EDB-F / R were used for amplification kdp of the E gene fragment, which was then purified and recovered; (2) Seamless cloning After extracting plasmid pBBR1MCS-2, it was digested with ScaI alone, purified, recovered and stored. Using the digested pBBR1 MCS-2 as a template, it was amplified with primers pBBR1MCS-2Δ( lac Zα)-F / R. Then, a suitable-sized sequence was selected at each end of the linearized plasmid, and the selected sequence was ligated to both ends of the kdp E gene fragment with the redesigned primers kdp EDQ-F / R to obtain the kdp E bridging fragment, such that kdp there was a complementary base pair between both ends of the E gene fragment and the vector, and thus, the kdp E gene fragment was ligated to the vector by seamless cloning; 3) pBBR1MCS-2Δ( lac Zα)- kdp Transformation of the E-complemented plasmid Transfer the pBBR1MCS-2Δ ( lac Zα)- kdp E complementation plasmid into competent cells of Escherichia coli WM3064. Using the grown single colonies as templates, verify the positive clone strains by PCR with primers pBBR-F / R and kdp EDB-F / R respectively; (4) Screening for complemented strains By the presence of pBBR1MCS-2Δ( lac Zα)- kdp E complementation plasmid in Escherichia coli WM3064 and Δ pho BRΔ kdp E Aeromonas dhakensis for conjugation transfer, using the obtained single colony as a template, and using the verification primers pBBR-F / R and the verification primers 2 kdp E redesigned at both ends kdp E-F / R for colony PCR verification to obtain the complemented strain ΔphoBRΔkdpE+CkdpE.

4. The Aeromonas dhakensis sourced from crocodile according to claim 1 or 2 phoBR and kdpE The use of the gene deletion strain or its complementary strain in the preparation of a medicament for treating or preventing diseases caused by Aeromonas dhakensis infection.

5. The application according to claim 4, characterized in that The drug described above is a vaccine.

Images