Identification of two gene editing enzymes and their application in nucleic acid detection

Abstract

The present invention discloses two novel guide RNA-dependent endonucleases Gs12-2 and Gs12-14. It is found through experimental identification that the PAM recognition sequence of Gs12-2 is HVH (H=A / T / C, V=A / C / G), and the PAM recognition sequence of Gs12-14 is TTYV (Y=C / T, V=A / C / G). The advantages are that, compared with the known LbCas12a, the target recognition range of these two endonucleases is wider, and they can efficiently and specifically cut the genome, and also have trans-cutting effect, i.e., non-specific, single-stranded DNase activity. The present invention also establishes a nucleic acid visualization detection technology mediated by CRISPR / Gs12-2 and Gs12-14 systems, which has broad application prospects in the field of nucleic acid detection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to two newly identified RNA-guided endonucleases Gs12-2 and Gs12-14 and applications thereof in nucleic acid detection. Background Art

[0002] Traditional gene editing tools primarily include zinc finger nucleases (ZFNs), transcription-activating effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR). ZFNs and TALENs are first- and second-generation gene editing technologies, both of which are nucleases containing a DNA recognition and binding domain and a DNA cleavage domain. In these technologies, the DNA binding domain is specifically designed to target a specific DNA sequence that is cleaved by the DNA nuclease domain. However, the widespread application of these first- and second-generation gene editing technologies is plagued by problems such as low target recognition rates, high costs, high off-target potential, and complex structures. These shortcomings have driven the development of the third-generation gene editing technology, the CRISPR / Cas9 system, which is derived from the adaptive immune system of bacteria. CRISPR gene editing relies on two key components: the CRISPR-associated (Cas) protein and a trans-active single guide RNA (sgRNA).

[0003] With further research into the composition and function of CRISPR-related proteins, CRISPR / Cas systems can be divided into two categories: Class 1 Cas proteins are multi-protein effector complexes composed of multiple subunits, including types I, III, and IV; Class 2 Cas proteins are single multi-domain effector proteins, including type II Cas9 proteins, type V Cas12 proteins, and type VI Cas13 proteins. Relatively speaking, the second type of system is relatively simpler, more efficient, and easier to operate. The Class 2 type V effector protein Cas12a, discovered in 2015, is 1200-1500 amino acids long. The Cas12a protein can bind to and cleave genomic DNA containing a target double-stranded DNA sequence (PAM sequence, a sequence rich in bases T) under the guidance of crRNA (CRISPR RNA), which is only 42-44 bases long. In addition, the CRISPR / Cas12a system has RNase and DNase activity and does not require additional trans-activating crRNA (tracrRNA). In 2018, Cas12a was found to be able to specifically bind to and cut target double-stranded DNA (dsDNA) under the guidance of crRNA, and remain active after cutting, continuing to cut other non-target single-stranded DNA (ssDNA). This non-specific cutting activity is called "incidental cutting" ability. Scientists use the "incidental cutting" ability of Cas12a, combined with nucleic acid amplification technology, and introduce ssDNA reporter genes modified with fluorescent groups and quenching groups into the system to develop many fast, simple, and low-cost nucleic acid detection platforms.

[0004] The CRISPR / Cas12a system has the advantages of simple operation and low price, and has great application potential in nucleic acid detection, but its application is limited by defects such as specificity and PAM restriction. These are all derived from the inherent characteristics of the Cas12a nuclease. Therefore, this field still urgently needs to find a new CRISPR / Cas12a gene editing system with high editing activity, simple PAM sequence, wide genome coverage and high specificity. Summary of the Invention

[0005] The present invention excavated and identified two Cas12a family homologous nucleases Gs12-2 and Gs12-14 for the first time, and also established a nucleic acid visualization detection method mediated by Gs12-2 and Gs12-14.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The cognate endonucleases in the CRISPR / Cas12a system include the following proteins:

[0008] 1. Gs12-2 protein with the amino acid sequence shown in SEQ ID NO.1 and Gs12-14 protein with the amino acid sequence shown in SEQ ID NO.2;

[0009] II. A protein having a sequence similarity of more than 80% with the amino acid sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, and substantially retaining the biological function derived from the sequence;

[0010] III. Proteins having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, and substantially retaining the biological functions derived from the sequences.

[0011] The fusion protein comprises the above-mentioned endonuclease and a polypeptide connected to the N-terminus or C-terminus of the endonuclease.

[0012] A polynucleotide encoding the aforementioned endonuclease or the aforementioned fusion protein, and a vector or host cell containing the polynucleotide.

[0013] A visual nucleic acid detection kit comprises the above-mentioned nuclease, a single-stranded DNA fluorescence-quenching reporter gene, and a guide RNA paired with a target nucleic acid.

[0014] A kit for visually detecting pseudorabies virus (PRV) nucleic acid, comprising the above-mentioned Gs12-2 protein or Gs12-14 protein, a single-stranded DNA fluorescence-quenching reporter gene, and a Gs12-2 or Gs12-14 protein guide RNA paired with a PRV nucleic acid target, wherein the Gs12-2 guide RNA sequence is 5'-AAUUUCUACUAUUGUAGAUU CCGGTGCUGGGCTCGUTGUG -3', the Gs12-14 protein guide RNA sequence is 5'-AAUUUCUACUUAGUGUAGAUU CCGGTGCUGGGCTCGUTGUG -3' (the underlined sequence is the target region). Further, an RPA primer pair for amplifying PRV is included, wherein the upstream primer sequence is 5'-CGTGTACGTGCAGAACTCCATGCGCGTGCC-3', and the downstream primer sequence is 5'-CCCAGCTTAAAGTAGCGCCGGTGGTTGCCG-3'.

[0015] The technical solution of the present invention has the following main beneficial effects:

[0016] 1. The present invention provides for the first time a novel Cas12a family homologous nuclease Gs12-2 and Gs12-14 mined and identified by combining metagenomics and experimental means.

[0017] 2. The present invention discovered nucleases Gs12-2 and Gs12-14 with a wider range of PAM recognition sequences. Their advantage is that they can identify target DNA sites in the genome where PAM is "HVH" or "TTYV" (V=A / C / G, Y=C / T, H=A / T / C), greatly expanding the coverage of gene editing targets.

[0018] 3. The present invention provides for the first time a nucleic acid visualization detection technology mediated by the CRISPR / Gs12-2 and Gs12-14 systems. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Phylogenetic tree analysis of Cas12a family homologous endonucleases Gs12-2 and Gs12-14 predicted using metagenomic methods. A. Homology analysis of Gs12-2 and Gs12-14 with known Cas12a proteins (AsCas12a, LbCas12a, and FnCas12a); B. Phylogenetic tree analysis of Gs12-2 and Gs12-14.

[0020] Figure 2 Schematic diagram of the Gs12-2 and Gs12-14 endonuclease loci, domains, and guide RNA DR sequences. A. Schematic diagram of the Gs12-2 and Gs12-14 loci; B. Secondary structure folding and multiple sequence alignment of the guide RNA DR sequences.

[0021] Figure 3 .Conservative analysis of the predicted amino acid sequences of Gs12-2 and Gs12-14 proteins with the amino acid sequences of known Cas12a proteins (AsCas12a, LbCas12a and FnCas12a).

[0022] Figure 4 Gel electrophoresis was used to detect the double-stranded DNA cleavage activity of Gs12-2 and Gs12-14. The target was an amplified fragment of the p72 gene of the African swine fever virus (ASFV), and the recognized target site PAM was "TTTV."

[0023] Figure 5 PAM library subtraction experiments were used to identify the PAM recognition features of Gs12-2 and Gs12-14 in bacteria. A. Schematic diagram of the PAM library subtraction experiment; B. PAMs recognized by Gs12-2 and Gs12-14.

[0024] Figure 6Identification of the temperature range within which Gs12-2 and Gs12-14 cleave double-stranded DNA targets. The target is an amplified fragment of the gB gene of pseudorabies virus (PRV). A. Gel electrophoresis image of Gs12-2 cleaving the double-stranded target in vitro for 1 hour; B. Gel electrophoresis image of Gs12-14 cleaving the double-stranded target in vitro for 1 hour.

[0025] Figure 7 Identification of the temperature range for trans-cleavage activity of Gs12-2 and Gs12-14. Target: ASFV p72 gene. A. Temperature range for trans-cleavage activity of Gs12-2; B. Temperature range for trans-cleavage activity of Gs12-14.

[0026] Figure 8 Evaluation of the positional effect of single-base mismatches in the target on the trans-cleavage activity of Gs12-2 and Gs12-14. The target was an amplified fragment of the porcine PRV gB gene, PC was the positive control, the PAM site was GTTG, and NC was the negative control. A. Schematic diagram of single-base mismatch patterns at the target site; B, D. Different trans-cleavage activities of Gs12-2 at single-base mismatches were detected by blue light and fluorescence intensity. C, E. Different trans-cleavage activities of Gs12-14 at single-base mismatches were detected by blue light and fluorescence intensity.

[0027] Figure 9 Visual detection of pseudorabies virus nucleic acid in pigs based on the RPA-CRISPR / Gs12-2 system. A. Quantitative PCR is used to confirm whether a sample is positive or negative for PRV; B. RPA-CRISPR / Gs12-2 results are detected using blue light. DETAILED DESCRIPTION

[0028] Terminology

[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0030] The Genie scissor (Lingjian) family of nucleases, with "Genie" meaning "elf" and representing their bacterial origin, and "scissor" representing gene scissors, indicates their potential gene editing capabilities. The Chinese name for Genie scissor endonucleases is "Lingjian" endonucleases, and the Genie scissor gene editing system stands for the "Lingjian" endonuclease-mediated gene editing system, abbreviated as "Lingjian gene editing."

[0031] The protospacer adjacent motif (PAM) is a short DNA sequence (usually 2-6 base pairs in length). Conventional wisdom holds that the PAM is required for Cas nuclease cleavage and is typically located 3-4 nucleotides downstream of the cleavage site. Many different Cas endonucleases can be purified from different bacteria, and each enzyme may recognize a different PAM sequence.

[0032] The present invention will be further described below with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer.

[0033] Example 1. Mining new Cas12 family homologous nucleases based on metagenomics methods

[0034] Based on the bioinformatics identification process of the Cas12a family homologous nuclease established by the inventors, the massive metagenomic sequencing data in public databases such as the NCBInr (Non-Redundant Protein Sequence Database) non-redundant protein library and the Global Microbial Gene Catalog Database (GMGC) were deeply mined for bacterial encoded proteins. The general analysis process is as follows: for all contig sequences in the target database, the minced software is used to search and locate the CRISPR array, and then the prodigal software is used to predict the proteins expressed adjacent to the CRISPR array. All predicted proteins are de-redundanted using the CD-hit software, and protein cluster analysis is performed using the mega software. The hmmer software is used to identify and classify CRISPR-Cas similar proteins, and finally two new unknown bacterial proteins are obtained.

[0035] Phylogenetic tree analysis revealed that the two new bacterial proteins were located on different branches of the CRISPR-Cas12a system evolution ( Figure 1), and speculated that they may be new RNA-guided nucleases. The present invention named this newly discovered protein from different bacteria Genie scissor (Gs) nuclease. To facilitate subsequent research, further based on the bacterial species of origin, the inventors named this new unknown bacterial protein Gs12-2 and Gs12-14, respectively. The naming convention is: "nuclease + number". The amino acid sequence of the Gs12-2 protein is shown in SEQ ID NO.1, and the amino acid sequence of the Gs12-14 protein is shown in SEQ ID NO.2.

[0036] Then, the inventors used the localized blast program to compare the sequence similarity of this newly discovered bacterial protein with the NCBI nr database. The results showed that the amino acid sequence conservation of the Gs12-2 protein with the known nucleases LbCas12a, FnCas12a and AsCas12a was 34.96%, 34.60% and 30.88%, respectively, and the amino acid sequence conservation of the new Gs12-14 protein with the known nucleases LbCas12a, FnCas12a and AsCas12a was 44.17%, 37.92% and 32.17%, respectively. Figure 1 ).

[0037] Furthermore, the inventors analyzed the loci of the two proteins using CRISPRCasFinder software. The results showed that Gs12-2 and Gs12-14 had CRISPR array sequences, containing multiple repeats and spacer sequences, but Gs12-14 did not have Cas4, Cas1 and Cas2. By using hmmer software to perform hidden Markov model alignment analysis with the domain sequences in the Pfam database, the REC1domain (Alpha helical recognition lobe domain), RuvCnuclease domain and NUC domain (Nuclease domain) were obtained, and it was speculated that the two new bacterial proteins may have nucleic acid cleavage activity; then the inventors predicted and compared the secondary structures of the DR sequences of Gs12-2 and Gs12-14 using the RNAfold web server online website and found that the two newly predicted bacterial proteins were similar to the DR secondary structures of the known Cas12a proteins, with Gs12-2 differing by only one base; the Gs12-14 DR sequence had one more base and four bases differed ( Figure 2 ).

[0038] Finally, the inventors performed amino acid multiple sequence alignment of the RuvC and REC domains of Gs12-2 and Gs12-14 proteins with the known LbCas12a, FnCas12a and AsCas12a proteins, respectively. Figure 3 As shown, it was found that the amino acid sequence similarity of the Gs12-2 and Gs12-14 protein domains was quite different from that of the known Cas12a protein, so further experiments are needed to determine whether it has nucleic acid-directed cleavage activity.

[0039] Example 2. Novel nucleases Gs12-2 and Gs12-14 have double-stranded DNA cleavage activity in vitro

[0040] This example tested the double-stranded DNA cleavage activity of Gs12-2 and Gs12-14 proteins in vitro. Guide RNAs paired with target nucleic acids were used to guide Gs12-2 and Gs12-14 proteins to recognize and bind to the target nucleic acid, thereby stimulating their cleavage activity and cleaving the double-stranded target nucleic acid in the system. Agarose gel electrophoresis was then performed to observe changes in the size of the target band to identify the enzymatic activity.

[0041] The target double-stranded DNA (dsDNA) selected in this example is the African swine fever P72 gene, and the PAM is TTTA, whose sequence is: The bold mark is PAM, and the underline is the targeting sequence. The guide RNA sequence of Gs12-2 protein is: AAUUUCUACUAUUGUAGAUU AGAGCAGACAUUAGUUUUUC; The guide RNA sequence of the Gs12-14 protein is: AAUUUCUACUUAGUGUAGAUU AGAGCAGACAUUAGUUUUUUC(The underlined area is the targeting area). Using the PMD-18T-p72 plasmid as a template, p72-F: CTGTAACGCAGCACAGCTGA, p72-R: CCATGGTTTATCCCAGGAGT as primers were used for PCR amplification to obtain P72 double-stranded DNA. Secondly, the DNA sequences encoding Gs12-2 and Gs12-14 were synthesized after E. coli codon optimization. The nucleotide sequences are shown in SEQ ID NO.3 and 4, and NLS nuclear localization signals were added to their C-termini, respectively. Subsequently, they were connected to the pET-28a prokaryotic expression vector and transformed into the E. coli BL21 strain. After identifying the positive clones, IPTG-induced expression was performed, and the target protein was obtained by affinity chromatography purification. The in vitro cleavage reaction used the following system: 2 μL of 10× CutSmart Buffer, 500 ng of the predicted Gs12-2 or Gs12-14 protein, enhanced enAsCas12a or LbCas12a protein, 500 ng of crRNA, and 2 μL of P72 double-stranded DNA amplification product. Each reaction was incubated at 37°C for 30 min. After completion, 0.5 μL of proteinase K was added to each reaction, and the reaction was terminated by incubation at 55°C for 10 min. Guide RNA and target nucleic acid were added to the experimental group, while no guide RNA was added to the control group. After the reaction, the target bands of the predicted novel nucleases Gs12-2 and Gs12-14 in the experimental and control groups were detected by 2% agarose gel electrophoresis. The target bands were visualized under a UV-illuminated microscope. Cleavage efficiency was analyzed using Image J software.

[0042] The results are as follows Figure 4 As shown, compared with the control group without guide RNA, the Gs12-2 and Gs12-14 proteins in the experimental group were able to cut the double-stranded DNA in the reaction solution within 30 minutes, with one or two obvious cutting bands, and the cutting efficiency was Gs12-2: 4.7%, Gs12-14: 87.2%, enAsCas12a: 47.9%, LbCas12a: 11.2%, respectively. It can be seen that the bacterial proteins predicted by the metagenomic strategy have nucleic acid targeted cutting activity as expected.

[0043] Example 3. Identification of PAM recognition characteristics of Gs12-2 and Gs12-14

[0044] By performing a PAM library subtraction experiment on bacteria, the PAM sequences recognized by Gs12-2 and Gs12-14 proteins with low homology and in vitro target nucleic acid cleavage activity were identified. The random mixed PAM vector library construction process is as follows: synthesize the DNA oligo sequence GGCCAGTGAATTCGAGCTCGGTACCCGGGNNNNNNN GAGAAGTCATTTAATAAGGC CACT GTTAAAAAGCTTGGCGTAATCATGGTCATAGCTGTTT, where N is a random deoxynucleotide. After PCR amplification using Oligo-F: GGCCAGTGAATTCGAGCTCGG and Oligo-R: AAACAGCTATGACCATGATTACGCCAA as upstream and downstream primers, the sequence was ligated into the pUC19 vector by homologous recombination. After transformation into E. coli, the plasmid was extracted to form a random mixed PAM vector library. The guide RNA sequence for the Gs12-2 protein is: AAUUUCUACUAUUGUAGAUU GAGAAGUCAUUUAAUAAGGCCA CU; The guide RNA sequence of the Gs12-14 protein is AAUUUCUACUUAGUGUAGAUU GAGAAGUCAUUUAAUAAGGCCACU (The underlined area is the targeted region).

[0045] Bacterial PAM library subtraction experiment: The constructed Gs12-2 and Gs12-14 protein co-expression vectors pACYC-Duet-1-Gs12-2-crRNA and pACYC-Duet-1-Gs12-14-crRNA, respectively, were transformed into DE3 (BL21) competent cells to prepare stable expression bacterial strains. A stable bacterial strain constructed without the Gs12-2 / 14 protein expression vector pACYC-Duet-1 was used as a negative control. 100 ng of the PAM library plasmid was electroporated into each of the stable expression bacterial strains and screened on ampicillin and chloramphenicol dual-resistance plates. After 16 hours, colonies were scraped from the plates for plasmid extraction. 100 ng of extracted plasmid was used as template, and library sequencing primers Seq-F: 5'-GGCCAGTGAATTCGAGCTCGG-3' and PAM-Seq-R: 5'-CAATTTCACACAGGAAACAGCTATGACC-3' were used for PCR amplification. After the products were recovered, the experimental group and the control group were subjected to second-generation high-throughput sequencing, and the sequencing results were analyzed and displayed using Weblogo3.0.

[0046] To characterize the PAM sequences recognized by the Gs12-2 and Gs12-14 proteins, we analyzed the 16,384 different PAM sequences contained in the starting vector library. Our analysis used high-throughput sequencing to calculate the frequency of each PAM sequence in both the experimental and control groups. The frequency of each PAM sequence was normalized to the total number of PAM sequences in each group. The change in PAM depletion was calculated as log2 (normalized value of the control group / normalized value of the experimental group). A PAM sequence with a value greater than 3.5 was considered significantly depleted. The frequency of each base position in these significantly depleted PAM sequences was then visualized using Weblogo 3.0.

[0047] The results are as follows Figure 5 As shown, two CRISPR / Cas12a gene editing systems with loose PAM sequences, Gs12-2 and Gs12-14, were found to be able to cut target DNA in sequences with PAM of "HVH" and "TTYV" (V=A / C / G, Y=C / T, H=A / T / C) in the genome, respectively.

[0048] Example 4. Identification of the temperature range of Gs12-2 and Gs12-14 for cleaving double-stranded DNA targets in vitro

[0049] This example uses in vitro experiments to test the double-stranded DNA cleavage activity of Gs12-2 and Gs12-14 proteins under different temperature gradients. Guide RNAs paired with target nucleic acids guide Gs12-2 and Gs12-14 proteins to recognize and bind to the target nucleic acid, thereby stimulating their cleavage activity and cleaving the double-stranded target nucleic acid in the system. Agarose gel electrophoresis is then performed to observe changes in the size of the target band to identify the enzymatic activity.

[0050] In this example, the target double-stranded DNA (dsDNA) is selected as the pseudorabies virus gB gene, and the PAM is TTTG, whose sequence is: The bold mark is PAM, and the underline is the targeting sequence. The guide RNA sequence of Gs12-2 protein is: AAUUUCUACUAUUGUAGAUU GUAGGUGAACUGCAGGCGCG The guide RNA sequence of Gs12-14 protein is: AAUUUCUACUUAGUGUAGAUU GUAGGUGAACUGCAGGCGCG(The underlined region indicates the target region). Double-stranded PRV DNA was amplified by PCR using the pUC57-PRV-gB plasmid as a template and primers PRV-F (GAGGCCTCGGAGGCCATCGA) and PRV-R (TACCGGCACATCTCGCGCC). The in vitro cleavage reaction used the following system: 2 μL of 10× CutSmart Buffer, 500 ng of predicted Gs12-2 or Gs12-14 protein, 500 ng of crRNA, and 2 μL of PRV gB target amplification product. Gs12-2 protein was incubated at 25°C, 37°C, 42°C, 50°C, and 60°C for 1 hour, respectively; Gs12-14 protein was incubated at 25°C, 37°C, 42°C, 50°C, and 60°C for 1 hour, respectively. After completion, the reaction was terminated by adding 0.5 μL of proteinase K and incubating at 55°C for 10 minutes. Guide RNA and target nucleic acid were added to the experimental group, while no guide RNA was added to the control group. After the reaction, the target bands of the predicted novel proteases Gs12-2 and Gs12-14 in the experimental group and the control group were observed by 2% agarose gel electrophoresis and imaging under UV imaging. The cleavage efficiency was analyzed by Image J software. Figure 6 As shown, at 25°C, 37°C, 42°C, 50°C, and 60°C, the cleavage efficiencies of Gs12-2 after 1 hour in vitro were 52.6%, 51.2%, 39.2%, 44.1%, and 47.6%, respectively; and the cleavage efficiencies of Gs12-14 after 20 minutes in vitro were 34.1%, 39.6%, 45.3%, 35.2%, and 26.1%, respectively. These results indicate that both Gs12-2 and Gs12-14 proteins have high in vitro cleavage activity within the range of 25-60°C.

[0051] Example 5. CRISPR / Gs12-2 and CRISPR / Gs12-14 systems can mediate rapid on-site visualization of nucleic acid detection

[0052] Further evaluate whether Gs12-2 and Gs12-14 proteins have trans cleavage activity. Guide RNA that can pair with the target nucleic acid is used to guide the nuclease Gs12-2 and Gs12-14 to recognize and bind to the target nucleic acid; then stimulate its "trans cleavage" activity on any single-stranded nucleic acid, thereby cutting the single-stranded DNA fluorescence-quenching reporter gene (ssDNA-FQ) in the reaction system; further, the trans cleavage function of the candidate bacterial protein can be judged by the excited fluorescence intensity, background noise and naked eye color change. The target double-stranded DNA (dsDNA) used in the temperature range for evaluating the trans cleavage activity of Gs12-2 and Gs12-14 in this example is the amplified fragment of the pseudorabies virus PRV gB gene, and the sequence is as follows: The bold mark is PAM, and the underline is the targeting sequence. The Gs12-2 protein guide RNA sequence is: AAUUUCUACUAUUGUAGAUU CCGGUGCAGGGCUCG AUGAG ; The guide RNA sequence of Gs12-14 protein is: AAUUUCUACUUAGUGUAGAUU CCGGUGCAGGGCUCGAUGAG The underlined sequence is the target region (the underlined area is the target region). The fluorescence-quenching reporter gene is ROX-random-BHQ2 (5'ROX / GTATCCAGTGCG / 3'BHQ2). The following reaction system was used: 500ng of Gs12-2 or Gs12-14 protein, 500ng of guide RNA, 2μL 10×CutSmart Buffer, 1μM single-stranded DNA fluorescence-quenching reporter gene and 2μL of PCR amplification target product. The negative control was without adding target. The reaction was carried out at 16°C, 25°C, 37°C, 42°C, 50°C and 60°C for 15 minutes, and inactivated at 98°C for 2 minutes. The trans-cleavage activity of the above-mentioned predicted proteins in vitro was judged by observing the fluorescence intensity and background noise under blue light and ultraviolet light. The results are shown in FIG. Figure 7 As shown, Gs12-2 and Gs12-14 proteins have high trans-cleavage activity at 37-50°C, and the trans-cleavage activity of Gs12-2 is highest at 50°C, while the trans-cleavage activity of Gs12-14 is highest at 42°C.

[0053] Example 6. Evaluation of the specificity of the CRISPR / Gs12-2 and CRISPR / Gs12-14 systems

[0054] The ability of the CRISPR / Gs12-2 and CRISPR / Gs12-14 systems to recognize single base mismatches in the target region was further evaluated. The target double-stranded DNA (dsDNA) used in this example was the conserved gene of the gB portion of the pseudorabies virus PRV, and the sequence is as follows: The bold mark is PAM, and the underlined mark is the targeting sequence. First, PCR amplified a double-stranded DNA template containing consecutive target site mutations from positions 1-20. Target-F to Target-p72-F-20C were used as upstream primers, and Target-p72-R was used as downstream primer to amplify the target double-stranded gene. The primer sequence table used in the present invention is as follows:

[0055]

[0056]

[0057] The guide RNA sequence of Gs12-2 protein is: AAUUUCUACUAUUGUAGAUU CCGGTGCUGGGCTCGUTGUG, The guide RNA sequence of Gs12-14 protein is: AAUUUCUACUUAGUGUAGAUU CCGGTGCUGGGCTCGUTGUG (The underlined area is the target area). First, the Gs12-2 and Gs12-14 proteins were expressed and purified by prokaryotic expression, the guide RNA was transcribed in vitro, and the double-stranded DNA of the PRV gB target gene was amplified by PCR. Then the following reaction system was used: 500 ng of Gs12-2 or Gs12-14 protein, 500 ng of guide RNA, 2 μL of 10×CutSmart Buffer, 1 μM single-stranded DNA fluorescence-quenching reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2) and 2 μL of PCR amplification target product. The negative control was without adding target. React at 37°C for 15 minutes and inactivate at 98°C for 2 minutes. The trans-cleavage activity of the above-mentioned predicted proteins in vitro was judged by observing the fluorescence intensity and background noise under blue light. The results are shown in the figure. Figure 8 As shown in the figure, compared with the fully matched positive control, the presence of a single base mismatch site can significantly inhibit the nucleic acid trans-cleavage activity of Gs12-2 and Gs12-14 proteins. This shows that Gs12-2 and Gs12-14 proteins are more sensitive to single base mismatches at the target site, which in turn indicates that they have a high specificity for target site recognition, which will be more helpful for the future use of accurate identification of single nucleotide sequence polymorphisms (SNPs) or genomic base modifications.

[0058] Example 7. Visual detection of porcine pseudorabies virus using RPA-CRISPR / Gs12-2 technology

[0059] To evaluate the reliability of CRISPR / Gs12-2-mediated nucleic acid on-site visualization detection technology. For PRV, an RPA-CRISPR / Gs12-2 detection technology was established. Culture fluids from PRV-infected and uninfected cells were collected as simulated clinical viral infection samples and compared with quantitative PCR to evaluate the detection accuracy of the newly developed technology. A fragment of the pseudorabies virus (PRV) gB gene amplification was used as a positive control, and sterile water alone was added as a negative control. The sequence is as follows: The bold mark is PAM, and the underline is the targeting sequence. The Gs12-2 protein guide RNA sequence is: AAUUUCUACUAUUGUAGAUU CCGGUGCAGGGCUCGAUGAG. RPA primers for amplification: Upstream primer: 5'-CGTGTACGTGCAGAACTCCATGCGCGTGCC-3', downstream primer: 5'-CCCAGCTTAAAGTAGCGCCGGTGGTTGCCG-3'. Quantitative PCR primers: Upstream primer: GGCGTGTACGTGCAGAACTC, downstream primer: ACCCGCTCCCCAGCTTAAAG. First, the Gs12-2 protein was expressed and purified by prokaryotic expression, the guide RNA was transcribed in vitro, and the double-stranded DNA of the PRV gB target gene was amplified by PCR. Then, PK15 cells were cultured in vitro, and after the cell confluence reached 70%, PRV virus was inoculated and the virus culture fluid was collected after culturing in a 37°C constant temperature incubator for 3 days. Then, 30 μL of PRV virus culture medium was divided into 3 PCR tubes, 10 μL per tube, and 10 μL of viral nucleic acid crude extract Quick Extract Solution was added respectively. After heating at 65°C for 5 minutes and 98°C for 5 minutes, it was set aside. 220 μL of sterilized water was taken and placed in 11 PCR tubes, 20 μL per tube. The above 14 PCR tubes were randomly shuffled and numbered 1-14. Finally, the 16 samples to be tested were tested by quantitative PCR and RPA-CRISPR / Gs12-2 detection methods respectively. Quantitative PCR reaction system: MonAmp TM The chemoHs qPCR mix consisted of 10 μL of chemoHs qPCR mix, 0.4 μL of forward primer, 0.4 μL of reverse primer, 9.2 μL of purified water, and 1 μL of the sample to be tested. The primer concentration was 10 nM. The reaction procedure was as follows: initial denaturation at 95°C for 5 min; amplification at 95°C for 5 s, then 60°C for 15 s, for 40 cycles; and annealing at 40°C for 30 s. Fluorescence signal detection was performed at the end of each extension cycle. The RPA-CRISPR / Gs12-2 reaction system consisted of 500 ng of Gs12-2 protein, 500 ng of guide RNA, 2 μL of 10× CutSmart Buffer, 1 μM single-stranded DNA fluorescence-quenched reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2), and 1 μL of RPA-amplified target product. The reaction was incubated at 37°C for 15 min and inactivated at 98°C for 2 min. RPA (TwistDX) reaction system: A buffer 29.4μL, forward primer 2μL, reverse primer 2μL, B buffer 2.5μL (concentration is 280mM), DEPC water 40.1μL, mix well and divide into 4 PCR tubes, 19μL per tube, and add 1μL of the sample to be tested. React at 42℃ for 20min. By analyzing the CT value of the sample to be tested by quantitative PCR and the CT value of the positive control and negative control, the number of the virus-infected cell culture medium in the sample to be tested is determined, and then the fluorescence intensity and background noise of the RPARPA-CRISPR / Gs12-2 detection result are observed under blue light. The results are as follows Figure 9 As shown, the quantitative PCR method identified samples 3, 7, and 12 as PRV-infected cell culture fluids, while the RPA-CRISPR / Gs12-2 method showed consistent results. This demonstrates the high accuracy of the RPA-CRISPR / Gs12-2 technique, providing a new method for visualizing PRV nucleic acid detection in the future.

[0060] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as above in terms of a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art may, without departing from the scope of the technical solution of the present invention, make some changes or modifications to equivalent embodiments using the technical contents suggested above. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention shall still fall within the scope of the solution of the present invention.

Claims

1. A homologous endonuclease in a CRISPR / Cas12a system, characterized in that It includes the Gs12-2 protein with the amino acid sequence shown in SEQ ID NO.1 and the Gs12-14 protein with the amino acid sequence shown in SEQ ID NO.

2.

2. A polynucleotide, characterized in that The polynucleotide is a polynucleotide encoding the nuclease according to claim 1.

3. A carrier, characterized in that The vector comprises the polynucleotide according to claim 2.

4. A visual nucleic acid detection kit, characterized in that: It comprises the nuclease according to claim 1, a single-stranded DNA fluorescence-quenching reporter gene, and a guide RNA paired with a target nucleic acid.

5. A kit for visual detection of pseudorabies virus, characterized in that: It comprises the Gs12-2 protein or Gs12-14 protein as described in claim 1, a single-stranded DNA fluorescence-quenching reporter gene, and a Gs12-2 or Gs12-14 protein guide RNA paired with a PRV nucleic acid target, wherein the Gs12-2 guide RNA sequence is 5'-AAUUUCUACUAUUGUAGAUCCGGTGCUGGGCTCGUTGUG-3', and the Gs12-14 protein guide RNA sequence is 5'-AAUUUCUACUUAGUGUAGAUCCGGTGCUGGGCTCGUTGUG-3'.

6. The kit according to claim 5, characterized in that Also included is a recombinase polymerase amplification primer pair for pseudorabies virus, wherein the upstream primer sequence is 5'-CGTGTACGTGCAGAACTCCATGCGCGTGCC-3', and the downstream primer sequence is 5'-CCCAGCTTAAAGTAGCGCCGGTGGTTGCCG-3'.

Images