Use of tmprss13 as a target for treatment of myocardial ischemia reperfusion injury
By supplementing with Tmprss13 reagent, especially by utilizing adeno-associated virus to overexpress Tmprss13, the treatment challenge of myocardial ischemia-reperfusion injury has been solved, significantly improving cardiomyocyte apoptosis, necrosis and fibrosis, enhancing cardiac function, and providing a new treatment approach for myocardial ischemia-reperfusion injury.
Patent Information
- Application Number
- CN202311152632.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-07
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2043-09-07
AI Technical Summary
Currently, there is a lack of effective treatments for myocardial ischemia-reperfusion injury, especially for problems such as myocardial cell death, pathological ventricular remodeling, and cardiac fibrosis caused by myocardial reperfusion therapy.
By supplementing Tmprss13 with reagents, including Tmprss13 protein, agonists, or by transgenic induction of Tmprss13 overexpression, and by using adeno-associated virus to overexpress Tmprss13 in vivo, its protease activity is enhanced to improve myocardial ischemia-reperfusion injury.
It can improve myocardial cell apoptosis and necrosis after myocardial ischemia-reperfusion, reduce myocardial fibrosis, improve cardiac function, and provide new drug targets and treatment pathways for myocardial ischemia-reperfusion injury.
Smart Images

Figure CN117138044B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of Tmprss13 as a therapeutic target for myocardial ischemia-reperfusion injury. Background Technology
[0002] A common trigger for myocardial infarction is ischemic cardiomyopathy (ICM), which occurs when blood flow to the myocardium is reduced or when a portion of the coronary arteries becomes blocked. The most effective intervention for myocardial infarction is immediate myocardial reperfusion therapy, such as restoring blood flow through thrombolytic drugs or percutaneous coronary intervention (PCI). However, myocardial reperfusion can increase reactive oxygen species levels in the heart, leading to ischemia-reperfusion injury (IRI) and further inducing cardiomyocyte death. Currently, reperfusion therapy can successfully reduce the mortality and disability rates of acute myocardial ischemia, but effective treatments for IRI are lacking. The main mechanisms of IRI are believed to be the excessive production of intracellular oxygen free radicals, calcium overload, leukocyte inflammation, and a lack of high-energy phosphate compounds.
[0003] The transmembrane serine protease 13 (Tmprss13) gene encodes a protein located on the cell membrane, belonging to the type II transmembrane serine protease (TTSP) family. Its N-terminus is located in the cytoplasm, while its C-terminus contains an extracellular serine protease domain composed of histidine, aspartic acid, and serine catalytic subunits. Tmprss13 regulates organismal development and homeostasis, cancer development and progression, and viral invasion through its protease activity.
[0004] Currently, there are no studies or reports on the role and mechanism of Tmprss13 in myocardial ischemia-reperfusion injury. Summary of the Invention
[0005] The purpose of this invention is to provide the use of Tmprss13 as a therapeutic target for myocardial ischemia-reperfusion injury, and to increase the pharmaceutical applications of Tmprss13 by supplementing Tmprss13 in vivo to treat myocardial ischemia-reperfusion injury.
[0006] This invention provides the use of a reagent for supplementing Tmprss13 in the preparation of medicaments for the prevention and / or treatment of myocardial ischemia-reperfusion injury, wherein the nucleotide sequence of Tmprss13 is shown in SEQ ID No. 1.
[0007] Preferably, the reagent comprises Tmprss13 protein or an agonist of Tmprss13.
[0008] Preferably, the reagent includes a transgene-induced Tmprss13 overexpression reagent or a Tmprss13 mRNA-mediated overexpression reagent.
[0009] Preferably, the reagents include reagents related to adeno-associated virus-induced Tmprss13 transgenes.
[0010] Preferably, the myocardial ischemia-reperfusion injury includes pathological ventricular remodeling and / or heart failure.
[0011] The present invention also provides a medicament for preventing and / or treating myocardial ischemia-reperfusion injury, wherein the active ingredient is a reagent that supplements Tmprss13, and further comprises pharmaceutically acceptable excipients; the nucleotide sequence of said Tmprss13 is shown in SEQ ID No. 1.
[0012] Preferably, the reagent for supplementing Tmprss13 includes Tmprss13 protein, a Tmprss13 agonist, or a transgene-induced Tmprss13 overexpression reagent.
[0013] Preferably, the pharmaceutically acceptable excipient is selected from at least one of buffers, encapsulating agents, fillers, binders, transdermal absorbents, humectants, disintegrants, absorption enhancers, surfactants, colorants, flavoring agents, and adsorbents.
[0014] Preferably, the treatment includes at least one of the following:
[0015] (1) Improves cardiomyocyte apoptosis and necrosis after myocardial ischemia-reperfusion;
[0016] (2) Improves pathological ventricular remodeling;
[0017] (3) Reduce cardiac fibrosis after myocardial ischemia-reperfusion;
[0018] (4) Improve cardiac function after myocardial ischemia-reperfusion.
[0019] Preferably, the dosage form of the drug includes an injection.
[0020] Beneficial Effects: This invention provides the application of a reagent supplementing Tmprss13 in the preparation of drugs for treating myocardial ischemia-reperfusion injury. Animal model experiments in the embodiments of this invention confirmed that overexpression of Tmprss13 can improve cardiomyocyte apoptosis and necrosis after myocardial ischemia-reperfusion, improve pathological ventricular remodeling, reduce cardiac fibrosis after myocardial ischemia-reperfusion, and improve cardiac function after myocardial ischemia-reperfusion, thus resisting myocardial injury from multiple aspects. This invention is the first to clearly demonstrate that overexpression of Tmprss13 can improve myocardial ischemia-reperfusion injury, providing a new drug development approach and drug target for the prevention and / or treatment of myocardial ischemia-reperfusion injury, and has very important pharmaceutical value. Attached Figure Description
[0021] Figure 1 The spectrum of the overexpression vector AAVMCS1.3-d;
[0022] Figure 2 The image shows the sequencing results of AAVMCS1.3-d-Tmprss13. The top image shows the results of the forward primer sequencing (including the start portion of the Tmprss13 nucleotide sequence), and the bottom image shows the results of the reverse primer sequencing (including the end portion of the Tmprss13 nucleotide sequence).
[0023] Figure 3 The results of RT-qPCR animal-level detection of Tmprss13 expression and verification of AAV9-Tmprss13 efficiency are shown in the figure.
[0024] Figure 4 The image shows the TUNEL and α-actinin staining results for the intervention of Tmprss13 in myocardial cell apoptosis in mice with myocardial ischemia-reperfusion injury. Figure A is a representative image of TUNEL and α-actinin staining in mice, scale bar: 50 μm; B is the statistical result of the apoptosis rate of cardiac tissue in each group after TUNEL and α-actinin staining, *** indicates p<0.001, from left to right are AAV9-Control+Sham, AAV9-Tmprss13+Sham, AAV9-Control+IRI and AAV9-Tmprss13+IRI treatment groups.
[0025] Figure 5 Figure showing the results of serum lactate dehydrogenase (LDH) activity assay in mice with myocardial ischemia-reperfusion injury treated with Tmprss13 overexpression;
[0026] Figure 6Echocardiograms showing the intervention of Tmprss13 on cardiac function in mice with myocardial ischemia-reperfusion injury; Figure A is a representative echocardiogram of the mouse heart; B is the statistical results of ejection fraction (EF) cardiac function index of mouse heart echocardiography; C is the statistical results of shortening fraction (FS) cardiac function index of mouse heart echocardiography. From left to right, B and C represent the AAV9-Control+Sham, AAV9-Tmprss13+Sham, AAV9-Control+IRI, and AAV9-Tmprss13+IRI treatment groups, respectively.
[0027] Figure 7 The image shows the results of sham staining in mice with myocardial ischemia-reperfusion injury treated with Tmprss13 overexpression. In the image, A is a representative sham staining image of myocardial fibrosis in mice, with blue representing the fibrotic areas of myocardial tissue. Scale bar: 50 μm. B shows the statistical results of the fibrosis percentage in each group after sham staining. *** indicates p<0.001. From left to right, the groups are AAV9-Control+Sham, AAV9-Tmprss13+Sham, AAV9-Control+IRI, and AAV9-Tmprss13+IRI treatment groups. Detailed Implementation
[0028]
[0029] The reagents described in this invention preferably include Tmprss13 protein or reagents that induce Tmprss13 overexpression, more preferably include agonists of Tmprss13, or reagents that induce Tmprss13 overexpression through transgenesis and reagents that induce overexpression through Tmprss13 mRNA, and more preferably include reagents related to Tmprss13 transgenesis induced by adeno-associated virus.
[0030] This invention preferably utilizes a Tmprss13 adeno-associated virus (AAV)-mediated overexpression of Tmprss13 in vivo. The source of the Tmprss13 AAV is not particularly important; conventional plasmid construction methods are employed, and the nucleotide sequence of the Tmprss13 gene is cloned into an AAV overexpression vector to obtain recombinant AAV. After obtaining the recombinant AAV, this invention preferably further includes packaging the recombinant AAV. The packaging method is not particularly limited; the viral load injected per mouse is 1 × 10⁻⁶. 11 vg is sufficient.
[0031] In this invention, the myocardial ischemia-reperfusion injury preferably includes pathological ventricular remodeling and / or heart failure, and the therapeutic effect of the drug preferably includes at least one of the following:
[0032] (1) Improves cardiomyocyte apoptosis and necrosis after myocardial ischemia-reperfusion;
[0033] (2) Improves pathological ventricular remodeling;
[0034] (3) Reduce cardiac fibrosis after myocardial ischemia-reperfusion;
[0035] (4) Improve cardiac function after myocardial ischemia-reperfusion.
[0036] The present invention also provides a medicament for preventing and / or treating myocardial ischemia-reperfusion injury, wherein the active ingredient is a reagent that supplements Tmprss13, and further comprises pharmaceutically acceptable excipients; the nucleotide sequence of said Tmprss13 is shown in SEQ ID No. 1.
[0037] The reagents for supplementing Tmprss13 described in this invention include Tmprss13 protein, Tmprss13 agonists, or transgenic agents that induce Tmprss13 overexpression, specifically as described above, and will not be repeated here. Pharmaceutically acceptable excipients described in this invention are preferably selected from at least one of buffers, encapsulation agents, fillers, binders, transdermal absorbents, wetting agents, disintegrants, absorption enhancers, surfactants, colorants, flavoring agents, and adsorbent carriers. The dosage forms of the drugs described in this invention include injections.
[0038] To further illustrate the present invention, the use of Tmprss13 provided by the present invention as a therapeutic target for myocardial ischemia-reperfusion injury is described in detail below with reference to embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0039] Example 1
[0040] 1. Construction and packaging of AAV9-Tmprss13 adeno-associated virus vector
[0041] The AAV MCS1.3-d and Tmprss13 fragments were digested with restriction endonucleases BamH1 and Sal1 and then ligated. E. coli were then transformed, and target strains were screened using conditional LB medium. Plasmids were extracted using a plasmid extraction kit, and the recombinant plasmid AAV MCS1.3-d-Tmprss13 was sequenced. After verification, the adeno-associated virus overexpression vector AAV MCS1.3-d-Tmprss13 containing the full-length coding sequence of Tmprss13 was obtained.
[0042] The spectrum of the AAV MCS1.3-d vector is as follows: Figure 1 As shown, the partial sequencing results of the AAV MCS1.3-d-Tmprss13 plasmid are as follows: Figure 2 As shown. According to Figure 2 The sequencing results show that the sequencing results are consistent with the target sequence of Tmprss13, indicating that the recombinant adeno-associated virus Tmprss13 overexpression vector AAV MCS1.3-d-Tmprss13 was successfully constructed.
[0043] Using 293T cells with a confluence of 80%-90%, the target plasmid AAV MCS1.3-d-Tmprss13 and the packaging plasmid were transfected. After 10-12 hours of transfection, the medium was replaced with fresh complete medium. After 48 hours of medium replacement, the virus was collected, purified, and concentrated. The concentrated Tmprss13 overexpressing adeno-associated virus AAV9-Tmprss13 was titered and frozen at -80 degrees Celsius.
[0044] 2. Construction and packaging of AAV9-Control adeno-associated virus vector
[0045] Same as step 1, use AAV MCS1.3-d plasmid to package control adeno-associated virus AAV9-Control.
[0046] Example 2
[0047] 1. Mouse grouping and model establishment
[0048] The experimental mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., and were randomly divided into myocardial ischemia-reperfusion injury (IRI) group (experimental group) and sham operation group (control group).
[0049] Experimental group: Mice were anesthetized by intraperitoneal injection of 4% chloral hydrate (prepared with 1×PBS) at a dose of 10 μl / g body weight. The mice were then fixed on an operating table, and the hair on the neck and left chest was removed with depilatory cream. Under a stereoscope, the skin, muscles, and tissues covering the trachea were separated with scissors. After exposing the trachea, a small hole was made between the two tracheal cartilage rings below the glottis, and an endotracheal tube was inserted and secured. The chest wall rise and fall frequency was checked to ensure good ventilation of both lungs. Under a stereoscope, a transverse incision was made at the fourth and fifth intercostal spaces along the left sternal border. The chest wall muscles and intercostal muscles were bluntly dissected with microforceps to expose the heart, and the left anterior descending artery was ligated. The thoracic cavity was sutured. After 30 minutes, the thoracic cavity was reopened, the ligation was cut and removed, and blood flow was restored. Finally, the intercostal muscles, chest wall muscles, and skin were sutured, and the postoperative wound was disinfected with iodine.
[0050] Control group: The procedure was the same as the experimental group except that no ligation was performed.
[0051] After surgery, carefully observe the mouse for any respiratory distress; if so, clear its airway promptly. Once the mouse has recovered, remove it from the heating pad and return it to its cage.
[0052] 2. Injection of the virus via the tail vein
[0053] The experimental group mice were randomly divided into two groups, designated as the AAV9-Control+IRI group and the AAV9-Tmpr ss13+IRI group. For the acute IRI model (samples were taken 24 hours after IRI surgery), Figure 4 and Figure 5 Three weeks prior to step 1, mice in each group were placed on a tail vein syringe, and their tails were disinfected with alcohol. A single-use insulin syringe was used to inject insulin via the tail vein at a dose of 1 × 10⁻⁶ mg / L. 11 The mice were injected with the dose of VG obtained in Example 1, namely AAV9-Tmprss13 and AAV9-Control. After the injection, the mice were placed in cages after hemostasis with absorbent cotton. Three weeks after the viral injection, the mice in the experimental group were further treated according to the above step 1. Twenty-four hours after the IRI surgery, the mice were anesthetized and sacrificed, and tissue samples were taken to detect cell apoptosis and necrosis indicators.
[0054] The control group mice were divided into two groups in the same manner, designated as the AAV9-Control+Sham group and the AAV9-Tmprss13+Sham group, respectively, and treated in the same way as the experimental group mice.
[0055] For the pathological ventricular remodeling model after IRI (samples were taken 3 weeks after IRI), Figure 6 and Figure 7 One week prior to step 1, mice in each group were placed on a tail vein syringe, and their tails were disinfected with alcohol. A single-use insulin syringe was used to inject insulin via the tail vein at a dose of 1 × 10⁻⁶ mg / L. 11 The mice were injected with the AAV9-Tmprss13 and AAV9-Control obtained in Example 1 at the dose of vg. After injection, the mice were placed in cages after hemostasis with absorbent cotton. One week after the viral injection, the experimental group mice were further treated according to step 1 above. Three weeks after the IRI surgery, the mice were first subjected to in vivo echocardiographic cardiac function testing. After the echocardiography, the mice were anesthetized and sacrificed, and tissue samples were taken to test the level of myocardial fibrosis.
[0056] The control group mice were divided into two groups in the same manner, designated as the AAV9-Control+Sham group and the AAV9-Tmprss13+Sham group, respectively, and treated in the same way as the experimental group mice.
[0057] Test Example 1
[0058] After the treatment in Example 2, mice were anesthetized and euthanized, and heart samples were collected. RNA was extracted from the mouse heart tissue using Trizol, and the extracted RNA was reverse transcribed into cDNA using the iScript™ cDNA Synthesis Kit. The cDNA was then quantified using real-time quantitative polymerase chain reaction (qPCR), with 18S rRNA used as an internal reference gene. -ΔΔCt The relative expression level of Tmprss13 was calculated using the method.
[0059] The primer sequences used are as follows:
[0060] Tmprss13 gene-qPCR primers
[0061] Tmprss13-qPCR-Forward Primer (SEQ ID No. 2): CGAGAGTGTACCTTGTTAGAGCA;
[0062] Tmprss13-qPCR-Reverse Primer (SEQ ID No. 3): GGATGACACACCGATGAGTG;
[0063] 18S rRNA-qPCR primers
[0064] 18s-qPCR-Forward Primer (SEQ ID No. 4): TCAAGAACGAAAGTCGGAGG;
[0065] 18s-qPCR-Reverse Primer (SEQ ID No. 5): GGACATCTAAGGGCATCAC;
[0066] Test results as follows Figure 3 As shown, the relative expression level of Tmprss13 mRNA in the heart tissue of mice in the AAV9-Tmprss13+Sham group was significantly higher than that in the AAV9-Control+Sham group, and the relative expression level of Tmprss13 mRNA in the heart tissue of mice in the AAV9-Tmprss13+IRI group was significantly higher than that in the AAV9-Control+IRI group. This indicates that AAV9-Tmprss13 effectively increases the mRNA expression of Tmprss13. *** indicates p<0.001.
[0067] Test Example 2
[0068] 1.1. TUNEL and α-actinin staining: After the treatment in Example 2, mice were anesthetized and euthanized. Heart samples were taken, and the heart tissue was transversely sectioned and frozen in OCT at -80°C. The tissue was then frozen sectioned and co-stained with TUNEL and α-actinin. After the tissue sections were dried, they were mounted with 50% glycerol prepared with sterile water and stored in the dark. The images were observed and acquired using a laser confocal microscope, and the apoptosis rate of the mouse heart tissue was calculated using ImageJ.
[0069] The results are as follows Figure 4 As shown, overexpression of Tmprss13 can improve the occurrence of cardiomyocyte apoptosis in mice with ischemia-reperfusion injury.
[0070] 1.2. Lactate dehydrogenase (LDH) activity detection: After the treatment in Example 2, the mice were anesthetized and euthanized, and their blood was collected immediately. After standing overnight at 4 degrees Celsius, the supernatant serum was collected, diluted, and tested using a lactate dehydrogenase (LDH) activity detection kit.
[0071] The results are as follows Figure 5 As shown, the activity of lactate dehydrogenase in the serum of mice in the AAV9-Control+Sham group and the AAV9-Tmprss13+Sham group was very low, while the activity of lactate dehydrogenase in the serum of mice in the AAV9-Control+IRI group was increased, indicating a significant increase in cardiomyocyte necrosis. Overexpression of Tmprss13 significantly reduced the activity of lactate dehydrogenase in the serum of mice with ischemia-reperfusion injury, thus improving cardiomyocyte necrosis. * indicates p<0.05, *** indicates p<0.001.
[0072] Test Example 3
[0073] After the treatment in Example 2, the mice were placed in a sealed glass box and anesthetized with 1.5%–2% isoflurane. Cardiac function was assessed using a Visual Sonics 2100 small animal echocardiography system at a frequency of 30 MHz. Left ventricular long-axis images and corresponding M-mode images were acquired to evaluate cardiac function. Each indicator was measured three times, and the average value was taken.
[0074] The results are as follows Figure 6 As shown, overexpression of Tmprss13 can improve cardiac function in mice with ischemia-reperfusion injury. ** indicates p<0.01, *** indicates p<0.001.
[0075] 1.3 Masson Staining: After the treatment in Example 2, mice were anesthetized and euthanized. Heart samples were taken, and transverse sections of the heart tissue were immersed in 4% paraformaldehyde. After 48 hours, the tissue was dehydrated and embedded in paraffin to prepare tissue sections with a thickness of 5 μm. After dewaxing, the sections were stained using the Masson trichrome staining kit (Kaiji Biotechnology). After the tissue sections were dried, they were mounted with neutral resin and observed and images were acquired using a bright-field microscope. ImageJ was used to quantitatively analyze the collagen fiber content and assess the level of myocardial collagen fibers.
[0076] The results are as follows Figure 7 As shown, overexpression of Tmprss13 can improve cardiac fibrosis in mice with ischemia-reperfusion injury.
[0077] The reagent overexpressing Tmprss13 provided by this invention can improve cardiac function after myocardial ischemia-reperfusion, reduce myocardial cell apoptosis and necrosis after myocardial ischemia-reperfusion, and alleviate cardiac fibrosis after myocardial ischemia-reperfusion. It provides a new approach for drug development and a drug target for the diagnosis and treatment of myocardial ischemia-reperfusion injury and / or heart failure, and has very important medicinal value.
[0078] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Use of an agent complementing Tmprss13 for the manufacture of a medicament for the prevention and / or treatment of myocardial ischemia reperfusion injury, characterized in that, The nucleotide sequence of the Tmprss13 is shown as SEQ ID No. 1; the reagent includes a Tmprss13 protein or a reagent for inducing overexpression of Tmprss13 by a transgene, or a reagent for overexpression mediated by Tmprss13 mRNA.
2. Use according to claim 1, characterized in that, The reagent includes an adeno-associated virus-induced Tmprss13 transgene-related reagent.
3. Use according to claim 1, characterized in that, The myocardial ischemia-reperfusion injury includes pathological ventricular remodeling and / or heart failure.
4. The use according to claim 1, characterized in that, The drug takes a reagent for supplementing Tmprss13 as an active ingredient, and further includes a pharmaceutically acceptable adjuvant; the nucleotide sequence of the Tmprss13 is shown as SEQ ID No.
1.
5. Use according to claim 4, characterized in that, The pharmaceutically acceptable adjuvant is selected from at least one of a buffer, a capsule, a filler, a binder, a humectant, a disintegrant, an absorption promoter, a surfactant, a colorant, a flavoring agent, and an adsorption carrier.
6. Use according to claim 4, characterized in that, The treatment includes at least one of the following: (1) improving myocardial cell apoptosis and necrosis after myocardial ischemia-reperfusion; (2) improving pathological ventricular remodeling; (3) reducing cardiac fibrosis after myocardial ischemia-reperfusion; (4) improving cardiac function after myocardial ischemia-reperfusion.
7. Use according to claim 4 or 6, characterized in that, The dosage form of the drug includes an injection.
Citation Information
Patent Citations
Diagnostics and therapeutics for diseases associated with human transmembrane serine protease 3 (tmprss3)
WO2004099779A1