A molecular marker for identifying resistance to blackmold in wheat and methods thereof
By detecting a specific SNP site at 109.9 Mb on wheat chromosome 6A, resistance to wheat black embryo disease was identified using KASP primers and a kit. This solved the problem of low breeding efficiency in existing technologies and realized an efficient molecular marker-assisted selection and environmentally friendly breeding method.
Patent Information
- Application Number
- CN202311023930.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-15
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2043-08-15
AI Technical Summary
Existing technologies make it difficult to effectively identify and select resistance genes for wheat black embryo disease, resulting in low breeding efficiency, and the use of seed coating agents and chemical control methods leads to environmental pollution.
A specific SNP site (T or C) located at 109.9 Mb on wheat chromosome 6A was developed as a molecular marker. Genotyping was performed using KASP primers and kits, and resistance to black embryo disease was determined by fluorescence signal scanning. Wheat varieties with strong or weak resistance were then bred or screened.
It significantly improved the breeding efficiency of wheat black embryo resistance, reduced the black embryo rate, reduced environmental pollution, and provided an efficient molecular marker-assisted selection method.
Smart Images

Figure CN117230230B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a molecular marker for identifying the resistance of wheat to black kernel disease and a method thereof. BACKGROUND
[0002] Black kernel disease is a worldwide disease, and the main symptom is that the kernel embryo presents obvious black and brown spots, which seriously affects the appearance, processing and nutritional quality of the kernel, and reduces the commodity grade of wheat. In recent years, with the improvement of soil conditions and the change of global climate, black kernel disease has become more and more serious, which threatens the safety of wheat production. In China, black kernel disease mainly occurs in the Huanghuai wheat region and the middle and lower reaches of the Yangtze River. In China, the percentage of imperfect kernels in grade three or above is required to be less than 6% (national standard GB-1351-2008). Using seed coating agents and spraying agents during the filling period is the main way to prevent and control black kernel disease, but it will cause serious environmental pollution. Therefore, breeding disease-resistant varieties is an economical and effective method to prevent and control black kernel disease.
[0003] Black kernel disease resistance is a complex quantitative trait controlled by multiple genes, and there is a significant difference in resistance among different varieties. It is urgent to explore resistance genes and develop closely linked markers for black kernel disease resistance breeding. Molecular markers closely linked to black kernel disease resistance QTL can be used for targeted gene accumulation through marker-assisted selection (MAS), thereby improving the resistance of varieties. MAS has been widely used in linkage analysis, association analysis, marker-assisted selection and crop design breeding. With the development of genomics and molecular biology, SNP markers have become the most widely used type of molecular markers in wheat genetic research. In recent years, wheat 90K, 660K, 50K, 55K and 35K gene chips have developed rapidly and are widely used in the genetic analysis of complex traits in wheat. SNP markers have been gradually applied to high-density genetic mapping, quantitative trait gene mapping and germplasm genotype detection, effectively accelerating the process of molecular breeding. KASP (Kompetitive Allele-Specific PCR) technology can accurately determine the double alleles of SNPs and InDels at specific loci in a wide range of genomic DNA samples. The SNP genotyping detection scheme based on KASP technology developed by LGC Genomics Company effectively saves costs and is highly efficient in specific marker detection of large quantities of materials. SUMMARY
[0004] The purpose of the present application is to provide a molecular marker for identifying the resistance of wheat to black kernel disease and a method thereof.
[0005] In a first aspect, the present application claims the use of a single nucleotide polymorphism at a specific SNP locus on the wheat genome as a marker in any of the following:
[0006] (A1) identifying or assisting in identifying the resistance of wheat to black smut;
[0007] (A2) preparing a product for identifying or assisting in identifying the resistance of wheat to black smut;
[0008] (A3) comparing the resistance of a wheat to be tested to black smut;
[0009] (A4) preparing a product for comparing the resistance of a wheat to be tested to black smut;
[0010] (A5) breeding a wheat single plant or strain or line or variety with relatively strong resistance to black smut;
[0011] (A6) preparing a product for breeding a wheat single plant or strain or line or variety with relatively strong resistance to black smut;
[0012] (A7) screening a wheat single plant with relatively weak resistance to black smut;
[0013] (A8) preparing a product for screening a wheat single plant with relatively weak resistance to black smut;
[0014] The specific SNP site is located at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C. The specific SNP site corresponds to the physical position 109.9 Mb of the wheat reference genome Chinese Spring RefSeq v1.0 (https: / / urgi.versailles.inra.fr / blast_iwgsc / ) (the same below).
[0015] In a second aspect, the present application claims the use of a substance for detecting the single nucleotide polymorphism of a specific SNP site on the genome of wheat in any one of the following:
[0016] (A1) identifying or assisting in identifying the resistance of wheat to black smut;
[0017] (A2) preparing a product for identifying or assisting in identifying the resistance of wheat to black smut;
[0018] (A3) comparing the resistance of a wheat to be tested to black smut;
[0019] (A4) preparing a product for comparing the resistance of a wheat to be tested to black smut;
[0020] (A5) breeding a wheat single plant or strain or line or variety with relatively strong resistance to black smut;
[0021] (A6) preparing a product for breeding a wheat single plant or strain or line or variety with relatively strong resistance to black smut;
[0022] (A7) screening and removing wheat single plant with relatively weak resistance to black smut;
[0023] (A8) preparing a product for screening and removing wheat single plant with relatively weak resistance to black smut;
[0024] The specific SNP site is located at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C.
[0025] The substance for detecting the single nucleotide polymorphism of the specific SNP site on the wheat genome is the KASP primer in the third aspect below or the reagent or kit in the fourth aspect below.
[0026] In a third aspect, the present application claims a KASP primer for identifying or assisting in identifying the resistance of wheat to black smut.
[0027] The KASP primer for identifying or assisting in identifying the resistance of wheat to black smut claimed by the present application consists of primer 1, primer 2 and primer 3; the primer 1 is a single-stranded DNA with a fluorescent tag sequence A and the nucleotide sequence of positions 22-39 of SEQ ID No. 1 from 5' end to 3' end; the primer 2 is a single-stranded DNA with a fluorescent tag sequence B and the nucleotide sequence of positions 22-39 of SEQ ID No. 2 from 5' end to 3' end; and the primer 3 is a single-stranded DNA with the nucleotide sequence as shown in SEQ ID No. 3 in the sequence listing.
[0028] The nucleotide sequence of the fluorescent tag sequence A can be positions 1-21 of SEQ ID No. 1, and the nucleotide sequence of the fluorescent tag sequence B can be positions 1-21 of SEQ ID No. 2.
[0029] Further, the primer 1 is a single-stranded DNA with the nucleotide sequence as shown in SEQ ID No. 1, and the primer 2 is a single-stranded DNA with the nucleotide sequence as shown in SEQ ID No. 2.
[0030] In a fourth aspect, the present application claims a reagent or kit for identifying or assisting in identifying the resistance of wheat to black smut.
[0031] The kit claimed by the present application contains the reagent; and the reagent contains the KASP primer in the third aspect above.
[0032] In a fifth aspect, the present application claims a specific DNA molecule.
[0033] The specific DNA molecule claimed by the present application is as shown in SEQ ID No. 4. The Y at position 37 of SEQ ID No. 4 is T or C.
[0034] In a sixth aspect, the present application claims the use of the KASP primer as defined in the third aspect above or the reagent or kit as defined in the fourth aspect above or the specific DNA molecule as defined in the fifth aspect above in any one of:
[0035] (A1) identifying or assisting in identifying the resistance to black smut of wheat;
[0036] (A2) preparing a product for identifying or assisting in identifying the resistance to black smut of wheat;
[0037] (A3) comparing the resistance to black smut of a wheat to be tested;
[0038] (A4) preparing a product for comparing the resistance to black smut of a wheat to be tested;
[0039] (A5) breeding a wheat individual or line or strain or variety with relatively stronger resistance to black smut;
[0040] (A6) preparing a product for breeding a wheat individual or line or strain or variety with relatively stronger resistance to black smut;
[0041] (A7) screening a wheat individual with relatively weaker resistance to black smut;
[0042] (A8) preparing a product for screening a wheat individual with relatively weaker resistance to black smut;
[0043] (A9) wheat breeding.
[0044] In (A9), the purpose of the breeding is to obtain a wheat variety with enhanced resistance to black smut.
[0045] In a seventh aspect, the present application claims any one of the following methods:
[0046] Method I: a method for comparing the resistance to black smut of a wheat to be tested, comprising the following steps:
[0047] (D1) detecting the nucleotide at a specific SNP site on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, and determining the resistance to black smut of the wheat to be tested according to the genotype of the wheat to be tested as follows: the resistance to black smut of the wheat to be tested with a T:T genotype is stronger or is a candidate for being stronger than that of the wheat to be tested with a C:C genotype;
[0048] the specific SNP site is at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C;
[0049] the T:T genotype is a homozygous genotype with T at the specific SNP site on the genome of the wheat;
[0050] The C:C genotype is a homozygous type of nucleotide C at the specific SNP site on the wheat genome.
[0051] Method II: a method for breeding a wheat single plant or strain or line or variety with relatively strong resistance to black smut, comprising the following steps:
[0052] detecting the nucleotide at the specific SNP site on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, selecting the wheat to be tested with the T:T genotype as the parent for breeding, and selecting the wheat with the T:T genotype in each generation of breeding to finally obtain a wheat single plant or strain or line or variety with relatively strong resistance to black smut;
[0053] The specific SNP site is located at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C.
[0054] The T:T genotype is a homozygous type of nucleotide T at the specific SNP site on the wheat genome.
[0055] Method III: a method for screening out a wheat single plant with relatively weak resistance to black smut, comprising the following steps:
[0056] detecting the nucleotide at the specific SNP site on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, and screening out the wheat to be tested with the C:C genotype for elimination;
[0057] The specific SNP site is located at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C.
[0058] The C:C genotype is a homozygous type of nucleotide C at the specific SNP site on the wheat genome.
[0059] In the above method, the detection of the nucleotide at the specific SNP site on the genome of the wheat to be tested can be completed by direct sequencing, or can be performed according to the method comprising the following steps: performing PCR amplification on the genomic DNA of the wheat to be tested using the reagent or kit described in the fourth aspect above, performing fluorescence signal scanning on the amplified product, and then determining the genotype of the specific SNP site in the genome of the wheat to be tested according to the following: if the fluorescence signal of the amplified product of the wheat to be tested is the signal corresponding to the fluorescence tag sequence A, then the wheat to be tested is of the T:T genotype; if the fluorescence signal of the amplified product of the wheat to be tested is the signal corresponding to the fluorescence tag sequence B, then the wheat to be tested is of the C:C genotype.
[0060] In the specific embodiment of the present application, the strength of the black kernel disease resistance is embodied by the high or low black kernel rate of the grain. The high black kernel rate of the grain indicates weak black kernel disease resistance, and the low black kernel rate of the grain indicates strong black kernel disease resistance.
[0061] In the present application, the wheat can be selected from the hybrid offspring of Linmai No. 2 and Zhong 892 or 166 wheat materials in Table 2.
[0062] In the present application, the KASP primer is developed based on a specific SNP site (T or C at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat), and then the average black kernel rate of the F6 RIL population of Linmai No. 2 / Zhong 892 and the wheat of the two genotypes in 166 natural varieties is counted respectively. The results show that the wheat variety of TT homozygous type (black kernel rate 18.6%) in the RIL population is 14.7% lower than the average of the black kernel rate of the wheat variety of CC homozygous type (black kernel rate 21.8%); the wheat variety of TT homozygous type (black kernel rate 22.2%) in the natural variety is 21.6% lower than the average of the black kernel rate of the wheat variety of CC homozygous type (black kernel rate 28.3%). The two population results have significant differences at the 0.05 level. The KASP primer developed in the present application can be used for molecular marker-assisted screening of the black kernel disease gene. The present application has important significance for breeding wheat varieties with enhanced black kernel disease resistance. BRIEF DESCRIPTION OF DRAWINGS
[0063] Figure 1 Figure 4 is the genotyping result of K-6A-109.9 on the RIL population of Linmai No. 2 / Zhong 892. Red is the genotype of Linmai No. 2 (CC), blue is the genotype of Zhong 892 (TT), pink is the detection failure, and green is the heterozygote (TC).
[0064] Figure 2 Figure 5 is the genotyping result of K-6A-109.9 on 166 wheat varieties. Red is the genotype of Linmai No. 2 (CC), blue is the genotype of Linmai No. 2 Zhong 892 (TT), pink is the detection failure, and green is the heterozygote (TC). DETAILED DESCRIPTION
[0065] The present application will be further described in detail below in conjunction with the specific embodiments. The examples provided below are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application.
[0066] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.
[0067] Lingmai 2: It is recorded in the article "Liu Zhengxue, Liu Fei, Li Baoqiang, Wang Jing, Zhu Xinliang, Wang Guixiang. (2005). Breeding and Cultivation Techniques of New Wheat Variety Lingmai 2 with High Yield. Chinese Agricultural Bulletin (06), 188-192". This variety is bred by the Linyi Academy of Agricultural Sciences by crossing the self-bred line Ling 90-15 with Lumaiz 23 through pedigree method. Lingmai 2 has the characteristics of good comprehensive agronomic traits, high yield potential, good stability, and wide adaptability.
[0068] Zhong 892: It is recorded in the article "Liu Jindong. Genetic Analysis of Black Kernel Resistance in Common Wheat. China Agricultural University, 2018". This variety is bred by the Crop Science Institute and the Cotton Research Institute of the Chinese Academy of Agricultural Sciences, with the F6 generation line of (786-11 (Ou Ruo / Beijing 8)) as the female parent and the F3 generation line of LK338 / 730-04 as the male parent. It has the advantages of high and stable yield, resistance to lodging, wide adaptability, high and stable thousand-grain weight.
[0069] Black kernel rate is the proportion of black kernel grains after wheat grain maturity, which is an index for evaluating black kernel disease resistance.
[0070] Example 1, Development and Polymorphism Detection of Anti-Black Kernel Disease Molecular Marker K-6A-109.9
[0071] I. Development of Molecular Marker K-6A-109.9
[0072] The inventors of the present application have conducted a large number of experiments, and by means of fine mapping, designed and synthesized a primer set suitable for identifying wheat black kernel disease resistance by allele competitive specific PCR at 109.9 Mb on wheat chromosome 6A. The KASP primer set consists of 3 primer sequences of upstream primer F1, upstream primer F2 and downstream primer R, which is used to amplify the target sequence including K-6A-109.9 site (SNP site).
[0073] Upstream primer F1: 5'-CTGCAGCAGTGTAGGCGA-3' (SEQ ID No. 1, the underlined part is specific fluorescent tag sequence FAM); GAAGGTGACCAAGTTCATGCT
[0074] Upstream primer F2: 5'-CTGCAGCAGTGTAGGCGG-3' (SEQ ID No. 2, the underlined part is specific fluorescent tag sequence HEX); GAAGGTCGGAGTCAACGGATT
[0075] Downstream primer R: 5'-GTCCTTGGATGCAGCCAAT-3' (SEQ ID No. 3).
[0076] K-6A-109.9 site is the nucleotide at position 37 from the 5' end of SEQ ID No. 4 (corresponding to the last base at the 3' end of the 3' end of the two upstream primers) in the wheat genome, which is T or C (indicated by Y in SEQ ID No. 4), and the genotype of this site can be TT homozygous, CC homozygous, and TC heterozygous.
[0077] SEQ ID No. 4: TCAGCAGCAGCTTTTCAGAACACGACGAAGCAAGTA[Y]CGCCTACACTGCTGCAGTTCCAGCAGCCTCAGAACA (Y is T / C).
[0078] Since genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules in reverse complement, the DNA molecule encoding protein is generally named as the sense DNA molecule; the DNA molecule reverse complementary to the sense DNA molecule is named as the antisense DNA molecule. The genotype of K-6A-109.9 site is the genotype of the sense DNA.
[0079] The upstream primer F1 is used to amplify the case where the nucleotide at the SNP site (antisense strand) on the wheat 6A chromosome is A (corresponding to the sense strand, the nucleotide at the SNP site is T); the upstream primer F2 is used to amplify the case where the nucleotide at the SNP site (antisense strand) on the wheat 6A chromosome is G (corresponding to the sense strand, the nucleotide at the SNP site is C); the downstream primer R is a universal primer.
[0080] The single-stranded DNA molecule shown in SEQ ID No. 1 and the single-stranded DNA molecule shown in SEQ ID No. 3 amplify the fragment of the SNP site (antisense strand) on the wheat 6A chromosome with A homozygous (corresponding to the sense strand, the genotype of the SNP site is T: T homozygous).
[0081] The single-stranded DNA molecule shown in SEQ ID No. 2 and the single-stranded DNA molecule shown in SEQ ID No. 3 amplify the fragment of the SNP site (antisense strand) on the wheat 3B chromosome with G homozygous (corresponding to the sense strand, the genotype of the SNP site is C: C homozygous).
[0082] The single-stranded DNA molecule shown in SEQ ID No. 1, the single-stranded DNA molecule shown in SEQ ID No. 2, and the single-stranded DNA molecule shown in SEQ ID No. 3 amplify the fragment of the SNP site (antisense strand) on the wheat 6A chromosome with A and G heterozygous (corresponding to the sense strand, the genotype of the SNP site is T: C heterozygous).
[0083] Detection of two polymorphisms
[0084] (I) Phenotypic identification of field resistance to black kernel of Limpingmai 2 / Middle 892
[0085] 1. Limpingmai 2 as the female parent, Middle 892 as the male parent, a RIL population containing 271 F6 lines was constructed by single seed descent method. Limpingmai 2 / Middle 892 RIL population of 271 F6 lines and their parents were planted in Anyang, Henan (2012-2013 and 2013-2014), Weixi, Anhui (2013-2014) and Qingshui, Gansu (2013-2014). Field planting used complete randomized block design, single row area, 3 times of repetition, row spacing 0.2 m, row length 1.5 m, 50 grains / row. During the whole growth period of wheat, field management was carried out according to the local conventional cultivation technology. After normal harvesting and threshing of wheat, 200 grains of each line in each repetition were randomly selected according to the unified standard (visible black-brown spots on the embryo of the grain), the number of black kernel grains was counted, and the black kernel rate was calculated, with three technical repetitions. Finally, the mean value of three biological repetitions was taken as the final black kernel rate of the line.
[0086] 2. After completing step 1, the Pearson correlation coefficient of black kernel rate (i.e. resistance to black kernel) was calculated by using international general SAS statistical software PROC CORR model, and PROC MIXED command was used for variance analysis. The results of variance analysis showed that there was a very significant difference in black kernel rate among different genes, the correlation coefficient of five environments was between 0.52-075, and the correlation was good, thus the effectiveness of the phenotype data was determined.
[0087] (II) Molecular identification of 271 wheat RIL populations
[0088] 1. CTAB method was used to extract genomic DNA from young leaves of 271 wheat germplasm resources. The quality and concentration of genomic DNA must meet the requirements of PCR, the standard is: agarose electrophoresis shows that the DNA band is single and has no obvious dispersion; the A260 / A280 ratio detected by ultraviolet spectrophotometer Nanodrop2100 (Thermo) is between 1.8-2.0 (DNA sample has no protein contamination), the A260 / A230 ratio is between 1.8-2.0 (DNA sample has low salt ion concentration), and there is no obvious light absorption at 270 nm (DNA sample has no phenol contamination); the concentration of wheat genomic DNA to be tested is 50-200 ng / μL.
[0089] 2. Competitive allele-specific PCR. Using the KASP primer set synthesized in step one as the template, PCR amplification was carried out to obtain the PCR amplification product.
[0090] Reaction system: 2.0 μl KASP 2x Master Mix (LGC, item number: 13448166), 0.048 μl KASP primer (3 primers mixed, total concentration 50 μM, the molar ratio of two upstream primers and one downstream primer is 2:2:5), 1.952 μl template DNA (50 ng / μl). Amplification uses 384-hole PCR instrument (BIO-RAD, S1000TM Thermal Cycler).
[0091] The reaction procedure is: 94℃ pre-denaturation, 15 min; 94℃ denaturation for 20 s, 61℃-55℃ (select touch down program, reduce 0.6℃ per cycle), 1 min, 10 cycles of amplification; 94℃ denaturation for 20 s, 55℃ 1 min, continue to amplify for 26 cycles.
[0092] 3. After completing step 2, when the PCR amplification product temperature drops below 40℃, the fluorescence value is read by scanning the FAM and HEX light beams of the enzyme marker (the FAM fluorescence tag sequence is observed and read at the excitation light 485 nm and the emission light 520 nm wavelength, and the HEX fluorescence tag sequence is observed and read at the excitation light 528 nm and the emission light 560 nm wavelength), and the genotype of the wheat based on K-6A-109.9 site is determined according to the fluorescence signal color. The specific judgment principle is as follows: if the wheat based on K-6A-109.9 site shows blue fluorescence signal, the genotype of the wheat based on K-6A-109.9 site is TT homozygous type, which is consistent with Zhong 892; if the wheat based on K-6A-109.9 site shows red fluorescence signal, the genotype of the wheat based on K-6A-109.9 site is CC homozygous type, which is consistent with Linmai No. 2; if the wheat based on K-6A-109.9 site shows green fluorescence signal, the genotype of the wheat based on K-6A-109.9 site is TC heterozygous type. The detection results are shown in Table 1. Figure 1 .
[0093] It should be noted that if the fluorescence signal is weak after PCR amplification, which affects data analysis, additional cycles (94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 5 cycles) can be added until the results are satisfactory.
[0094] III. Significance analysis
[0095] The average blackened embryo rate of the two genotypes of wheat in the F6 RIL population of Linmai 2 / Zhong 892 was counted respectively, and the t test was conducted by using the international general SAS9.2 statistical software PROC TTEST model. The statistical results are shown in Table 1. The results show that the blackened embryo rate of the wheat variety with TT homozygous type (18.6%) is reduced by 14.7% than the average value of the blackened embryo rate of the wheat variety with CC homozygous type (21.8%), and there is a significant difference at the level of 0.05 (Table 2).
[0096] Therefore, the genotype of K-6A-109.9 can be used to identify the resistance of wheat to blackened embryo disease, and the resistance of the wheat to be tested with the genotype of K-6A-109.9 in TT homozygous type is significantly higher than that of the wheat to be tested with the genotype in CC homozygous type.
[0097] Table 1, K-6A-109.9 detection results and blackened embryo rate of Linmai 2 / Zhong 892 RIL population
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108] Note: - represents missing phenotype data. The parent Linmai 2 is genotype CC, the parent Zhong 892 is genotype TT, the heterozygote is TC, and NN represents missing genotype.
[0109] Table 2, K-6A-109.9 detection results of Linmai 2 / Zhong 892 RIL population
[0110]
[0111] Example 2, correlation analysis and verification of resistance primer group and natural wheat variety resistance to blackened embryo disease
[0112] 1. Detection of the genotype of 166 wheat varieties based on K-6A-109.9 locus
[0113] According to the method in Example 1, the wheat to be detected was replaced by 166 varieties respectively, and other steps were unchanged, to obtain the genotype of 166 wheat varieties based on K-6A-109.9 locus. The detection results are shown in Table 3. Figure 2 .
[0114] 2. Detection of black kernel rate
[0115] The 166 wheat varieties in Huanghuai wheat region were planted in Anyang, Henan (2012-2013, 2013-2014 and 2014-2015) and Weixi, Anhui (2012-2013 and 2013-2014). All tests used randomized block design, 3 times of repetition, 3 rows of area, row length 2m, row spacing 25cm, 50 grains / row. Field management was carried out according to the local conventional management procedures, and black kernel resistance identification was carried out. After normal harvesting and threshing of wheat, 200 grains of each strain were randomly selected from each repetition, and the number of black kernel grains was counted according to the unified standard (there were visible black and brown spots on the embryo of the grain), and the black kernel rate was calculated, and the three technical repetitions were repeated. Finally, the average of the three biological repetitions was taken as the final black kernel rate of the strain.
[0116] 3. Association analysis
[0117] The average black kernel rate of wheat of two genotypes was counted respectively, and t test was carried out by using international general SAS9.2 statistical software PROCTTEST model. The statistical results are shown in Table 2. The results show that the average value of black kernel rate of wheat varieties of TT homozygous type (black kernel rate 22.2%) is reduced by 21.6% than that of CC homozygous type (black kernel rate 28.3%), and there is significant difference at 0.05 level (Table 3, Table 4).
[0118] Table 3, genotype detection results of 166 wheat varieties
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126] Note: TT: Zhong 892 genotype; CC: Linmai 2 genotype; TC: heterozygous genotype; NN: unidentified genotype, - represents the absence of phenotype.
[0127] Table 4, K-6A-109.9 detection of Linmai 2 / Zhong 892 RIL population results
[0128]
[0129] It can be seen that the genotype of K-6A-109.9 site can be used to identify the resistance of wheat to black smut, and the resistance of the wheat to be tested with the genotype of K-6A-109.9 site being TT homozygous is significantly higher than that of the wheat to be tested with the genotype of K-6A-109.9 site being CC homozygous.
[0130] The above results show that the resistance of wheat to black smut can be identified by detecting the genotype of the wheat to be tested based on the K-6A-109.9 site, and it has important application value in the process of molecular marker-assisted breeding of wheat.
[0131] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In short, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application.
Claims
1. Use of a substance for detecting single nucleotide polymorphism at a specific SNP site on a wheat genome in any one of the following: (A1) identifying or assisting in identifying the resistance to black smut of wheat; (A2) preparing a product for identifying or assisting in identifying the resistance to black smut of wheat; (A3) comparing the resistance to black smut of a wheat to be tested; (A4) preparing a product for comparing the resistance to black smut of a wheat to be tested; (A5) breeding a wheat single plant or strain or line or variety with relatively stronger resistance to black smut; (A6) preparing a product for breeding a wheat single plant or strain or line or variety with relatively stronger resistance to black smut; (A7) screening a wheat single plant with relatively weaker resistance to black smut; (A8) preparing a product for screening a wheat single plant with relatively weaker resistance to black smut; the specific SNP site is at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C; the resistance to black smut of a wheat to be tested with T:T genotype is stronger than or candidate stronger than that of a wheat to be tested with C:C genotype; the T:T genotype is a homozygous genotype with T at the specific SNP site on the wheat genome; the C:C genotype is a homozygous genotype with C at the specific SNP site on the wheat genome; the substance for detecting single nucleotide polymorphism at a specific SNP site on a wheat genome is a KASP primer; the KASP primer consists of primer 1, primer 2 and primer 3; the primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 1; the primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 2; and the primer 3 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 3 in the sequence listing.
2. A KASP primer for identifying or assisting in identifying the resistance to black smut of wheat, which consists of primer 1, primer 2 and primer 3; the primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 1 from 5' end to 3' end in the order of a fluorescent tag sequence A and positions 22-39 of SEQ ID No. 1; the primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 2 from 5' end to 3' end in the order of a fluorescent tag sequence B and positions 22-39 of SEQ ID No. 2; and the primer 3 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 3 in the sequence listing. the primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 1; and the primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No.
2.
3. A reagent for identifying or aiding in the identification of resistance to black smut of wheat, characterized in that: the reagent contains the KASP primer of claim 2.
4. Any one of the following methods: Method I: a method for comparing the resistance to black smut of a wheat to be tested, comprising the following steps: (D1) detecting the nucleotide at a specific SNP site on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, and determining the resistance of the wheat to be tested to black smut according to the genotype of the wheat to be tested as follows: the wheat to be tested with a T:T genotype has stronger resistance to black smut than the wheat to be tested with a C:C genotype; the specific SNP site is located at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C; the T:T genotype is a homozygous genotype in which the nucleotide at the specific SNP site on the genome of the wheat is T; the C:C genotype is a homozygous genotype in which the nucleotide at the specific SNP site on the genome of the wheat is C; Method II: a method for breeding a wheat single plant or strain or line or variety with relatively strong resistance to black smut, comprising the following steps: detecting the nucleotide at a specific SNP site on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, selecting the wheat to be tested with a T:T genotype as a parent for breeding, and selecting the wheat with a T:T genotype in each generation of breeding to finally obtain a wheat single plant or strain or line or variety with relatively strong resistance to black smut; the specific SNP site is located at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C; the T:T genotype is a homozygous genotype in which the nucleotide at the specific SNP site on the genome of the wheat is T; Method III: a method for screening and removing a wheat single plant with relatively weak resistance to black smut, comprising the following steps: detecting the nucleotide at a specific SNP site on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, and screening and removing the wheat to be tested with a C:C genotype; the specific SNP site is located at position 37 of SEQ ID No. 4 on the 6A chromosome of wheat, and the nucleotide at the SNP site is T or C; the C:C genotype is a homozygous genotype in which the nucleotide at the specific SNP site on the genome of the wheat is C.
5. The method of claim 4, wherein: The detection of the nucleotide at the specific SNP site on the genome of the wheat to be tested is performed by a method comprising the following steps: performing PCR amplification on the genomic DNA of the wheat to be tested by using the reagent of claim 3, performing fluorescence signal scanning on the amplified product, and then determining the genotype of the specific SNP site in the genome of the wheat to be tested as follows: if the fluorescence signal of the amplified product of the wheat to be tested is the signal corresponding to the fluorescent tag sequence A, then the wheat to be tested has a T:T genotype; if the fluorescence signal of the amplified product of the wheat to be tested is the signal corresponding to the fluorescent tag sequence B, then the wheat to be tested has a C:C genotype.