KASP molecular markers related to nitrogen uptake efficiency in watermelon and development and use thereof

By developing KASP molecular markers related to nitrogen absorption efficiency in watermelons, the problem of low nitrogen fertilizer utilization in watermelons was solved, enabling efficient screening and molecular breeding, and improving nitrogen absorption efficiency in watermelons.

CN117106949BActive Publication Date: 2026-03-27ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-30
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Watermelon has low nitrogen fertilizer utilization rate and lacks effective molecular markers for screening and improving efficient nitrogen absorption materials.

Method used

KASP molecular markers related to nitrogen uptake efficiency in watermelon were developed based on BSA pooled sequencing. Using the SNP marker located at 27873651 bp on chromosome 7 of watermelon, primer combinations were designed for PCR amplification and fluorescence signal analysis to identify genotypes.

Benefits of technology

This study enabled efficient screening and molecular-assisted breeding of nitrogen absorption efficiency in watermelons, significantly improving nitrogen utilization efficiency and advancing the breeding process of high-efficiency nitrogen-utilizing varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117106949B_ABST
    Figure CN117106949B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of molecular marker assisted breeding, and is particularly suitable for rapid screening and molecular marker assisted breeding of watermelon nitrogen absorption efficiency. The present application discloses a KASP molecular marker for identifying different watermelon nitrogen utilization efficiencies based on BSA pool sequencing positioning watermelon nitrogen absorption efficiency related genes, wherein the KASP molecular marker is an SNP marker located at 27873651bp of the 7th chromosome of watermelon, and the present application further provides a primer combination for identifying the KASP molecular marker related to watermelon nitrogen absorption efficiency, i.e. a forward primer F-Fam and a forward primer F-Hex. The method of the present application can be used to select and separate single plants with high nitrogen absorption efficiency in a population for breeding improvement, realize efficient utilization of nitrogen in watermelon plants, and accelerate the molecular breeding process of "green" watermelon varieties.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular marker assisted breeding, and is particularly suitable for rapid screening and molecular marker assisted breeding of watermelon nitrogen absorption efficiency, and provides a novel and simple molecular marker and assisted selection method. BACKGROUND

[0002] Nitrogen is a key mineral nutrient element for plant growth and development (Krapp et al. 2014; Vidal et al. 2014). In the process of agricultural production, (vegetable) crop nitrogen fertilizer is generally overused, and the nitrogen use efficiency is not high, which in turn causes serious water eutrophication and environmental pollution problems (Jiang Zemin et al. 2018). How to improve the nitrogen use efficiency (NUE) of crop and thus increase the yield of crop has become a major problem to be solved in the development of China's agriculture.

[0003] NUE is a complex quantitative trait regulated by multiple genes, involving nitrogen absorption, transport, assimilation, reutilization and other biological processes (Han et al. 2020). Current researches are mostly focused on model plants (crops) such as Arabidopsis and rice (Han et al. 2020; Kiba and Krapp 2016). Through forward genetics, using different trait evaluation indicators, multiple genes that regulate nitrogen absorption have been successfully cloned. A non-synonymous mutation in the coding region of OsNRT1.1B gene can enhance the absorption of nitrate in rice (Hu et al. 2015). The promoter sequence and amino acid sequence of OsNPF6.1 gene are different in indica and japonica rice, resulting in different nitrate absorption capacity (Tang et al. 2019). A negative regulator of auxin accumulation, OsDNR1, can also participate in the regulation of nitrate absorption in rice (Zhang et al. 2021). In addition, the transcription level of OsGRF4 also affects the absorption of ammonium salt in rice and affects plant growth (Li et al. 2018). Many studies have shown that the plant hormone ethylene can regulate plant root architecture and play an important role in the response of plants to changes in soil nutrient levels (Iqbal et al. 2013). ClACS7 promotes taproot growth by inhibiting ethylene synthesis in watermelon roots (Mahmoud et al. 2022); OsEIL1 can interact with gibberellin metabolism genes OsGA2ox1 / 2 / 3 / 5 to inhibit cell proliferation in root apical meristems (Qin et al. 2022); GmETO1 promotes hairy root growth by inhibiting ethylene synthesis (Zhang et al. 2020); and knocking out GmERF1 can improve root growth in soybean (Wang et al. 2023). Currently, there are few studies on the involvement of ethylene in regulating plant nitrogen absorption (Ma et al. 2022).

[0004] Watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai) is an important economic crop in China, with the largest total cultivation area and yield in the world. For a long time, genetic breeding of watermelon in China has focused on functional genes related to disease resistance, yield, and quality traits, while the exploration and functional research of nutrient utilization genes have not been emphasized. Watermelon is different from Arabidopsis and rice, with strong taproots and developed fibrous roots, high economic yield, and high demand for nitrogen fertilizer. However, the problem of high nitrogen fertilizer application and low nitrogen utilization efficiency is prominent, and so far the target genes determining high nitrogen use efficiency in watermelon have not been cloned. Therefore, it is urgent to identify key genes controlling nitrogen use efficiency in watermelon and develop functional molecular markers for nitrogen use efficiency in watermelon, providing a scientific basis for molecular design breeding of nitrogen use efficiency in watermelon.

[0005] The references referred to above are as follows:

[0006] Han X, Wu K, Fu X, Liu Q (2020) Improving coordination of plant growth and nitrogen metabolism for sustainable agriculture. aBIOTECH 1 :255-275.

[0007] Hu B, Wang W, Ou SJ, Tang JY, Li H, Che RH, Zhang ZH, Chai XY, Wang HR, Wang YQ, Liang CZ, Liu LC, Piao ZZ, Deng QY, Deng K, Xu C, Liang Y, Zhang LH, Li LG, Chu CC (2015) Variation in NRT1.1B contributes to nitrate-use divergence between rice subspecies. Nature Genet 47:834-838.

[0008] Iqbal N, Trivellini A, Masood A, Ferrante A, Khan NA (2013) Current understanding on ethylene signaling in plants: The influence of nutrient availability. Plant Physiol Biochem 73:128-138.

[0009] Kiba T, Krapp A (2016) Plant Nitrogen Acquisition Under Low Availability: Regulation of Uptake and Root Architecture. Plant Cell Physiol 57:707-714.

[0010] Krapp A, David LC, Chardin C, Girin T, Marmagne A, Leprince A-S, Chaillou S, Ferrario-Mery S, Meyer C, Daniel-Vedele F (2014) Nitrate transport and signalling in Arabidopsis. J Exp Bot 65: 789-798.

[0011] Li S, Tian YH, Wu K, Ye YF, Yu JP, Zhang JQ, Liu Q, Hu MY, Li H, Tong YP, Harberd NP, Fu XD (2018) Modulating plant growth-metabolism coordination for sustainable agriculture. Nature 560: 595-600.

[0012] Ma B, Ma T, Xian W, Hu B, Chu C (2022) Interplay between ethylene and nitrogen nutrition: how ethylene orchestrates nitrogen responses in plants. J Integr Plant Biol 65: 399-407.

[0013] Mahmoud A, Qi R, Zhao H, Yang H, Liao N, Ali A, Malangisha GK, Ma Y, Zhang K, Zhou Y, Xia Y, Lyu X, Yang J, Zhang M, Hu Z (2022) An allelic variant in the ACS7 gene promotes primary root growth in watermelon. Theor Appl Genet 135: 3357-3373.

[0014] Qin H, Pandey BK, Li Y, Huang G, Wang J, Quan R, Zhou J, Zhou Y, Miao Y, Zhang D, Bennett MJ, Huang R (2022) Orchestration of ethylene and gibberellin signals determines primary root elongation in rice. Plant Cell 34: 1273-1288.

[0015] Tang WJ, Ye J, Yao XM, Zhao PZ, Xuan W, Tian YL, Zhang YY, Xu S, An HZ, Chen GM, Yu J, Wu W, Ge YW, Liu XL, Li J, Zhang HZ, Zhao YQ, Yang B, Jiang XZ, Peng C, Zhou C, Terzaghi W, Wang CM, Wan JM (2019) Genome-wide associated study identifies NAC42-activated nitrate transporter conferring high nitrogen use efficiency in rice. Nat Commun 10: 1-11.

[0016] Vidal EA, Moyano TC, Canales J, Gutierrez RA (2014) Nitrogen control of developmental phase transitions in Arabidopsis thaliana. J Exp Bot 65: 5611-5618.

[0017] Wang R, Liu X, Zhu H, Yang Y, Cui R, Fan Y, Zhai X, Yang Y, Zhang S, Zhang J, Hu D, Zhang D (2023) Transcription factors GmERF1 and GmWRKY6 synergistically regulate low phosphorus tolerance in soybean. Plant Physiol 00: 1-16.

[0018] Zhang H, Yang Y, Sun C, Liu X, Lv L, Hu Z, Yu D, Zhang D (2020) Up-regulating GmETO1 improves phosphorus uptake and use efficiency by promoting root growth in soybean. Plant Cell Environ 43: 2080-2094.

[0019] Zhang S, Zhu L, Shen C, Ji Z, Zhang H, Zhang T, Li Y, Yu J, Yang N, He Y, Tian Y, Wu K, Wu J, Harberd NP, Zhao Y, Fu X, Wang S, Li S (2021) Natural allelic variation in a modulator of auxin homeostasis improves grain yield and nitrogen use efficiency in rice. Plant Cell 33: 566-580.

[0020] Jiang Z, Wang W, Chu C (2018) Research progress and prospect of plant nitrogen efficient utilization. Life Science 30: 1060-1071. SUMMARY

[0021] The technical problem to be solved by the present application is to provide a molecular marker closely linked to the nitrogen uptake efficiency trait of watermelon, and a KASP molecular marker (Nitrogen Uptake Rate) related to the nitrogen uptake efficiency of watermelon is developed. The molecular marker obtained by the present application can be used for assisted selection breeding of watermelon materials and their offspring with different nitrogen uptake efficiency.

[0022] In order to solve the above technical problems, the present application provides a KASP molecular marker for identifying different nitrogen utilization efficiencies of watermelon based on BSA mixed pool sequencing positioning of watermelon nitrogen uptake efficiency related genes; the KASP molecular marker is a SNP marker located at 27873651bp of watermelon chromosome 7; the sequence of 100bp before and after the molecular marker site is:

[0023] ATATGTTAAAAGTTCAAAACTAAATTGTTATAAATTAGGAAATATAGTGACTACATCTTTTCAAACTTAAGTTTGGTAACTAAATTTTACTTCTTTCAAC G / ATGTTGGAATTAAACCATTTTTTAACCTTTCAAATGTAGATGGTTTGGAAATAGTTGGTGAGTCAATAAGCTTGTATCCTCTATTTTCTTTTCGTTTAATA

[0024] wherein the underlined is SNP site, and the mutant type is A base.

[0025] In addition, the present application also provides a primer combination for identifying the KASP molecular marker related to the nitrogen absorption efficiency of watermelon, wherein the nucleotide sequence is 5'-3';

[0026] Forward primer F-Fam:

[0027] GAAGGTGACCAAGTTCATGCTTTGGTAACTAAATTTTACTTCTTTCAACG

[0028] Forward primer F-Hex:

[0029] GAAGGTCGGAGTCAACGGATTTTGGTAACTAAATTTTACTTCTTTCAACA

[0030] Reverse primer R:

[0031] ACTCACCAACTATTTCCAAACC

[0032] The present application also simultaneously provides the use of the above-mentioned molecular marker for molecular assisted selection breeding of different watermelon nitrogen absorption efficiency materials or their offspring.

[0033] As the use of the molecular marker of the present application: determining which genotype the different watermelon materials and their hybrid offspring belong to: homozygous GG genotype, homozygous AA genotype and heterozygous GA genotype.

[0034] The present application also simultaneously provides a method for identifying the nitrogen absorption efficiency of watermelon by using the above-mentioned molecular marker, comprising the following steps:

[0035] (1) extracting the genomic DNA of the watermelon sample to be tested;

[0036] (2) using the molecular marker primer combination as described above to perform PCR amplification on the watermelon genomic DNA on an ABI Stepone PCR instrument; using the ABI Stepone PCR instrument to detect the fluorescence signal, and analyzing the genotyping;

[0037] (3) According to the difference of the fluorescence signals of the PCR products, the genotype of each watermelon to be tested is identified, and the homozygous GG genotype (low nitrogen absorption efficiency), the homozygous AA genotype (high nitrogen absorption efficiency) and the heterozygous GA genotype are identified.

[0038] As an improvement of the method of the application:

[0039] The PCR reaction system is: 20-50 ng / ul watermelon genomic DNA 5.0 ul, KASP Master Mix 5.0 ul, KASP Assay Mix (F-Fam: F-Hex: R = 2:2:5, the concentration of the three primers is 10 ng / ul) 0.14 ul, and the total volume is 10.14 ul;

[0040] The PCR reaction program is: 30℃, 1min (read fluorescence signal); 94℃, 15min (pre-denaturation); 94℃, 20s (denaturation); 61℃ (-0.6℃ / cycle) annealing 60s, 10 cycles; 94℃, 20s (denaturation); 55℃, annealing 60s, 31 cycles; 30℃, 1min (read fluorescence signal).

[0041] The application also provides a development method of the above-mentioned molecular marker, comprising the following steps:

[0042] (1) The low-nitrogen absorption efficiency watermelon material ZJU045 and the high-nitrogen absorption efficiency watermelon material ZJU132 are used as parents to perform forward and reverse crosses to obtain ZJU045×ZJU132 F1 and ZJU132×ZJU045 F1, and the ZJU045×ZJU132 F1 is self-crossed to obtain an F2 genetic segregation population; the ZJU045×ZJU132 F1 is backcrossed with the ZJU045 and the ZJU132 respectively to obtain BC1F2(ZJU045) and BC2F2(ZJU132) populations;

[0043] (2) The CTAB (Hexadecyl trimethyl ammonium bromide) method is used to extract the genomic DNA of the watermelon parents and the F2 population of the hybrid offspring;

[0044] (3) The extreme materials in the F2 population are selected to construct a low-nitrogen absorption efficiency pool and a high-nitrogen absorption efficiency pool, and the BSA (Bulked Segregant analysis) is used to locate the region or gene related to the nitrogen absorption efficiency trait; the BC1F2(ZJU045) and BC2F2(ZJU132) populations are used to further narrow the candidate interval;

[0045] (4) identify SNP variation and InDel insertion and deletion variation closely linked to watermelon nitrogen uptake efficiency traits;

[0046] (5) based on linked variation, KASP (Kompetitive Allele Specific Polymerase Chain Reaction) method is used to screen watermelon nitrogen uptake efficiency related molecular markers;

[0047] (6) a KASP molecular marker closely linked to watermelon nitrogen uptake efficiency is developed.

[0048] The method for identifying different watermelon nitrogen uptake efficiency materials using the above molecular marker is as follows:

[0049] (1) polymorphism analysis of molecular markers in low nitrogen uptake efficiency material ZJU045 and high nitrogen uptake efficiency material ZJU132 and their offspring population:

[0050] Design and develop KASP molecular markers for detecting genotype polymorphism of two parent materials ZJU045 and ZJU132 and their offspring. The KASP molecular marker primer combination consists of forward primer F-Fam, F-Hex and reverse primer R. The primer (molecular marker) can be entrusted to Shanghai Sangon Biological Engineering Co., Ltd. to synthesize, and the amplification is carried out on ABI Step One PCR instrument.

[0051] The PCR reaction system is: 20-50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASPAssay Mix (F-Fam: F-Hex: R = 2:2:5 by volume ratio, the concentration of three primers is 10 ng / μl) 0.14 μl, the total volume is 10.14 μl;

[0052] The PCR reaction program is: 30℃, 1min (read fluorescence signal); 94℃, 15min (pre-denaturation); 94℃, 20s (denaturation); 61℃ (-0.6℃ / cycle) annealing 60s, 10 cycles; 94℃, 20s (denaturation); 55℃, annealing 60s, 31 cycles. 30℃, 1min (read fluorescence signal).

[0053] After amplification, detect the fluorescence signal and analyze the genotyping. The genotyping results are as follows: Figure 2As shown, the molecular marker can be obviously typed in different nitrogen absorption efficiency watermelon materials, and genotypes can be judged according to different fluorescence signals. Among them, the red color is the homozygous genotype AA of the high nitrogen absorption efficiency material ZJU132, the blue color is the homozygous genotype GG of the low nitrogen absorption efficiency material ZJU045, and the green color is the F1 hybrid genotype GA.

[0054] Description: In the present application, ZJU045, ZJU132 and their offspring population can be fully typed according to the above PCR reaction program.

[0055] (2) Using the above-mentioned molecular marker to carry out molecular assisted selection breeding of watermelon nitrogen absorption efficiency traits:

[0056] The KASP molecular marker closely linked to the high and low nitrogen absorption efficiency is designed and developed. The low nitrogen absorption efficiency material ZJU045 and the high nitrogen absorption efficiency material ZJU132 are crossed, and then backcrossed, self-crossed and combined with molecular marker assisted selection, and the single plant with high nitrogen absorption efficiency in the separation population is selected for breeding improvement, so as to realize the efficient utilization of nitrogen in watermelon plants and accelerate the molecular breeding process of "green" watermelon varieties. BRIEF DESCRIPTION OF DRAWINGS

[0057] The specific embodiments of the present application will be further described in detail below in combination with the drawings.

[0058] Figure 1 is the nitrogen absorption efficiency of parent materials ZJU045 and ZJU132 and F1 thereof;

[0059] The results show that the nitrogen absorption efficiency of ZJU045 is significantly lower than that of ZJU132, and the nitrogen absorption efficiency of ZJU045 x ZJU132 F1 and ZJU132 x ZJU045 F1 two F1 populations is equivalent and slightly lower than that of ZJU132.

[0060] Figure 2 is the typing map of the molecular marker of the parent materials ZJU045 and ZJU132 and F1 thereof;

[0061] Among them, the genotype of ZJU045 is GG, which is represented by blue; the genotype of ZJU132 is AA, which is represented by red; the genotype of F1 is GA, which is represented by green; and the black cross represents the negative control without fluorescence signal.

[0062] Figure 3 is the typing map of the molecular marker of the F2 generation population of the cross of different nitrogen absorption efficiency watermelon materials;

[0063] Figure 3 Among them, the left graph is the molecular marker typing map of 71 F2 single plants, and the right graph is the molecular marker typing map of 24 F2 single plants.

[0064] Wherein blue represents GG genotype consistent with low nitrogen absorption efficiency material ZJU045; red represents AA genotype consistent with high nitrogen absorption efficiency material ZJU132; green represents GA genotype consistent with F1; black cross represents negative control without fluorescent signal.

[0065] The molecular marker shows obvious separation in hybrid offspring materials, which indicates that the marker is reliable and can be used for screening of different nitrogen absorption efficiency materials in offspring.

[0066] Figure 4 is the nitrogen absorption efficiency distribution of F2 population of watermelon materials with different nitrogen absorption efficiency;

[0067] The left column represents the nitrogen absorption efficiency of F2 population of watermelon materials with all homozygous GG genotype; the right column represents the nitrogen absorption efficiency of F2 population of watermelon materials with all homozygous AA genotype; the middle column represents the nitrogen absorption efficiency of F2 population of watermelon materials with all heterozygous GA genotype;

[0068] The results show that the genotyping of the molecular marker is linked to the phenotype of nitrogen absorption efficiency in F2 population, and the next breeding can be carried out by selecting AA gene hybrid or backcross offspring individuals. It is proved that the molecular marker can assist the breeding of watermelon varieties with high nitrogen absorption efficiency.

[0069] Figure 5 is the application of the molecular marker in BC1F2 (ZJU045) population and BC2F2 (ZJU132) population

[0070] The left column represents the nitrogen absorption efficiency of plants with all homozygous GG genotype; the right column represents the nitrogen absorption efficiency of watermelon plants with all homozygous AA genotype;

[0071] The results show that there is a significant difference in nitrogen absorption efficiency between watermelon materials with GG genotype and watermelon materials with AA genotype, which further proves that the molecular marker can be successfully applied to screen watermelon varieties with high nitrogen absorption efficiency. DETAILED DESCRIPTION

[0072] The application will be further described below in combination with specific examples, but the protection scope of the application is not limited to this:

[0073] Example 1, identification of nitrogen absorption efficiency of parent materials ZJU045 and ZJU132:

[0074] Watermelon materials ZJU045 and ZJU132 were selected from the laboratory germplasm bank, and two F1 offspring of ZJU045×ZJU132 F1 and ZJU132×ZJU045 F1 were obtained by reciprocal cross, and the nitrogen absorption efficiency of the two F1 offspring was identified by using the method of Example 1. 15N stable isotope tracer technique was used to determine the nitrogen absorption efficiency of the plants per unit time. Figure 1 .

[0075] The above watermelon material is clearly informed in "An allelic variant in the ACS7 gene promotes primary root growth in watermelon" (2022.8) of Theoretical and Applied Genetics.

[0076] Specifically as follows:

[0077] The modified Hoagland nutrient solution formula of watermelon (2.5mM Ca(NO3)2·4H2O, 2.5mM KNO3, 0.5mM KH2PO4, 1.4mM MgSO4·7H2O, 50μM H3BO3, 10μM MnSO4.4H2O, 0.76μM ZnSO 4. 4.5H2O and 0.016μM (NH4)6Mo7O 24 .4H2O, pH 6.0) was used to select two-leaf one-heart watermelon seedlings with consistent growth vigor for nutrient solution culture, and the nutrient solution was replaced twice a week. After 14 days, the watermelon plants were transplanted into 15 N labeled nutrient solution (Ca(NO3)2·4H2O and KNO3 were replaced by Ca 15 (NO3)2·4H2O and K 15 NO3, respectively, and the concentration remained unchanged, and the rest of the components and concentrations were the same as the above formula) for 3 hours, and the plant roots were washed with 0.1mmol / L CaSO4 for 2 minutes. The aboveground and underground parts of the plants were placed in envelope bags, dried at 80℃ to constant weight, and then ground into powder and filtered with a 200 mesh sieve. The N content of the aboveground part of the plants was determined by stable isotope ratio mass spectrometer (Iso Prime100 Isotope Ratio Mass Spectrometer, Germany). 15

[0078] The results are as follows: Figure 1 According to Figure 1 , it can be known that the nitrogen absorption efficiency of ZJU045 is significantly lower than that of ZJU132, and the nitrogen absorption efficiency of the two F1 populations has no significant difference with that of ZJU132 and is significantly higher than that of ZJU045.

[0079] Example 2, QTL positioning of watermelon nitrogen absorption efficiency trait

[0080] ​Parental materials were selected from the laboratory germplasm bank. ZJU045 is a watermelon material with low nitrogen absorption efficiency; ZJU132 is a watermelon material with high nitrogen absorption efficiency. The genetic segregation populations F2, BC1F1(ZJU045), BC2F1(ZJU132), BC1F2(ZJU045) and BC2F2(ZJU132) were constructed by selfing and backcrossing of the above-mentioned parental hybrids. The stable isotope 15 N was used to determine the nitrogen absorption efficiency of watermelon plants per unit time.

[0081] Description:

[0082] F2 represents F2 obtained by selfing ZJU045×ZJU132 F1;

[0083] BC1F1(ZJU045) represents the BC1F1(ZJU045) population obtained by backcrossing ZJU045×ZJU132 F1 with ZJU045, BC2F1(ZJU132) represents the BC2F1(ZJU132) population obtained by backcrossing ZJU045×ZJU132 F1 with ZJU132, BC1F2(ZJU045) represents the BC1F2(ZJU045) population obtained by selfing BC1F1(ZJU045), and BC2F2(ZJU132) represents the BC2F2(ZJU132) population obtained by selfing BC2F1(ZJU132).

[0084] The CTAB (Hexadecyl trimethyl ammonium bromide) method was used to extract the genomic DNA of the watermelon parents and hybrid progeny populations; the extreme phenotype materials in the F2 population were selected to construct BSA pools, and genome resequencing was performed. Through the △SNP-index method, association analysis was performed, and a 99% confidence interval was selected to locate an interval of 23680695-28147000 on chromosome 7. Subsequently, recombinant single plants were screened in the BC1F1(ZJU045) and BC2F1(ZJU132) populations, and the BC1F2(ZJU045) and BC2F2(ZJU132) populations obtained by selfing the recombinant single plants were used for fine mapping, and the candidate interval was narrowed down to 27671704-27886428.

[0085] Example 3: Development and verification of watermelon nitrogen absorption efficiency-related KASP molecular markers

[0086] According to the gene mapping results of Example 2, the SNPs and InDels in the interval of chromosome 7 of the parental materials were extracted and analyzed, and related molecular markers were developed using KASP technology.

[0087] The specific process is as follows:

[0088] I. DNA extraction

[0089] The genomic DNA of the watermelon parents and hybrid offspring population was extracted by CTAB (Hexadecyl trimethyl ammonium bromide) method.

[0090] II. PCR amplification

[0091] The PCR reaction system was as follows: 20-50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (F-Fam: F-Hex: R = 2:2:5 in volume ratio, and the concentration of the three primers was 10 ng / μl) 0.14 μl, and the total volume was 10.14 μl.

[0092] The PCR reaction program was as follows: 30°C, 1 min (read the fluorescence signal); 94°C, 15 min (pre-denaturation); 94°C, 20 s (denaturation); 61°C (-0.6°C / cycle) annealing for 60 s, 10 cycles; 94°C, 20 s (denaturation); 55°C, annealing for 60 s, 31 cycles. 30°C, 1 min (read the fluorescence signal).

[0093] The PCR amplification was directly performed on an ABI Step One PCR instrument, and the genotyping information could be directly obtained after the instrument detected the fluorescence signal, and the results are shown in Figure 2 The software divided the detected samples into homozygous GG genotype, homozygous AA genotype and heterozygous GA genotype according to different genotypes.

[0094] The forward primers F-Fam and F-Hex were respectively provided with their own fluorescent adapters (shown as different colors on the typing chart, for example, AA genotype is red, GG genotype is blue, and GA genotype is green). If the detected material is a homozygous genotype, only one corresponding primer will be selected for amplification during amplification (for example, homozygous GG genotype can only react with F-Fam). Finally, according to the fluorescence difference, it is determined whether the detected material is homozygous GG genotype or AA genotype. If the detected material is a heterozygous genotype, both primers will be amplified, and the fluorescence signal produced is different from that of the homozygous genotype, thereby realizing the differentiation of the heterozygous genotype.

[0095] After molecular marker screening, a KASP molecular marker closely linked to the nitrogen uptake efficiency of watermelon was finally obtained. The molecular marker is a SNP marker, and the primer combination sequence of the molecular marker is as follows:

[0096] Forward primer F-Fam:

[0097] GAAAGGTGACCAAGTTCATGCTTTGGTAACTAAATTTTACTTCTTTCAACG

[0098] Forward primer F-Hex:

[0099] GAAAGGTGACCAAGTTCATGCTTTGGTAACTAAATTTTACTTCTTTCAACG

[0100] Reverse primer R:

[0101] ACTCACCAACTATTTCCAAACC

[0102] Wherein, the SNP marker is located at 27873651bp of watermelon chromosome 7, and the sequence of 100bp before and after the molecular marker site is:

[0103] GAAAGGTGACCAAGTTCATGCTTTGGTAACTAAATTTTACTTCTTTCAACG G / A TGTTGGAATTAAACCATTTTTTAACCTTTCAAATGTAGATGGTTTGGAAATAGTTGGTGAGTCAATAAGCTTGTATCCTCTATTTTCTTTTCGTTTAATA

[0104] Wherein the underlined is the SNP site, and the mutant type is A base.

[0105] According to Figure 2 It can be seen that the low nitrogen absorption efficiency watermelon material ZJU045 is homozygous GG genotype, which is represented by blue in the figure; the high nitrogen absorption efficiency material ZJU132 is homozygous AA genotype, which is represented by red in the figure; ZJU045 and ZJU132 hybrid F1 represent heterozygous GA genotype, which is represented by green in the figure.

[0106] According to Figure 3 It can be seen that the genotype of the material corresponding to ZJU1045 with blue is GG; the genotype of the material corresponding to ZJU163 with red is AA; the genotype of the material corresponding to F1 with green is GA. It is shown that the molecular marker can be used for molecular assisted selection breeding of different watermelon nitrogen absorption efficiency materials.

[0107] The BC1F2 (ZJU045) and BC2F2 (ZJU132) watermelon plants of the population are detected according to the above method, and the result is that the nitrogen absorption efficiency of the GG genotype watermelon material is significantly lower than that of the AA genotype watermelon material, and the molecular marker is highly linked to the nitrogen absorption efficiency phenotype.

[0108] Finally, it should also be noted that the above enumeration is only several specific embodiments of the present application. Obviously, the present application is not limited to the above embodiments, but can also have many variations. All variations that can be directly derived or inferred by those of ordinary skill in the art from the disclosure of the present application should be considered as falling within the scope of the present application.

Claims

1. Use of a KASP molecular marker related to watermelon nitrogen absorption efficiency: for molecular assisted selection breeding to identify watermelon materials or their offspring with high nitrogen absorption efficiency; The homozygous AA genotype is high in nitrogen absorption; The molecular marker is amplified by the following primer pairs, and the nucleotide sequences are 5'-3'; Forward primer F-Fam: GAAGGTGACCAAGTTCATGCTTTGGTAACTAAATTTTACTTCTTTCAACG Forward primer F-Hex: GAAGGTCGGAGTCAACGGATTTTGGTAACTAAATTTTACTTCTTTCAACA Reverse primer R: ACTCACCAACTATTTCCAAACC Comprising the following steps: (1) Extract the genomic DNA of the watermelon sample to be tested; (2) Use the molecular marker primer set as claimed in claim 1 to perform PCR amplification on the watermelon genomic DNA on an ABI Stepone PCR instrument; detect the fluorescence signal using an ABI Stepone PCR instrument, and analyze the genotyping; 2. A method for identifying nitrogen uptake efficiency in watermelon using the molecular marker of claim 1, characterized in that (3) According to the difference of the fluorescence signal of the PCR product, identify the genotype of each watermelon to be tested, and identify the homozygous GG genotype, the homozygous AA genotype and the heterozygous GA genotype; The homozygous GG genotype is low in nitrogen absorption, and the homozygous AA genotype is high in nitrogen absorption.

3. The method of claim 2, characterized in that: The PCR reaction system is: 20-50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASPAssay Mix 0.14 μl, and the total volume is 10.14 μl; The PCR reaction program is: 30℃, 1 min; 94℃, 15 min; 94℃, 20 s; 61℃ annealing 60 s, 10 cycles, each cycle-0.6℃; 94℃, 20 s; 55℃, annealing 60 s, 31 cycles; 30℃, 1 min. ​ ​ ​

Citation Information

Patent Citations

  • KASP molecular marker for watermelon crack resistance trait and its use

    CN110195062A

  • KASP marker primer combination for detecting orange / yellow flesh color characters of watermelons and application of KASP marker primer combination

    CN116179744A