A microsporidium of eriocheir sinensis mira primer, detection method and detection kit
By designing specific amplification primers and optimizing MIRA reaction conditions, and using simple equipment and reagent kits, a rapid and sensitive detection of *Microsporidium spp.* from the Chinese mitten crab was achieved, solving the problems of expensive equipment and long detection time in existing technologies.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NANJING NORMAL UNIVERSITY
- Filing Date
- 2023-09-21
- Publication Date
- 2026-04-24
AI Technical Summary
Existing methods for detecting microsporidia in Chinese mitten crabs require expensive instruments and equipment, are complex to operate, are difficult to apply widely in aquaculture sites, and have long detection times and insufficient sensitivity.
Specific amplification primers were designed and MIRA reaction conditions were optimized. A 37°C isothermal amplification technique was used, and detection was performed using simple equipment and kits.
It achieves detection within 25 minutes at 37℃, with a sensitivity of 1 copy/μL and a detection accuracy of 100%, making it suitable for rapid detection in aquaculture sites.
Smart Images

Figure CN117248063B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of aquaculture, specifically relating to a primer, detection method, and detection kit for the microsporidia MIRA of the Chinese mitten crab. Background Technology
[0002] The Chinese mitten crab (commonly known as the river crab) plays an important role in China's freshwater aquaculture industry, possessing high economic and nutritional value. However, the rapid and large-scale development of Chinese mitten crab farming has led to a sharp deterioration in aquatic environmental conditions, with diseases becoming increasingly frequent and severe. Among these, hepatopancreatic necrosis disease caused by microsporidia has resulted in significant losses in Chinese mitten crab farming. Microsporidia infecting Chinese mitten crabs was first discovered by Wang Wen during his research on trembling disease in the crab, who confirmed that microsporidia infection is essentially an opportunistic infection exploiting the weakened immune status of the host. In 2007, Wang Wen established a new... Endoreticulatus eriocheir The sp. nov. branch. Following this initial discovery, Stentiford et al. proposed forming a new genus ( Hepatospora The microsporidia in the hepatopancreas of the Chinese mitten crab were named... Hepatospora eriocheir .
[0003] Currently, various detection methods are available for microsporidia detection, including histopathological examination, microscopic examination, and molecular diagnostics using PCR. While physiological and biochemical methods combined with microscopic observation can provide preliminary identification of *Eriocheir sinensis* in *Eriocheir sinensis*, and the procedures are not difficult, they require a high level of operator skill and are not suitable for widespread application. Molecular detection methods such as PCR and RT-PCR generally require expensive equipment and cannot be used outside of laboratories. The MIRA detection technique for *Eriocheir sinensis* established in this experiment can complete the reaction in just 25 minutes at 37℃, with a detection limit of 1 copy / μL, higher than the conventional limit of 10. 4 The study achieved a detection limit of copies / μL, with an accuracy of 100% and good specificity. The results also indicate that the MIRA method for detecting *Microsporidium spp.* in *Eriocheir sinensis* is applicable to clinical sample testing. In summary, isothermal amplification technology enables rapid detection of *Microsporidium spp.* in *Eriocheir sinensis*, requiring short reaction times, low temperatures, and simple equipment. It is clinically applicable and can be used for rapid detection in the breeding field, eliminating the need for a laboratory setting. Therefore, the established MIRA method is a promising alternative for detecting *Microsporidium spp.* in *Eriocheir sinensis*. Summary of the Invention
[0004] To address the aforementioned issues, this invention designs and screens specific amplification primers based on the conserved sequence of the microsporidia fasciculata of the Chinese mitten crab. The screened specific amplification primers are then modified with markers, and the MIRA reaction conditions are optimized. The results show that MIRA can be detected at 37°C for 25 minutes.
[0005] To achieve the above objectives, the technical solution of the present invention is as follows:
[0006] This invention provides a detection kit for *Microsporidium MIRA* from the Chinese mitten crab, the kit comprising the following primers: *Microsporidium MIRA* primers from the Chinese mitten crab:
[0007] CHI4-17-F: TTTTTGTATTAAATGGGATATTCTGTAGGT, SEQ ID NO.1;
[0008] CHI4-223-R: AGGTACTCCATCATCCGCATCATCTTCATC, SEQ ID NO. 2.
[0009] Furthermore, the kit also includes MIRA mixed enzyme, buffer, Chinese mitten crab microsporidia DNA, sterile enzyme-free water, magnesium acetate, and extraction solution.
[0010] Furthermore, the reaction system of the reagent kit is as follows:
[0011] 14.7 μL of 2× MIRA mixed enzyme buffer (DNA isothermal rapid amplification kit from Weifang Anpu Future Biotechnology Co., Ltd.).
[0012] 1 μL of *Microsporidium spp.* from the Chinese mitten crab;
[0013] 6.05 μL of sterile, enzyme-free water;
[0014] 1 μL of 10 μmol / L forward primer;
[0015] 1 μL of 10 μmol / L reverse primer;
[0016] Magnesium acetate 1.25 μL.
[0017] This invention also provides a method for detecting *Microsporidium MIRA* in the Chinese mitten crab, wherein the method does not include methods for diagnosing and treating the disease, and is characterized by comprising the following steps:
[0018] (1) Take the required components out of the refrigerator, melt them at room temperature, and mix them by shaking.
[0019] (2) After completely melting and mixing, add 29.4 μL of MIRA mixed enzyme buffer to each enzyme dry powder reaction tube, invert and mix well, and then divide it into two equal portions of 14.7 μL each.
[0020] (3) Add 1 μL of upstream primer and 1 μL of downstream primer to each reaction tube, with the upstream primer and downstream primer concentrations being 10 μM respectively;
[0021] (4) Then add 6.05 μL ddH2O and 1 μL nucleic acid template in sequence;
[0022] (5) Finally, add 1.25 μL of magnesium acetate to the reaction tube and mix thoroughly (invert the reaction tube 8-10 times to mix).
[0023] (6) After mixing, the reaction solution is quickly centrifuged to the bottom of the tube, and then the reaction tube is immediately placed in a 37°C constant temperature device and incubated for 25 min.
[0024] (7) After the reaction is complete, add 75 μL of extraction buffer, mix the reaction solution, centrifuge at 12000 rpm for 5 min, and take 5 μL of supernatant for agarose gel electrophoresis detection.
[0025] Furthermore, the extraction solution comprises Tris-saturated phenol, chloroform, and isoamyl alcohol, with a volume ratio of 25:24:1.
[0026] This invention also provides primers for detecting *Microsporidium MIRA* from the Chinese mitten crab, the sequences of which are as follows: *Microsporidium MIRA* primers from the Chinese mitten crab:
[0027] CHI4-17-F: TTTTTGTATTAAATGGGATATTCTGTAGGT, SEQ ID NO.1;
[0028] CHI4-223-R: AGGTACTCCATCATCCGCATCATCTTCATC, SEQ ID NO. 2.
[0029] The beneficial effects of this invention are as follows:
[0030] Compared with existing methods for detecting microsporidia in Chinese mitten crabs, the MIRA detection technology has significant advantages, including no need for thermal cycling, short detection time, simple operation, high sensitivity, and simple equipment configuration.
[0031] Compared with conventional PCR detection, the MIRA detection technology for *Microsporidium* from *Eriocheir sinensis* established in this experiment can complete the reaction in just 30 minutes at 37℃, and the detection limit is 1 copy / μL, which is higher than the conventional limit of 10.4 The detection limit is set at copies / μL, with a detection accuracy of 100% and good specificity.
[0032] This invention requires no PCR instrument, has a short detection time, is easy to operate, has high sensitivity, and requires only simple equipment configuration. It can be completed by incubating at 37°C for 25 minutes. Attached Figure Description
[0033] Figure 1 MIRA primers for the microsporidia elegans of the Chinese mitten crab were screened. A: Agarose gel electrophoresis was performed using 9 sets of MIRA primers. B: Four sets of primers were screened and tested repeatedly. M: Trans2K DNA Marker; NC(-): negative control; PC(+): positive control.
[0034] Figure 2 Optimization of reaction conditions for MIRA of *Eriocheir sinensis* microsporidia; A: Optimization of reaction temperature; B: Optimization of reaction time; M: Trans2K DNA Marker;
[0035] Figure 3 To ensure the specificity of the MIRA detection method for *Eriocheir sinensis* microsporidia, M: Trans2K DNA Marker; Lanes 1-8: Negative control, *Bacillus subtilis*, *Bacillus thuringiensis*, *Staphylococcus aureus*, *Escherichia coli*, *Aeromonas hydrophila*, *Salmonella*, *Eriocheir sinensis* microsporidia;
[0036] Figure 4 To compare the sensitivity of MIRA and PCR detection methods for *Microsporidium sinense* from *Eriocheir sinensis*; A: MIRA detection; B: PCR detection; M: Trans2K DNA Marker; template concentrations in lanes 1-9 were 10... 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL;
[0037] Figure 5 The detection of microsporidia elegans from the Chinese mitten crab using MIRA and PCR methods on clinical samples; A: PCR detection; B: MIRA detection; M: Trans2K DNA Marker; lanes 1-23: different samples as templates. Detailed Implementation
[0038] The present invention will be further illustrated below with reference to the accompanying drawings and specific embodiments. It should be understood that the following specific embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Example 1
[0039] Primer synthesis and screening
[0040] Based on the conserved sequence of *Microsporidium sinense* from *Eriocheir sinensis*, and following the MIRA primer design principles: using 30-35 bp primers with no secondary structure, amplifying fragments of 150-300 bp, and designing 9 primer pairs using Oligo6 software. Two primer sets with good amplification effects, 17F / 223R and 160F / 432R, were then selected. To ensure experimental accuracy, four primer sets with good amplification effects (17F / 223R, 278F / 416R, 160F / 432R, and 280F / 432R) were re-validated to find the primers with the best amplification effect. The negative control was a sample containing healthy *Eriocheir sinensis* (PCR negative), and the positive control was a sample containing *Eriocheir sinensis* that tested positive for PCR. The screening of *Eriocheir sinensis* microsporidium MIRA primers is as follows: Figure 1 As shown in Table 1; A: Agarose gel electrophoresis using 9 sets of MIRA primers; B: Screening of 4 sets of primers for repeated detection, M: Trans2K DNA Marker; NC(-): negative control; PC(+): positive control. Ultimately, primer 17F / 223R for the CHI4 gene was considered the most suitable primer for MIRA detection of *Microsporidium chinense* from *Eriocheir sinensis* (as shown in Table 1), with an amplification length of 238 bp. Subsequent experiments were all performed using 17F / 223R as primers.
[0041] Table 1 Primers for the microsporidia MIRA of the Chinese mitten crab
[0042] Primers Sequence (5'-3') CHI4-17-F TTTTTGTATTAAATGGGATATTCTGTAGGT CHI4-223-R AGGTACTCCATCATCCGCATCATCTTCATC Example 2
[0043] Establishment of MIRA reaction system
[0044] To prepare a 25 μL MIRA reaction system, add 29.4 μL of MIRA rehydration buffer (A Buffer) (Weifang Anpu Future Biotechnology Co., Ltd. DNA Isothermal Rapid Amplification Kit (Basic Type), WLB8201KIT) to a lyophilized mixed enzyme (Weifang Anpu Future Biotechnology Co., Ltd.). Divide the mixture into two equal portions. Add 1 μL of total DNA extracted from the hepatopancreatic tissue of *Eriocheir sinensis* (TransGen Biotech, catalog number EE101-01) using a commercial nucleic acid extraction kit to each portion, along with 6.05 μL of sterile, enzyme-free water, 1 μL of 10 μmol / L forward primer, 1 μL of 10 μmol / L reverse primer, and 1.25 μL of magnesium acetate (B Buffer). Mix the mixture thoroughly, centrifuge the reaction solution rapidly to the bottom of the tube, and immediately place the reaction tube in an incubator for incubation. MIRA products were extracted with Tris saturated phenol:chloroform:isopropanol (volume ratio 25:24:1) and then analyzed by 2% agarose gel electrophoresis.
[0045] Optimization of reaction temperature
[0046] Using the selected optimal MIRA primers, MIRA reactions were performed at 25℃, 30℃, 35℃, 37℃, 40℃, and 45℃ for 30 min. After the reaction, the results were analyzed based on agarose gel electrophoresis and flow chromatography test strips (e.g., Figure 2 (Figure A in the figure) In the MIRA reaction, bands were present at temperatures ranging from 25 to 45°C, but the bands were brightest at 37°C, thus determining that the optimal reaction temperature for MIRA is 37°C.
[0047] Response time optimization
[0048] Using the selected optimal MIRA primers, reactions were performed at 37°C for 1 min, 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, and 40 min, respectively. After the reaction, the results were detected by agarose gel electrophoresis (e.g., Figure 2 (Figure B in the figure) The results show that bands were present in the MIRA reaction from 5 to 40 min, with the best detection effect at a reaction time of 25 min. Example 3
[0049] Specificity and sensitivity of MIRA detection of Microsporidium monnieri from Eriocheir sinensis
[0050] Using the optimal primers and reaction conditions, DNA was extracted from three Gram-positive bacteria (Bacillus subtilis, Bacillus thuringiensis, and Staphylococcus aureus), three Gram-negative bacteria (Escherichia coli, Aeromonas hydrophila, and Salmonella), and *Microsporidium spp.* from *Eriocheir sinensis* as templates. A blank control using sterile water as a template was also included for MIRA detection. The results showed that only when *Eriocheir sinensis* snail DNA was used as a template did the detection result show a specific band; other samples did not produce bands, indicating that the established MIRA detection method for *Eriocheir sinensis* microsporidia has good specificity. Furthermore, the extracted *Eriocheir sinensis* microsporidia sample DNA was diluted 10-fold in a 10-fold concentration gradient to obtain 10... 8 -10 0 Nine concentration gradients (copies / μL) were used for PCR (35 cycles of PCR reaction: 98°C pre-denaturation for 30 s; 98°C for 10 s, 60°C for 5 s, 72°C for 30 s, followed by a 72°C extension for 1 min) and MIRA assay. The results are as follows. Figure 3 and Figure 4 As shown, the detection limit of the PCR method is 10. 4 The detection limit for MIRA was found to be 1 copy / μL. This indicates that the sensitivity of the MIRA detection method is the same as, and much higher than, that of conventional PCR. Example 4
[0051] Practical Applications
[0052] To assess the clinical applicability of the MIRA detection method for *Microsporidium sinense* from *Eriocheir sinensis*, 23 clinical samples were randomly selected. Using the optimized MIRA system and reaction conditions from Example 2, extracted DNA was subjected to PCR (35 cycles of PCR reaction: 98°C pre-denaturation for 30 s; 98°C for 10 s, 60°C for 5 s, 72°C for 30 s, followed by a 72°C extension for 1 min) and MIRA detection. The results are as follows: Figure 5 As shown, 15 samples tested positive for MIRA, and the PCR results were identical to those of MIRA. In conclusion, the MIRA and PCR results for *Microsporidium* in *Eriocheir sinensis* are highly consistent and can be used for clinical testing.
[0053] In summary, our established MIRA detection method has significant advantages such as no need for thermal cycling, short detection time, simple operation, high sensitivity, and simple equipment configuration, making it suitable for rapid detection of microsporidia in Chinese mitten crabs in both aquaculture sites and the wild.
[0054] It should be noted that the above content merely illustrates the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. For those skilled in the art, various improvements and modifications can be made without departing from the principle of the present invention, and all such improvements and modifications fall within the scope of protection of the claims of the present invention.
Claims
1. A detection kit for *Microsporidium MIRA* in the Chinese mitten crab, characterized in that, The kit includes the following primers: MIRA primers for *Eriocheir sinensis* microsporidia: CHI4-17-F: TTTTTGTATTAAATGGGATATTCTGTAGGT, SEQ ID NO.1; CHI4-223-R: AGGTACTCCATCATCCGCATCATCTTCATC, SEQ ID NO.2; The kit also includes MIRA mixed enzyme, buffer, Chinese mitten crab microsporidia DNA, sterile enzyme-free water, magnesium acetate and extraction solution; The reaction system of the kit is as follows: 14.7 μL of 2× MIRA mixed enzyme buffer; 1 μL of *Microsporidium spp.* from the Chinese mitten crab; 6.05 μL of sterile, enzyme-free water; 1 μL of 10 μmol / L forward primer; 1 μL of 10 μmol / L reverse primer; Magnesium acetate 1.25 μL; The extraction solution includes Tris-saturated phenol, chloroform, and isoamyl alcohol, with a volume ratio of 25:24:1.
Citation Information
Patent Citations
Eriocheir sinensis spiroplasma MIRA and MIRA-LFD detection method and application thereof
CN116219045A