A kit for rapid detection of Fusarium sporeans, a pathogen of corn stalk rot, and its application and detection method

Abstract

The present invention discloses a kit and a detection method for rapidly detecting Fusarium, a pathogen of corn stalk rot, wherein the Cas protein is Cas12, and the kit includes RPA primers and crRNA, wherein the Fusarium includes Fusarium graminearum, and the RPA primers and crRNA of Fusarium graminearum are primer combinations FgraF2 / FgraR2 and Fg-crRNA, respectively. The present invention develops a field visualization rapid detection technology for corn stalk rot pathogens based on recombinase polymerase amplification technology combined with CRISPR / Cas12a for the widely distributed, highly isolated and highly pathogenic corn stalk rot pathogens. The technology can react at a constant temperature of 37-42°C without the need for complex instruments and equipment, and CRISPR / Cas12a can recognize and cut specific nucleic acid sequences, thereby further increasing the specificity and sensitivity of the detection on the basis of RPA.

Description

Technical Field

[0001] The invention relates to the technical field of molecular detection, and in particular to a kit capable of rapidly detecting Fusarium spores, a pathogen of corn stalk rot, and an application and detection method thereof. Background Art

[0002] Corn is the world's largest crop and one of my country's most important food crops. Corn stalk rot is a soil-borne disease that seriously threatens my country's corn production. Its incidence rate is 15% to 20% in normal years, and can reach more than 70% in severe cases. The yield loss caused by this disease is about 20%, and can reach more than 50% in severe cases. It has become an important factor affecting the lodging and grain loss of corn before mechanized harvesting in my country, and has an adverse impact on the country's construction of a food security system and the guarantee of regional corn safety production.

[0003] A large number of studies at home and abroad have shown that there are many types of pathogens that cause corn stalk rot. Currently, there are more than 30 known species. In my country, they are mainly divided into two categories: Pythium inflatum and Fusarium graminearum. It can be caused by single or combined infection of Fusarium, Pythium, and Colletotrichum, and there are differences in the pathogens of corn stalk rot in different regions. In 2017, He Juan et al. reported that Fusarium graminearum and F. verticillioides were the dominant species of corn stalk rot in Yunnan Province; in 2019, Liu Shusen et al. studied the stalk rot in the main summer corn producing areas of Huanghuaihai, and believed that the detection rate of F. verticillioides was the highest in Hebei Province, while F. proliferatum and P. aristosporum were the dominant species in Shandong Province; in the same year, Guo Cheng discovered that the F. graminearum species complex and F. verticillioides were the dominant pathogens of corn stalk rot in the four major ecological zones of Gansu Province.

[0004] From 2020 to 2021, Song Zishuo collected a total of 335 corn stalk rot samples in Xinjiang, and obtained a total of 601 isolates, including 560 strains of Fusarium, accounting for 93.18%. Among them, F. verticillioides, F. proliferatum, F. graminearum, F. oxysporum, and F. solani were the main dominant pathogens.

[0005] Recombinase polymerase amplification (RPA) is a new nucleic acid isothermal amplification technology developed by Piepenburg et al. in 2006 using protein recombination and repair involved in cell DNA synthesis. Unlike conventional PCR, which requires instruments for cyclic amplification, RPA operates at 37-42°C and requires only a small amount of sample preparation. It can amplify as few as 1-10 DNA copies within 10 minutes. It has the advantages of high sensitivity, selectivity, portability, rapidity, and the ability to perform multiple amplification. It has been widely used to amplify a variety of different targets, including RNA, miRNA, ssDNA, and dsDNA. The RPA reaction uses recombinase and oligonucleotide primers to form a protein-DNA complex, which can search for homologous sequences in double-stranded DNA. Once the homologous sequence is located, a strand displacement reaction occurs to form and initiate DNA synthesis, exponentially amplifying the target on the template. Single-stranded DNA binding (SSB) proteins bind to the displaced DNA strand and form a D-loop to prevent further replacement. The entire amplification reaction is rapid, starting from a few copies of the target DNA, and reaching detectable levels within a few minutes.

[0006] CRISPR (Clustered regularly interspaced short palindromic repeats, CRISPR) is an immune system derived from bacteria and archaea that recognizes and resists exogenous nucleic acids. Researchers have found that the Cas12 and Cas13 families have collateral cleavage capabilities (or cleavage in trans), that is, after the Cas protein-crRNA binary complex recognizes and binds to the substrate, it can not only cut the substrate, but also cut any substrate free in the environment. The principle of the molecular detection technology of CRISPR / Cas protein based on recombinase polymerase amplification (RPA) technology combined with clustered regularly interspaced short palindromic repeats and CRISPR associated protein systems (CRISPR associated enzyme systems, Cas proteins) is that the substrate DNA or RNA is first amplified by RPA or RT-RPA (Reverse transcription RPA) to increase the substrate concentration; then, the transcriptase transcribes the amplified DNA into RNA and mixes it with RNA endonuclease and crRNA reaction solution. When the Cas protein-crRNA complex recognizes the substrate RNA, cis-cutting and trans-cutting occur. Finally, a suitable detection method is selected according to the experimental requirements, such as electrophoresis, real-time fluorescence, colorimetry, etc. for detection and analysis.

[0007] There have been reports on the detection of Fusarium using RPA, but its specificity and sensitivity are limited. Currently, there are few reports on the detection of Fusarium using RPA combined with CRISPR / Cas. Summary of the invention

[0008] One of the purposes of the present invention is to provide a kit for rapidly detecting Fusarium, a pathogen of corn stalk rot, in order to solve the above problems. The Cas protein is Cas12, and the kit includes RPA primers and crRNA. The Fusarium includes Fusarium graminearum. The RPA primers and crRNA of Fusarium graminearum are primer combinations FgraF2 / FgraR2 and Fg-crRNA, respectively, and the sequences are as follows:

[0009] FgraF2:5'-GGGCGCTCATCATCACGTGTCAACCAGTC-3',

[0010] FgraR2: 5'-CCATGTTAGTATGAGAATGTGATGACAGCAGTG-3', Fg-crRNA: UAAUUUCUACUAAGUGUAGAUAGCUUGUCAAGAACCCAGGC.

[0011] Preferably, the Fusarium also includes Fusarium pseudoverticillium and / or Fusarium laminarum.

[0012] The RPA primers and crRNA of the pseudo-verticillium spores are primer combinations FverF1 / FverR1 and Fv-crRNA, respectively, and the sequences are as follows:

[0013] FverF1: 5'-GATTTCTCAAAGAAAACATGCTGACATCGC-3',

[0014] FverR1: 5'-AGCTCAGTGAGGTTGTGGAATGGGAGAGGGCAG-3', Fv-crRNA: UAAUUUCUACUAAGUGUAGAUCCCAUCGAUUCCCCCCUACGAC;

[0015] The RPA primers and crRNA of Fusarium spp. are primer combinations FproF2 / FproR3 and Fp-crRNA2, respectively, and the sequences are as follows:

[0016] FproF2:5'-CGCGTCCTCTGCCCACCGATTTCACTTG-3',

[0017] FproR3: 5'-AGCGCTTCCTATTGTCGAATGGTTAGTCG-3', Fp-crRNA2: UAAUUUCUACUAAGUGUAGAUGUCUCGAGCGGGGUAGCAGGC.

[0018] Preferably, the kit further comprises a signal reporter molecule, the sequence of which is: 5'-TTATTATT-3' or 5'-TTTTTTTTTT-3';

[0019] Preferably, the 5' end of the signal reporter molecule is labeled with a fluorescent reporter group, and the 3' end is labeled with a biotin affinity group, or the two ends of the signal reporter molecule respectively carry a fluorescent reporter group and a fluorescent quencher group for fluorescent signal detection, preferably the fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.

[0020] Preferably, the kit further comprises an RPA amplification reagent, and the RPA amplification reagent comprises: RPA enzyme and MgOAc.

[0021] Preferably, the kit further comprises a CRISPR / Cas detection reagent, wherein the CRISPR / Cas detection reagent comprises: cas12a protein, RNAse inhibitor, DTT,

[0022] The Cas12a protein is selected from AsCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a and BoCas12a,

[0023] Preferably, the cas12a protein is LbaCas12a.

[0024] Another object of the present invention is to provide the use of any of the above-mentioned kits in detecting Fusarium, wherein the Fusarium includes Fusarium spp.

[0025] Another object of the present invention is to provide a method for rapidly detecting Fusarium spores, the pathogen of corn stalk rot, using at least one primer combination in any of the above-mentioned kits, comprising the following steps:

[0026] S1, extracting DNA from the sample to be tested;

[0027] S2. RPA amplification: preparing an RPA reaction system, and amplifying the DNA of the sample to be tested obtained by the above extraction by the RPA method to obtain an amplified product;

[0028] S3, CRISPR / Cas system reaction detection: take the above amplified product, add signal reporter molecules, cas protein and crRNA, perform CRISPR reaction detection, read the detection signal, and obtain;

[0029] Preferably, the reaction system of the RPA amplification includes 28.5-30.5 μL Rehydration buffer, 10.5-12 μL ddH2O, 1-3 μL of each 10 μM upstream and downstream primers, RPA enzyme lyophilized powder, 1-3 μL template DNA, 1.5-3.5 μL MgOAc with a concentration of 280 μmol / L; preferably 29.5 μL Rehydration buffer, 11.2 μL ddH2O, 2.4 μL of each 10 μM upstream and downstream primers, RPA enzyme lyophilized powder, 2 μL template DNA, and 2.5 μL MgOAc with a concentration of 280 μmol / L;

[0030] The reaction conditions for RPA amplification are: 37-42°C for 10-30 min.

[0031] The last object of the present invention is to provide another detection method: a one-step detection method for rapidly detecting Fusarium spores, the pathogen of corn stalk rot, using at least one primer combination in any of the above-mentioned kits, comprising the following steps:

[0032] Extract the DNA of the sample to be tested as template DNA; add the template DNA and the RPA reaction system into a PCR tube, drop the CRISPR / Cas system reaction system into the inside of the tube cap of the PCR tube, cover the tube cap, place the PCR tube at the RPA reaction temperature for RPA amplification, then shake the PCR tube or briefly centrifuge to allow the CRISPR / Cas system reaction system solution in the tube cap to completely enter the RPA amplification product solution in the PCR tube, then place the PCR tube at the CRISPR / Cas system reaction temperature for reaction, and read the detection signal after the reaction is completed to obtain;

[0033] Preferably, in the one-step detection method, the RPA amplification reaction system includes 5.7-6.1 μL Rehydration buffer, 2.1-2.4 μL ddH2O, 0.2-0.6 μL of 10 μM upstream and downstream primers, RPA enzyme lyophilized powder, 0.2-0.6 μL template DNA, and 0.3-0.7 μL MgOAc with a concentration of 280 μmol / L.

[0034] In any of the above detection methods, the reaction system of the CRISPR / Cas system reaction includes: NEBuffer 1.5-2.5 μL, 5 μM LbaCas12a 0.8-1.2 μL, 40U / μL RNAse Inhibitor 0.4-0.6 μL, 0.1M DTT 0.4-0.6 μL, 10 μM signal reporter molecule 1.5-2.5 μL and 10 μM crRNA 0.8-1.2 μL;

[0035] The reaction conditions of the CRISPR / Cas system are: 37-42°C for 5-30 min;

[0036] The detection signal is read by using a real-time quantitative PCR instrument to read the fluorescence signal or by using a CRISPR / Cas test strip to determine the result.

[0037] The beneficial effects of the present invention are:

[0038] The present invention develops a rapid on-site visualization detection technology for corn stalk rot pathogens based on recombinase polymerase amplification technology combined with CRISPR and CRISPR-related protein system CRISPR / Cas12a for the widely distributed, highly isolated and highly pathogenic corn stalk rot pathogens. This technology can react at a constant temperature of 37-42°C without the need for complex instruments and equipment. CRISPR / Cas12a can recognize and cut specific nucleic acid sequences, thereby further increasing the specificity and sensitivity of the detection based on RPA. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Figure 1 is the electrophoresis detection result of RPA reaction products of RPA primers, wherein Figure A is the specific primer detection result of Fusarium oxysporum, Figure B is the specific primer detection result of Fusarium oxysporum, Figure C is the FgraF1 / FgraR1 RPA electrophoresis detection result, and Figure D is the specific primer detection result of Fusarium graminearum. In Figures AD, the lanes are from left to right: D2000 Marker, samples numbered 1-8 in Table 1.

[0040] Figure 2 This is the test strip test result of RPA-CRISPR / Cas12a of Fusarium oxysporum.

[0041] Figure 3 These are the test strip results for Fusarium RPA-CRISPR / Cas12a.

[0042] Figure 4 This is the test strip test result of Fusarium graminearum RPA-CRISPR / Cas12a.

[0043] Figure 5 Figure 1 is the sensitivity test result of the one-step RPA-CRISPR / Cas12a detection system when the total reaction time is 20 minutes. Figure A is the test result of Fusarium spp. The template concentrations on the test strips are 78.4 ng / μL, 7.84 ng / μL, 784 pg / μL, 78.4 pg / μL, 7.8 pg / μL, and 0.78 pg / μL from left to right. Figure B is the test result of Fusarium spp. , the template concentrations on the test strips are from left to right: 104.9ng / μL, 10.49ng / μL, 1.049ng / μL, 0.11ng / μL, 11pg / μL; Figure C is the detection result of Fusarium graminearum, and the template concentrations on the test strips are from left to right: 130.2ng / μL, 13.02ng / μL, 1.302ng / μL, 0.13ng / μL, 13pg / μL.

[0044] Figure 6 Figure 1 is the sensitivity test result of the one-step RPA-CRISPR / Cas12a detection system when the total reaction time is 30 minutes. Figure A is the test result of Fusarium spp., and the template concentrations on the test strip are from left to right: 78.4 ng / μL, 7.84 ng / μL, 784 pg / μL, 78.4 pg / μL, 7.8 pg / μL, 0.78 pg / μL, and 78 fg / μL; Figure B is the test result of Fusarium spp., and the template concentrations on the test strip are from left to right: 78.4 ng / μL, 7.84 ng / μL, 784 pg / μL, 78.4 pg / μL, 7.8 pg / μL, 0.78 pg / μL, and 78 fg / μL. The template concentrations from left to right are: 104.9ng / μL, 10.49ng / μL, 1.049ng / μL, 0.11ng / μL, 11pg / μL, 1.1pg / μL; Figure C is the detection result of Fusarium graminearum, and the template concentrations on the test strips are from left to right: 130.2ng / μL, 13.02ng / μL, 1.302ng / μL, 0.13ng / μL, 13pg / μL, 1.3pg / μL.

[0045] Figure 7Figure 1 is the sensitivity test result of the one-step RPA-CRISPR / Cas12a detection system when the total reaction time is 40 min. Figure A is the test result of Fusarium spp., and the template concentrations on the test strip are from left to right: 78.4 ng / μL, 7.84 ng / μL, 784 pg / μL, 78.4 pg / μL, 7.8 pg / μL, 0.78 pg / μL, 78 fg / μL, 7.8 fg / μL; Figure B is the test result of Fusarium spp., and the template concentrations on the test strip are from left to right: 1 04.9ng / μL, 10.49ng / μL, 1.049ng / μL, 0.11ng / μL, 11pg / μL, 1.1pg / μL, 0.11pg / μL, 11fg / μL; Figure C is the detection result of Fusarium graminearum. The template concentrations on the test strip are from left to right: 130.2ng / μL, 13.02ng / μL, 1.302ng / μL, 0.13ng / μL, 13pg / μL, 1.3pg / μL, 0.13pg / μL, 13fg / μL.

[0046] Figure 2-7 In the test strip, the upper band on the test strip is the test band, and the lower band is the quality control band. DETAILED DESCRIPTION

[0047] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0048] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0049] The sources of the strains used in the experiments in the present invention are shown in Table 1:

[0050] Table 1

[0051] Serial number Chinese name scientific name source 1 Pseudo-Verticillium Fusarium verticillioides Institute of Plant Protection, Xinjiang Academy of Agricultural Sciences 2 Pseudo-Verticillium Fusarium verticillioides Northwest Agriculture and Forestry University 3 Fusarium Fusarium proliferatum Institute of Plant Protection, Xinjiang Academy of Agricultural Sciences 4 Fusarium graminearum Fusarium graminearum Institute of Plant Protection, Xinjiang Academy of Agricultural Sciences 5 Fusarium graminearum Fusarium graminearum Northwest Agriculture and Forestry University 6 Fusarium spp. Fusariam culmorum Xinjiang Agricultural University 7 Fusarium fujikura Fusarium fujikuroi Xinjiang Agricultural University 8 Fusarium solani Fusarium solani Xinjiang Agricultural University

[0052] Example 1. Primer design, screening and establishment of RPA-CRISPR / Cas12a detection system

[0053] 1. Design of RPA primers and crRNA for target species

[0054] According to the translation elongation factor genes (TEF-1α) of target species (F. verticillioides, F. proliferatum and F. graminearum) and related species in GenBank, RPA primers and crRNA of target species were designed. In order to improve the specificity of primers and crRNA, different haplotype sequences of multiple target species and their related species were selected for sequence comparison analysis according to the relationship of Fusarium, and RPA specific primers and crRNA were artificially designed according to SNP sites. The TEF-1α gene sequences used for primer and crRNA design are shown in Table 2. Primers and crRNA were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0055] Table 2

[0056]

[0057]

[0058]

[0059] The species in Table 2 are all Fusarium species and are closely related species of the same genus. Among them, Fusarium verticillioides is a closely related species of the same monophyletic group as Fusarium oxysporum, Fusarium subglutinans, and Fusarium proliferatum; Fusarium graminearum is a closely related species of the same monophyletic group as Fusarium incarnatum, Fusarium equiseti, and Fusarium culmorum.

[0060] The DNAMAN software was used to perform multiple sequence alignment in Table 2, and the SNP sites of the TEF-1α gene of the target species and its closely related species were found. At the same time, the TEF-1α gene sequences of the strains of Fusarium pseudo-verticillium, Fusarium spp., and Fusarium graminearum preserved in this laboratory were detected to further confirm the correctness of the strains, and the RPA specific primers and crRNA were artificially designed using the measured TEF-1α gene sequences according to the SNP sites found. The TEF-1α gene sequences of Fusarium pseudo-verticillium, Fusarium spp., and Fusarium graminearum strains are shown in SEQ ID NO.1 to 3, respectively.

[0061] The sequences of the designed RPA-specific primers and crRNA are as follows:

[0062] 1. Fusarium pseudoverticulatum:

[0063] FverF1 (SEQ ID NO. 4): 5'-GATTTCTCAAAGAAAACATGCTGACATCGC-3', the primer design position is in the range of 112-141 bp.

[0064] FverF2 (SEQ ID NO.5): 5'-TCCTTCTATCGCGCGTTCTTTGCCCATCGATTC-3', the primer design position is in the range of 224-256 bp.

[0065] FverR1 (SEQ ID NO. 6): 5'-AGCTCAGTGAGGTTGTGGAATGGGAGAGGGCAG-3', the primer design position is in the range of 368-400 bp.

[0066] For the target sequence, crRNA is designed as follows. The target sequence binding region is underlined, and the bold marked part can bind to cas12a protein:

[0067] Fv-crRNA (SEQ ID NO.7):

[0068]

[0069] 2. Fusarium:

[0070] FproF1 (SEQ ID NO.8): 5'-GATCCTGACCAAGATCTGGCGGGGTACATCTTGG-3', the primer design position is in the range of 92-125 bp.

[0071] FproF2 (SEQ ID NO.9): 5'-CGCGTCCTCTGCCCACCGATTTCACTTG-3', the primer design position is in the range of 240-267 bp.

[0072] FproR1 (SEQ ID NO.10):

[0073] 5'-CACGTTTCGAATCGCAAGTGAAATCGGTGGGCAG-3', the primer design position was 248-281bp.

[0074] FproR2 (SEQ ID NO.11):

[0075] 5'-CGCTGCTTGACACGTGACAATGCGCTCATTGAGGTTGTGGAC-3', the primer design position was 387-428bp.

[0076] FproR3 (SEQ ID NO.12): 5'-AGCGGCTTCCTATTGTCGAATGGTTAGTCG-3', the primer design position is 427-456 bp interval.

[0077] For the target sequence, crRNA is designed as follows. The target sequence binding region is underlined, and the bold marked part can bind to cas12a protein:

[0078] Fp-crRNA1 (SEQ ID NO.13):

[0079]

[0080] Fp-crRNA2 (SEQ ID NO.14):

[0081]

[0082] 3. Fusarium graminearum:

[0083] FgraF1 (SEQ ID NO. 15): 5'-TGTGAGTACCACCGCATCCCAACCCCGCCGACAC-3', the primer design position is in the range of 56-89 bp.

[0084] FgraF2 (SEQ ID NO. 16): 5'-GGGCGCTCATCATCACGTGTCAACCAGTC-3', the primer design position is 403-431 bp interval.

[0085] FgraR1 (SEQ ID NO.17):

[0086] 5'-GACGACTGTCGCTCGAGTGGCAGGGTATGAGCCCCAACGG-3', the primer design position was 337-376bp.

[0087] FgraR2 (SEQ ID NO. 18): 5'-CCATGTTAGTATGAGAATGTGATGACAGCAGTG-3', the primer design position is 602-634 bp interval.

[0088] For the target sequence, crRNA is designed as follows. The target sequence binding region is underlined, and the bold marked part can bind to cas12a protein:

[0089] Fg-crRNA (SEQ ID NO.19):

[0090]

[0091] 2. Primer screening and establishment of RPA-CRISPR / Cas12a detection system

[0092] 1. DNA extraction

[0093] DNA was extracted from the test strains using a high-efficiency plant genomic DNA extraction kit (DP350) (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the DNA was accurately quantified using a Nanodrop ultra-micro spectrophotometer (Thermo Fisher Scientific).

[0094] 2. Primer screening

[0095] Adopt TwistDX (UK) Basic RPA kit (Cat. No.: TABAS03KIT) was used for RPA reaction. The reaction system was referred to the kit manual. The specific ratio was as follows: 29.5 μL Rehydration buffer, 11.2 μL ddH2O, and 2.4 μL of upstream and downstream primers (10 μM) were added to the RPA enzyme lyophilized powder. After the dry powder was dissolved, 2 μL template DNA was added. Finally, 2.5 μL MgOAc (280 μmol / L) was added. After mixing, it was placed in a metal bath and incubated at 39°C for 20 min. The RPA reaction product was mixed with Tris-saturated phenol / chloroform / isoamyl alcohol (25:24:1), centrifuged at 12000 rpm for 5 min, and 5 μL of the supernatant was taken for electrophoresis to detect the RPA product and screen for RPA primers with strong specificity.

[0096] The RPA reaction was performed on the strains in Table 1 according to the above steps using the primers designed previously:

[0097] The primer combinations FverF1 / FverR1 and FverF2 / FverR1 were used for RPA reaction of Fusarium pseudo-verticillium. Under the same conditions of template concentration, reaction time, primer concentration and other reagent concentrations, the amplified band of FverF2 / FverR1 was light in color, with low amplification efficiency and low sensitivity; while the amplified product of FverF1 / FverR1 had high brightness and obvious bands, indicating that the primer amplification efficiency was high and the sensitivity was high. Therefore, FverF1 / FverR1 was selected for subsequent experiments. FverF1 / FverR1 was used to perform RPA reaction on samples No. 1-8 in Table 1. Only Fusarium pseudo-verticillium amplified bands, indicating that FverF1 / FverR1 is specific to Fusarium pseudo-verticillium ( Figure 1 A).

[0098] The primer combinations FproF1 / FproR1, FproF1 / FproR2, and FproF2 / FproR3 were used for RPA reaction of Fusarium spp., and all three primer pairs amplified specific bands only for Fusarium spp. However, in the subsequent CRISPR / Cas cleavage experiments, it was found that the cleavage efficiency of FproF1 / FproR1 / Fp-crRNA1 and FproF1 / FproR2 / Fp-crRNA1 was low and the experimental results were unstable. Under the condition of the highest template concentration, the CRISPR / Cas cleavage system needed to react for more than 1 hour to show the detection band, while FproF2 / FproR3 / Fp-crRNA2 could show a clear detection band on the test strip after 10 minutes of cleavage. Therefore, FproF2 / FproR3 was determined to be used for subsequent experiments. FproF2 / FproR3 was used to perform RPA reaction on samples No. 1-8 in Table 1. Only bands of Fusarium spp. were amplified, indicating that FproF2 / FproR3 is specific to Fusarium spp. ( Figure 1 B).

[0099] The primer combinations FgraF1 / FgraR1 and FgraF2 / FgraR2 were used for RPA reaction of Fusarium graminearum. FgraF1 / FgraR1 amplified bands for Fusarium graminearum and Fusarium fujikura, and there were also amplified bands for other species ( Figure 1 C), its specificity is poor. When FgraF2 / FgraR2 was used to detect the 8 samples in Table 1, only a specific band was amplified for Fusarium graminearum ( Figure 1 D), while no bands were amplified for other species, indicating that FgraF2 / FgraR2 was specific to Fusarium graminearum. Finally, FgraF2 / FgraR2 was determined to be used for subsequent experiments.

[0100] After screening, the optimal primers and crRNA were determined for the three target species for subsequent experiments: FverF1 / FverR1 / Fv-crRNA was used for Fusarium solani, FproF2 / FproR3 / Fp-crRNA2 was used for Fusarium graminearum, and FgraF2 / FgraR2 / Fg-crRNA was used for Fusarium graminearum.

[0101] 3. Establishment of CRISPR / Cas12a detection system

[0102] The CRISPR / Cas12a detection system was developed by New England Biolabs (UK). LbaCas12a (Cpf1) nuclease and supporting reagents. Cas12 / 13-specific nucleic acid detection test strips (Beijing Baoying Tonghui Biotechnology Co., Ltd., China) were used for visual detection.

[0103] The CRISPR / Cas12a detection system of Fusarium verticillioides includes 12.2μLDEPC-H2O, 2μL NEBuffer, 0.4μL LbaCas12a (Cpf1) (5μM), 0.5μL RNAse Inhibitor (40U / μL), 0.5μL DTT (0.1M), 2μL reporter molecule (10μM), 0.4μL crRNA (10μM), 2μL RPA reaction product, mixed and placed in a metal bath, incubated at 37°C for 20min. After the reaction is completed, 80μL deionized water is added, mixed evenly, and the sample end of the test strip is immersed in the reaction solution to observe the strip. The sequence of the reporter molecule is 5'-FAM-TTATTATT-Biotin-3' or 5'-FAM-TTTTTTTTTT-Biotin-3' (SEQ ID NO. 20). Experimental verification shows that both of these reporter molecules can be applied in this embodiment.

[0104] The CRISPR / Cas12a detection system for Fusarium proliferatum and Fusarium graminearum includes 12.2μL DEPC-H2O, 2μL NEBuffer, 1μL LbaCas12a (Cpf1) (5μM), 0.5μL RNAse Inhibitor (40U / μL), 0.5μL DTT (0.1M), 2μL reporter molecule (FAM-TTATTATT-Biotin or FAM-TTTTTTTTTT-Biotin) (10μM), 1μL crRNA (10μM), 2μL RPA reaction product, mixed and placed in a metal bath, incubated at 37°C for 20min. After the reaction is completed, 80μL deionized water is added, mixed evenly, and the sample end of the test strip is immersed in the reaction solution to observe the strip.

[0105] The RPA-CRISPR / Cas12a detection system (FverF1 / FverR1 / Fv-crRNA) of Fusarium verticillioides was used to detect the 8 strains in Table 1. The test results of the test strips are as follows: Figure 2As shown, the test strips 1-8 from left to right represent the detection results of the strains numbered 1-8 in Table 1. It can be seen from the figure that only the Fusarium spp. with serial numbers 1 and 2 in Table 1 show detection bands (when the amplification and cutting efficiency are high, quality control bands usually do not appear), and the other strains do not show detection bands, indicating that the detection system is specific to Fusarium spp.

[0106] The 8 strains in Table 1 were tested using the Fusarium RPA-CRISPR / Cas12a detection system (FproF2 / FproR3 / Fp-crRNA2). The test results were as follows: Figure 3 As shown, the test strips 1-8 from left to right represent the detection results of the strains numbered 1-8 in Table 1. It can be seen from the figure that only the Fusarium spp. with number 3 in Table 1 shows a detection band, while the other strains do not show a detection band, indicating that the detection system is specific to Fusarium spp.

[0107] The RPA-CRISPR / Cas12a detection system (FgraF2 / FgraR2 / Fg-crRNA) of Fusarium graminearum was used to detect the 8 strains in Table 1. The test results of the test strips are as follows: Figure 4 As shown, the test strips 1-8 from left to right represent the detection results of the strains numbered 1-8 in Table 1. It can be seen from the figure that only the Fusarium graminearum with numbers 4 and 5 in Table 1 show detection bands, while the other strains do not show detection bands, indicating that the detection system is specific to Fusarium graminearum.

[0108] The above results show that only the target species has detection bands, and other control species have no detection bands, indicating that the specific primers and crRNA of the target species have good specificity for the detection of the target species.

[0109] The inventors also studied the different cutting times of CRISPR / Cas12a. When there is enough substrate, the target species can be detected by the test strip after cutting for 5 minutes. Using the RPA primers determined by the present invention, the target species can be detected by the test strip after cutting for 10 minutes.

[0110] Example 2, establishment and optimization of RPA-CRISPR / Cas12a detection system and sensitivity detection

[0111] The RPA-CRISPR / Cas12a detection system established in Example 1 was further optimized to make the entire reaction faster and more efficient while significantly reducing costs. A one-step RPA-CRISPR / Cas12a detection system was established. Compared with the method of adding the CRISPR / Cas12a detection system after RPA was completed, the one-step method saves operation and avoids contamination from opening the lid.

[0112] 1. One-step RPA-CRISPR / Cas12a detection system

[0113] (1) The one-step RPA-CRISPR / Cas12a detection system for Fusarium spp. is as follows:

[0114] 29.5 μL Rehydration buffer, 11.2 μL ddH2O, and 2.4 μL upstream and downstream primers (10 μM) were added to the RPA enzyme lyophilized powder, and after the dry powder was dissolved, it was divided into five equal parts in five PCR tubes, that is, the RPA reaction system was reduced to 1 / 5 of the RPA reaction system in Example 1, and 0.5 μL template DNA and 0.5 μL MgOAc (280 μmol / L) were added to the PCR tube; then the mixed Fusarium spp. cutting system was dropped on the PCR tube cap, and the cutting system on each PCR tube cap contained: 2 μL NEBuffer, 0.4 μL LbaCas12a (Cpf1) (5 μM), 0.5 μL RNAse Inhibitor (40 U / μL), 0.5 μL DTT (0.1 M), 2 μL reporter molecule (10 μM) and 0.4 μL crRNA (10 μM). Put the tube cap on, put the PCR tube in a metal bath, and incubate at 39°C for 10 to 30 minutes (RPA reaction time). Then shake the PCR tube manually or centrifuge briefly to completely mix the solution on the tube cap into the reaction solution. Then put the PCR tube in a metal bath and incubate at 39°C for 10 minutes (cutting time). After the reaction is completed, add 30 μL of deionized water, mix well, immerse the sample end of the test strip in the reaction solution, and observe the strip.

[0115] (2) The one-step RPA-CRISPR / Cas12a detection system for Fusarium spp. and Fusarium graminearum is as follows:

[0116] 29.5 μL Rehydration buffer, 11.2 μL ddH2O, and 2.4 μL upstream and downstream primers (10 μM) were added to the RPA enzyme lyophilized powder, and after the dry powder was dissolved, it was divided into five equal parts in five PCR tubes, that is, the RPA reaction system was reduced to 1 / 5 of the RPA reaction system in Example 1, and 0.5 μL template DNA and 0.5 μL MgOAc (280 μmol / L) were added to the PCR tube; then the mixed Fusarium spp. or Fusarium graminearum cutting system was dropped on the PCR tube cover, and the cutting system on each PCR tube cover contained: 2 μL NEBuffer, 1 μL LbaCas12a (Cpf1) (5 μM), 0.5 μL RNAse Inhibitor (40 U / μL), 0.5 μL DTT (0.1 M), 2 μL reporter molecule (10 μM) and 1 μL crRNA (10 μM). Put the tube cap on, put the PCR tube in a metal bath, and incubate at 39°C for 10 to 30 minutes (RPA reaction time). Then shake the PCR tube manually or centrifuge briefly to completely mix the solution on the tube cap with the reaction solution. Then put the PCR tube in a metal bath and incubate at 39°C for 10 minutes (cutting time). After the reaction is completed, add 30 μL of deionized water, mix well, immerse the sample end of the test strip in the reaction solution, and observe the strip.

[0117] 2. Sensitivity test

[0118] The template DNA of the target species (the template concentration of Fusarium spp. was 78.4 ng / μL, the template concentration of Fusarium spp. was 104.9 ng / μL, and the template concentration of Fusarium graminearum was 130.2 ng / μL) was diluted 10-fold. 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 A total of 8 concentrations were used, using the previously established one-step RPA-CRISPR / Cas12a detection system, with RPA reaction times of 10 min, 20 min, and 30 min, respectively, and the cleavage time of 10 min unchanged, to determine the detection sensitivity. Each concentration gradient was repeated 3 times.

[0119] Sensitivity test results are as follows Figure 5-7 As shown:

[0120] like Figure 5As shown, the total reaction time was within 20 min (RPA reaction 10 min, cutting 10 min), and the detection sensitivity of the Fusarium spp. RPA-CRISPR / Cas12a test strip was 7.8 pg / μL ( Figure 5 A) The detection sensitivity of Fusarium RPA-CRISPR / Cas12a test strip is 0.11ng / μL ( Figure 5 B) The sensitivity of the Fusarium graminearum RPA-CRISPR / Cas12a test strip is 0.13 ng / μL ( Figure 5 C).

[0121] like Figure 6 As shown, the total reaction time was within 30 min (RPA reaction 20 min, cutting 10 min), and the detection sensitivity of the Fusarium spp. RPA-CRISPR / Cas12a test strip was 0.78 pg / μL ( Figure 6 A) The detection sensitivity of Fusarium RPA-CRISPR / Cas12a test strip is 11pg / μL ( Figure 6 B) The sensitivity of the Fusarium graminearum RPA-CRISPR / Cas12a test strip is 13pg / μL ( Figure 6 C).

[0122] like Figure 7 As shown, the total reaction time was within 40 min (RPA reaction 30 min, cutting 10 min), and the detection sensitivity of the Fusarium spp. RPA-CRISPR / Cas12a test strip was 78 fg / μL ( Figure 7 A) The detection sensitivity of Fusarium RPA-CRISPR / Cas12a test strip is 0.11pg / μL ( Figure 7 B) The sensitivity of the RPA-CRISPR / Cas12a test strip for Fusarium graminearum is 0.13 pg / μL ( Figure 7 C).

[0123] Example 3: Application

[0124] DNA was crudely extracted from suspected corn stalk rot disease samples collected in the field, and the tissue of the diseased sample was added to a 1.5 mL centrifuge tube, 30 μL of buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0) was added to the tube, and the centrifuge tube was placed at 95 ° C for 5 min. The supernatant was taken as a DNA template, and the diseased sample was detected using the one-step RPA-CRISPR / Cas12a detection system established in Example 2, and the total reaction time was 20 min (RPA reaction 10 min, cutting 10 min). At the same time, the conventional separation and culture medium method of Fusarium was used to identify the pathogenic species.

[0125] A total of 5 samples were collected, and the test results of the one-step RPA-CRISPR / Cas12a test and the conventional pathogen isolation and culture identification method are shown in Table 3:

[0126] Table 3

[0127]

[0128] The one-step RPA-CRISPR / Cas12a method can detect Fusarium spp., Fusarium graminearum and Fusarium graminearum in field disease samples. The traditional isolation and culture method also isolates the three pathogens, and the detection results of the two methods for each sample are consistent. The one-step RPA-CRISPR / Cas12a detection method established in the present invention can realize on-site rapid detection of corn stalk rot pathogens in the field, and the results are accurate and reliable.

Claims

1. A kit for rapid detection of Fusarium sporeans, the pathogen of corn stalk rot, characterized in that: The Cas protein is Cas12a, the kit includes RPA primers and crRNA, and the kit includes RPA primers and crRNA primer combination FgraF2 / FgraR2, Fg-crRNA for detecting Fusarium graminearum, and the sequence is as follows: FgraF2: 5'-GGGCGCTCATCATCACGTGTCAACCAGTC-3', FgraR2: 5'-CCATGTTAGTATGAGAATGTGATGACAGCAGTG-3', Fg-crRNA:UAAUUUCUACUAAGUGUAGAUAGCUUGUCAAGAACCCAGGC.

2. The kit according to claim 1, characterized in that: The kit also comprises an RPA primer and a crRNA primer combination for detecting Fusarium pseudoverticillium and / or Fusarium spp. The RPA primers and crRNA primer combinations of the pseudo-verticillium spores are FverF1 / FverR1, Fv-crRNA, and their sequences are as follows: FverF1: 5'-GATTTCTCAAAGAAAACATGCTGACATCGC-3', FverR1: 5'-AGCTCAGTGAGGTTGTGGAATGGGAGAGGGCAG-3', Fv-crRNA: UAAUUUCUACUAAGUGUAGAUCCCAUCGAUUCCCCCCUACGAC; The RPA primers and crRNA primer combinations of Fusarium spp. are FproF2 / FproR3, Fp-crRNA2, and their sequences are as follows: FproF2: 5'-CGCGTCCTCTGCCCACCGATTTCACTTG-3', FproR3: 5'-AGCGGCTCCTATTGTCGAATGGTTAGTCG-3', Fp-crRNA2:UAAUUUCUACUAAGUGUAGAUGUCUCGAGCGGGGUAGCAGGC.

3. The kit according to claim 1, characterized in that: It also includes a signal reporter molecule, the sequence of which is: 5'-TTATTATT-3' or 5'-TTTTTTTTTT-3'.

4. The kit according to claim 3, characterized in that: The 5' end of the signal reporter molecule is labeled with a fluorescent reporter group, and the 3' end is labeled with a biotin affinity group, or the two ends of the signal reporter molecule are respectively provided with a fluorescent reporter group and a fluorescent quenching group for fluorescent signal detection.

5. The kit according to claim 1, characterized in that: Also included is an RPA amplification reagent, which contains: RPA enzyme and MgOAc.

6. The kit according to claim 1, characterized in that: It also includes a CRISPR / Cas detection reagent, which contains: Cas12a protein, RNAse inhibitor, DTT, The Cas12a protein is selected from AsCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a and BoCas12a.

7. Use of the kit according to any one of claims 1 to 6 in detecting Fusarium, characterized in that: The Fusarium includes Fusarium graminearum.

8. A method for rapidly detecting Fusarium spores, the pathogen of corn stalk rot, characterized in that: Using at least one primer combination in the kit according to any one of claims 1 to 6, the following steps are performed: S1, extracting DNA from the sample to be tested; S2. RPA amplification: preparing an RPA reaction system, and amplifying the DNA of the sample to be tested obtained by the above extraction by the RPA method to obtain an amplified product; S3. CRISPR / Cas system reaction detection: Take the above amplified product, add signal reporter molecules, Cas12a protein and crRNA, perform CRISPR reaction detection, and read the detection signal.

9. The method for rapidly detecting Fusarium spores, the pathogen of corn stalk rot according to claim 8, characterized in that: The RPA amplification reaction system includes 28.5-30.5 μL rehydration buffer, 10.5-12 μL ddH2O, 1-3 μL of 10 μM upstream and downstream primers, RPA enzyme lyophilized powder, 1-3 μL template DNA, and 1.5-3.5 μL MgOAc with a concentration of 280 μmol / L; The reaction conditions for RPA amplification are: 37-42°C for 10-30 min; The detection signal is read by using a real-time quantitative PCR instrument to read the fluorescence signal or by using a CRISPR / Cas test strip to determine the result.

10. A one-step detection method for rapidly detecting Fusarium spores, the pathogen of corn stalk rot, characterized in that: Detection using the kit according to any one of claims 1 to 6 comprises the following steps: Extract the DNA of the sample to be tested as template DNA; add the template DNA and the RPA reaction system into a PCR tube, drop the CRISPR / Cas system reaction system into the inside of the tube cap of the PCR tube, cover the tube cap, place the PCR tube at the RPA reaction temperature for RPA amplification, then shake the PCR tube or briefly centrifuge to allow the CRISPR / Cas system reaction system solution in the tube cap to completely enter the RPA amplification product solution in the PCR tube, then place the PCR tube at the CRISPR / Cas system reaction temperature for reaction, and read the detection signal after the reaction is completed.

11. The one-step detection method for rapidly detecting Fusarium spores, the pathogen of corn stalk rot according to claim 10, characterized in that: The RPA amplification reaction system includes 5.7~6.1 μL Rehydration buffer, 2.1~2.4 μL ddH2O, 0.2~0.6 μL of 10 μM upstream and downstream primers, RPA enzyme lyophilized powder, 0.2~0.6 μL template DNA, and 0.3~0.7 μL MgOAc with a concentration of 280 μmol / L.

12. The detection method according to claim 10 or 11, characterized in that: The reaction system of the CRISPR / Cas system reaction includes: NEBuffer 1.5~2.5 μL, 5 μM LbaCas12a0.8~1.2 μL, 40U / μL RNAse Inhibitor 0.4~0.6 μL, 0.1 M DTT 0.4~0.6 μL, 10 μM signal reporter molecule 1.5~2.5 μL and 10 μM crRNA 0.8~1.2 μL; The reaction conditions of the CRISPR / Cas system are: 37-42°C for 5-30 min; The detection signal is read by using a real-time quantitative PCR instrument to read the fluorescence signal or by using a CRISPR / Cas test strip to determine the result.

Images