A method for identifying circadian expression of genes in klebsiella pneumoniae using a bioluminescent reporter system

Abstract

The application discloses a method for identifying Klebsiella pneumoniae gene circadian rhythm expression by using a bioluminescence reporting system. The application constructs a recombinant bioluminescence Klebsiella pneumoniae driven by a metabolic gene malate:quinone oxidoreductase mqo promoter (Pmqo), and directly observes the change rule of bacterial gene expression under entrainment and free-running conditions of temperature cycle by monitoring the luminescence characteristics. The luxCDABE gene operon comprises genes for coding luciferase and substrate synthesis enzyme, wherein luxA and luxB code for heterodimer luciferase, luxC, luxD and luxE synthesize aldehyde as a substrate for the luciferase luminescence reaction. The luciferase catalyzes the oxidation of aldehyde to generate visible blue-green light with a wavelength of 450-490 nm. The Lux bioluminescence reporting system has the advantages of not needing to add an exogenous substrate and not affecting the normal physiological functions of the host, and can be applied to the identification of Klebsiella pneumoniae gene circadian rhythm expression.

Description

Technical Field

[0001] This invention relates to a method for identifying the diurnal rhythm expression of genes in Klebsiella pneumoniae using a bioluminescent reporter system. This invention belongs to the field of biotechnology. Background Technology

[0002] Klebsiella pneumoniae (K. pneumoniae) belongs to the genus Klebsiella of the family Enterobacteriaceae and is a Gram-negative bacterium. It exists in nature and in healthy humans. When the body's immunity is weakened, it can cause various inflammations, such as pneumonia, meningitis, urinary tract infections, and even invasive infections such as blood infections and liver abscesses.

[0003] Circadian rhythm refers to the variation of life activities in a cycle of approximately 24 hours. From primitive cyanobacteria to mammals, circadian rhythms exist in all living organisms, and the circadian regulation of physiological behaviors is crucial for maintaining normal life. Disruption of the circadian rhythm leads to metabolic system disorders, affects life activities, and causes disease. Recent studies have shown that circadian rhythms also exist in the non-photosynthetic bacterium *Bacillus subtilis*, where bacterial biofilm formation and related gene expression follow daily cycles to adapt to changes in the external environment. Furthermore, research on the pathogenic microorganism *Klebsiella aerogenes* has found that temperature changes can act as a zeitgeber; that is, the cycle of high and low temperatures can act as an entrainment condition for the circadian rhythm. By simulating the diurnal difference in host body temperature, the swarming ability of *Klebsiella aerogenes* is synchronized with the entrainment condition, and a certain periodic fluctuation is maintained even during the free movement phase. However, understanding how Klebsiella pneumoniae senses time and adjusts its molecular expression to match the time of day through internal physiological metabolism allows for more precise clinical drug administration, providing valuable information for the fields of biomedicine, bio-agriculture, and industrial biotechnology. Summary of the Invention

[0004] One of the objectives of this invention is to provide a recombinant bioluminescent Klebsiella pneumoniae;

[0005] The second objective of this invention is to provide a method for identifying the diurnal rhythm expression of Klebsiella pneumoniae genes using a bioluminescent reporter system.

[0006] To achieve the above objectives, the present invention employs the following technical means:

[0007] The present invention discloses a recombinant bioluminescent Klebsiella pneumoniae, wherein the recombinant bioluminescent Klebsiella pneumoniae is a Klebsiella pneumoniae containing a recombinant plasmid that drives the expression of the luxCDABE gene by the mqo promoter (Pmqo).

[0008] Preferably, the sequence of the mqo promoter is shown in SEQ ID NO.1.

[0009] Preferably, the recombinant plasmid is pBBR1MCS4-Pmqo-luxCDABE, which is a recombinant plasmid driven by the mqo promoter (Pmqo) to express the luxCDABE gene.

[0010] Preferably, the recombinant plasmid pBBR1MCS4-Pmqo-luxCDABE is constructed using the following method:

[0011] Genomic DNA was extracted from the standard strain ATCC13883 of Klebsiella pneumoniae. The promoter sequence Pmqo of the mqo gene with restriction sites added at both ends was amplified by PCR. The PCR product was detected by agarose gel electrophoresis and then purified. After digestion with Spe I, the pBBR1MCS4-luxCDABE plasmid was ligated with the Pmqo target fragment using a seamless cloning assay. The ligation product, pBBR1MCS4-Pmqo-luxCDABE, was transformed into E. coli DH5α competent cells and screened on LB agar plates containing 50 μg / mL kanamycin to obtain single colonies of E. coli DH5α containing the pBBR1MCS4-Pmqo-luxCDABE recombinant plasmid. These colonies were identified by PCR electrophoresis and sequencing. The pBBR1MCS4-Pmqo-luxCDABE recombinant plasmid was extracted and electrotransformed into Klebsiella pneumoniae ATCC13883 competent cells. These cells were then screened on LB agar plates containing 50 μg / mL kanamycin to obtain single colonies of Klebsiella pneumoniae ATCC13883 containing the pBBR1MCS4-Pmqo-luxCDABE recombinant plasmid.

[0012] The preferred primers used for PCR amplification are as follows:

[0013] Pmqo-F:gaggaaaaaaaaatgactagtTCCCTTTCTCTGCCAGGTGC

[0014] Pmqo-R:aatttttttagtcatactagtTGCAGGCATAATAGAATTATCACGTAGCAC.

[0015] Furthermore, this invention also proposes the application of the recombinant bioluminescent Klebsiella pneumoniae in identifying the diurnal rhythm expression of Klebsiella pneumoniae genes using a bioluminescent reporter system.

[0016] Furthermore, this invention also proposes a method for identifying the diurnal rhythm expression of Klebsiella pneumoniae genes using a bioluminescent reporter system, comprising the following steps:

[0017] The recombinant bioluminescent Klebsiella pneumoniae, which had not been exposed to the entrainment conditions, was diluted 1:100 and cultured overnight in LB broth to resuscitate the strain. The strain was then exposed to a constant cyclic temperature condition (T = 24 h, Δt = 3 °C) for three days, followed by release to a constant 34 °C for three days of further cyclic culture. The specific cyclic culture conditions are as follows:

[0018]

[0019] Between 60 and 96 hours of culture of recombinant bioluminescent Klebsiella pneumoniae, 1 mL of bacterial culture was collected every 4 hours. The rhythmicity of bioluminescence intensity was detected and a curve was plotted using a small animal imaging instrument. The rhythmic period and amplitude were then analyzed by mathematical model fitting.

[0020] The mFourfit function model was used to analyze the free-running period of the recombinant bioluminescent Klebsiella pneumoniae using continuous photometric measurements. The mFourfit model function was then used for calculation. The function model is as follows: Where A i For cosine amplitude, Let τ be the phase and τ / i be the period.

[0021] Compared with the prior art, the beneficial effects of the present invention are:

[0022] This experiment constructed a recombinant bioluminescent Klebsiella pneumoniae strain driven by the metabolic gene mqo. By monitoring its luminescence properties, the changes in bacterial gene expression under entrainment conditions were observed directly. The luxCDABE gene operon contains genes encoding luciferase and substrate synthase. luxA and luxB encode heterodimeric luciferase, while luxC, luxD, and luxE synthesize aliphatic aldehydes, serving as substrates for the luciferase luminescence reaction. Luciferase catalyzes the oxidation of aliphatic aldehydes, producing visible blue-green light with wavelengths of 450–490 nm. The Lux bioluminescent reporter system has the advantages of not requiring the addition of exogenous substrates and not affecting the normal physiological functions of the host, making it suitable for identifying the diurnal rhythm expression of Klebsiella pneumoniae genes. Attached Figure Description

[0023] Figure 1 The identification results of the pBBR1MCS4-Pmqo-luxCDABE recombinant plasmid;

[0024] M is a 100bp DNA Ladder;

[0025] Figure 2 To collect the bioluminescence of bioluminescent bacteria Kp-lux using a multi-functional small animal in vivo imaging system and measure its luminescence intensity;

[0026] Figure 3 qPCR and small animal imaging were used to monitor the rhythmic changes in luminescence intensity of recombinant bioluminescent Klebsiella pneumoniae under Kp-lux temperature entrainment and free movement conditions;

[0027] Figure 4 For the CFU colony count and OD of recombinant bioluminescent Klebsiella pneumoniae under Kp-lux temperature entrainment and free-running conditions. 600 Value detection;

[0028] Figure 5 The period of the cosine curve fitted to the average bioluminescence brightness of Kp-lux under entrainment and free-running conditions is given. Detailed Implementation

[0029] The present invention will be further illustrated below through embodiments, the purpose of which is only to better understand the research content of the present invention and not to limit the scope of protection of the present invention.

[0030] Example 1: Preparation of recombinant bioluminescent Klebsiella pneumoniae (Pmqo::Kp-lux, hereinafter referred to as Kp-lux)

[0031] 1. Extraction of genomic DNA from the Klebsiella pneumoniae quality control strain ATCC13883 (abbreviated Kp13883):

[0032] Bacterial cells were lysed using Buffer GL, Proteinase K, RNase A, Buffer GB, and anhydrous ethanol. Genomic DNA was collected through a collection column, the collection column was washed with Buffer WA and Buffer WB, and finally the genomic DNA was dissolved using ddH2O.

[0033] 2. By combining transcriptome sequencing and promoter sequence prediction analysis, and verifying and screening in the NCBI database, the promoter (Pmqo) sequence of the mqo gene was determined, and its sequence is shown in SEQ ID NO.1;

[0034] 3. Design PCR primers for Pmqo with Spe I restriction sites flanking the promoter sequence of the mqo gene using the primer-blast function in NCBI (lowercase letters represent restriction sites and protective bases):

[0035] Pmqo-F:gaggaaaaaaaaaatg actagt TCCCTTCTCTGCCAGGTGC

[0036] Pmqo-R: aatttttttagtcat actagt TGCAGGCATAATAGAATTATCACGTAGCAC

[0037] 4. Using the extracted Klebsiella pneumoniae quality control strain ATCC13883 genomic DNA as a template, the mqo gene promoter sequence Pmqo with restriction sites added at both ends was amplified by PCR. The PCR product was detected by agarose gel electrophoresis and then recovered and purified.

[0038] PCR reaction system: Pmqo-F 2μl, Pmqo-R 2μl, dNTP Mix 1μl, 2×PhantaMax Buffer 25μl, Kp13883 genomic DNA 5μl, DNA Polymerase 1μl, dH2O 14μl;

[0039] Reaction program: 95℃ for 3 min, (95℃ for 15 s, 58℃ for 15 s, 72℃ for 50 s, for a total of 35 cycles), 72℃ for 5 min.

[0040] 5. After digestion with Spe I, the pBBR1MCS4-luxCDABE plasmid was ligated to the Pmqo target fragment via In-Fusion seamless cloning.

[0041] The single-enzyme digestion system for pBBR1MCS4-luxCDABE plasmid was as follows: Spe I 2.5 μl, 10×M buffer 5 μl, pBBR1MCS4-luxCDABE 2.5 μl, dH2O 40 μl; digestion conditions: 37℃ for 1 hour.

[0042] Seamless cloning ligation system for pBBR1MCS4-luxCDABE and Pmqo: Cloning reaction (Insert 1.5 μl (Pmqo), Linearized vector 4 (pBBR1MCS4-luxCDABE-cr) μl, 5×In-Fusion Snap Assembly Master Mix 2 μl, dH2O 2.5 μl); Negative control (Linearized vector 1 (pBBR1MCS4-luxCDABE-cr) μl, 5×In-Fusion Snap Assembly Master Mix 2 μl, dH2O 7 μl); Control (Insert 2 (control) μl, Linearized vector 1 (pUC19) μl, 5×In-Fusion Snap Assembly Master Mix 2 μl, dH2O 5 μl); Ligation conditions: Incubate at 50℃ for 15 min and then place on ice.

[0043] 6. The ligation product pBBR1MCS4-Pmqo-luxCDABE was transformed into Escherichia coli DH5α competent cells; single colonies of E. coli DH5α obtained by screening on LB agar plates containing 50 μg / mL kanamycin were obtained, and identified by PCR electrophoresis and sequencing.

[0044] 7. Extract the recombinant plasmid pBBR1MCS4-Pmqo-luxCDABE, prepare Klebsiella pneumoniae Kp13883 electrotransformation competent cells, and transform the recombinant plasmid pBBR1MCS4-Pmqo-luxCDABE into Klebsiella pneumoniae electrotransformation competent cells by electroporation.

[0045] 8. Single colonies of Klebsiella pneumoniae Kp13883 (Kp-lux) containing the recombinant plasmid pBBR1MCS4-Pmqo-luxCDABE were obtained by screening on LB agar plates containing 50 μg / mL kanamycin. Colony PCR identification was performed, and the results are as follows: Figure 1 As shown.

[0046] Example 2: Bioluminescent Detection of Recombinant Bioluminescent Klebsiella pneumoniae Kp-lux

[0047] method:

[0048] Klebsiella pneumoniae Kp-lux, which had not been exposed to entrainment conditions (temperature cycling), was diluted 1:100 and cultured overnight in LB broth to resuscitate the strain. The bacteria were then exposed to a constant temperature cycle (T = 24 h, Δt = 3 °C) for three days, followed by release to a constant low temperature cycle (t = 34 °C) for three days. Specific cyclic culture conditions are shown in Table 1. Between 60 and 96 h of Kp-lux culture, 1 mL of bacterial suspension was collected every 4 hours. The rhythmicity of bioluminescence intensity was detected using a small animal imaging system, and curves were plotted. Mathematical model fitting analysis was used to determine the rhythmic period and amplitude.

[0049] The mFourfit function model was used to analyze the free-running period of the average bioluminescence intensity of Kp-lux recombinant bioluminescent Klebsiella pneumoniae using continuous photometric measurements. The mFourfit model function was then used for calculation. The function model is as follows: Where A i For cosine amplitude, Let τ be the phase and τ / i be the period.

[0050] Table 1. Conditions for setting the diurnal rhythm expression cycle

[0051]

[0052] result:

[0053] The bioluminescence of the bioluminescent bacteria Kp-lux was collected using a multi-functional small animal in vivo imaging system, and its luminescence intensity was measured. The luminescence intensity of 1 mL of overnight cultured Kp-lux in a 1.5 mL Eppendorf tube is shown in the figure below. Figure 2 As shown, its average bioluminescence brightness is 391.52 CPS (countper second).

[0054] Figure 3 qPCR and small animal imaging average bioluminescence monitoring of the rhythmic changes in luminescence intensity of recombinant bioluminescent Klebsiella pneumoniae under Kp-lux temperature entrainment and free movement conditions;

[0055] Figure 4 For the CFU colony count and OD of recombinant bioluminescent Klebsiella pneumoniae under Kp-lux temperature entrainment and free-running conditions. 600 Value detection;

[0056] Figure 5The period of the fitted cosine curve of the average bioluminescence brightness of Kp-lux under entrainment and free-running conditions is given. The rhythm period is 10.14 h, slightly less than the expected 12 h. This is presumably because after 12 h of entrainment, the monitoring data is limited, with only 7 monitoring points, and the entrainment effect is not fully utilized. The rhythmicity test was performed using BD2EJTK, with a p-value of 0.00246, indicating that the fitted curve has rhythmicity.

Claims

1. A recombinant bioluminescent Klebsiella pneumoniae ( Klebsiella pneumoniae ), characterized in that, The recombinant bioluminescent Klebsiella pneumoniae contains mqo promoter P mqo drive luxCDABE Klebsiella pneumoniae with recombinant plasmids expressing genes, as described mqo The sequence of the promoter is shown in SEQ ID NO.

1.

2. The recombinant bioluminescent Klebsiella pneumoniae as described in claim 1, characterized in that, The recombinant plasmid is mqo promoter P mqo drive luxCDABE Recombinant plasmid pBBR1MCS4-P for gene expression mqo - luxCDABE.

3. The recombinant bioluminescent Klebsiella pneumoniae as described in claim 1, characterized in that, The recombinant plasmid pBBR1MCS4-P mqo - luxCDABE It was constructed using the following method: Genomic DNA was extracted from the Klebsiella pneumoniae standard strain ATCC13883, and PCR amplification was performed using strains with restriction enzyme sites added at both ends. mqo Gene promoter sequence P mqo PCR products were detected by agarose gel electrophoresis and then purified; pBBR1MCS4- luxCDABE plasmids Spe After single enzyme digestion with I, pBBR1MCS4- was cloned using a seamless cloning assay. luxCDABE plasmids and P mqo Target fragment ligation, ligation product pBBR1MCS4-P mqo - luxCDABE Transformed into *E. coli* DH5α competent cells, pBBR1MCS4-P was screened by plating on LB agar plates containing 50 μg / mL kanamycin to obtain pBBR1MCS4-P. mqo - luxCDABE Single colonies of *E. coli* DH5α containing the recombinant plasmid were identified by PCR electrophoresis and sequencing; pBBR1MCS4-P was extracted. mqo - luxCDABE The recombinant plasmid was electrotransformed into Klebsiella pneumoniae ATCC13883 competent cells, and selected on LB agar plates containing 50 μg / mL kanamycin to obtain cells containing pBBR1MCS4-P. mqo - luxCDABE Single colony of Klebsiella pneumoniae ATCC13883 with recombinant plasmid.

4. The recombinant bioluminescent Klebsiella pneumoniae as described in claim 3, characterized in that, The primers used for PCR amplification are as follows: Pmqo-F:gaggaaaaaaaaatgactagtTCCCTTTCTCTGCCAGGTGC Pmqo-R:aatttttttagtcatactagtTGCAGGCATAATAGAATTATCACGTAG CAC.

5. The application of the recombinant bioluminescent Klebsiella pneumoniae according to any one of claims 1-4 in identifying the diurnal rhythm expression of Klebsiella pneumoniae genes using a bioluminescent reporter system.

6. A method for identifying the diurnal rhythm expression of Klebsiella pneumoniae genes using a bioluminescent reporter system, characterized in that, Includes the following steps: The recombinant bioluminescent Klebsiella pneumoniae according to any one of claims 1-4, without exposure to entrainment conditions, was diluted 1:100 and cultured overnight in LB broth to resuscitate the strain; it was then exposed to a constant-cycle temperature condition, i.e., T = 24 h. Δt The bacteria were cultured at 3℃ for three days, then released to a constant low-temperature condition of 34℃ for three more days, with the following cyclic culture conditions: Timing factor: temperature; Culture medium: LB, changed every 12 hours; Carrying conditions: 34℃:37℃ 12h:12h Free operation conditions: 34℃ Between 60 and 96 h of culture of recombinant bioluminescent Klebsiella pneumoniae, 1 mL of bacterial culture was collected every 4 hours. The rhythmicity of bioluminescence intensity was detected by a small animal imaging instrument and a curve was plotted. The rhythmic period and amplitude were analyzed by mathematical model fitting. mFourfit function model: The average bioluminescence intensity of recombinant bioluminescent Klebsiella pneumoniae was analyzed using continuous photometric measurements to determine its free-running cycle, and the mFourfit model function was used for analysis. The calculation and function model are as follows: ,in For cosine amplitude, For phase, It is a periodicity.

Images