Molecular marker QNRT.caas-5D for total root tip number in wheat and its application

By developing the KASP marker Kasp-Kukri_c46526_103 on the wheat 5D chromosome, nucleotide polymorphism was detected, and the problem of difficulty in screening the total root tips in wheat breeding was solved, achieving a breeding effect of high yield and stable yield.

CN117248065BActive Publication Date: 2025-08-26INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311249018.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-26
Publication Date
2025-08-26
Estimated Expiration
2043-09-26

AI Technical Summary

Technical Problem

It is difficult to efficiently screen and select the correlation traits of the total root apical number of roots in existing wheat breeding, resulting in unstable yield under abiotic stress.

Method used

KASP markers of specific SNP sites on wheat 5D chromosomes were developed (Kasp-Kukri_c46526_103), and wheat varieties with a large number of total root tips were screened or bred by detecting nucleotide polymorphism identification and assisted selection.

Benefits of technology

The total number of root tips in wheat has been significantly improved, the growth and development ability of wheat under water and nutrient deficiency conditions has been improved, and the breeding goal of high yield and stable yield has been achieved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117248065B_ABST
    Figure CN117248065B_ABST
Patent Text Reader

Abstract

The present invention discloses a molecular marker for wheat total root tip number QNRT.caas-5D and its application. The present invention provides the use of a single nucleotide polymorphism at a specific SNP site on the wheat genome as a marker for identifying or assisting in the identification of wheat total root tip number; the specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at this SNP site is T or C. This invention is of great significance for breeding wheat varieties with a higher total root tip number (higher and more stable yields).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a molecular marker of wheat total root tip number QNRT.caas-5D and an application thereof. Background Art

[0002] Common wheat ( Triticum aestivum Wheat (L.) is one of the world's most important staple crops. Wheat production is significantly limited by various abiotic stresses, making the selection of high-yielding and stable varieties under these conditions a key goal in wheat breeding. The root system is not only crucial for absorbing nutrients and water from the soil but also for tolerance to environmental stresses. Root architectural characteristics define root shape and play a crucial role in plant growth and development, particularly under conditions of water and nutrient deficiency (Paez Garcia et al., 2015). Root morphology encompasses multiple traits, including root length, root surface area, number of root tips, and root diameter (Maccaferri et al., 2016). Root tip number is significantly correlated with nutrient and water uptake (Maccaferri et al., 2016). Due to the difficulty of high-throughput phenotyping of root structure-related traits under field conditions, traditional breeding has largely focused on aboveground traits, particularly harvest index, disease resistance, and plant height, while neglecting the optimization of root structure-related traits. The total number of root tips in wheat is controlled by microgenes and significantly influenced by environmental conditions. Discovering the genes controlling the total root tip number of wheat root system and developing usable KASP markers are of great significance for breeding high and stable yield wheat.

[0003] KASP markers have been widely used to detect SNPs in crops such as wheat, rice, and corn, enabling high-throughput genotyping. Using genotype data from wheat SNP arrays for QTL mapping and genome-wide association analysis, linked SNPs can be converted into KASP markers for direct application in marker-assisted selection breeding. Summary of the Invention

[0004] The present invention aims to provide a method for determining the total root tip number of wheat. QNRT.caas-5DL Molecular markers and their applications.

[0005] In the first aspect, the present invention claims protection for the use of a single nucleotide polymorphism at a specific SNP site on the wheat genome as a marker in any of the following:

[0006] (A1) Identify or assist in identifying the total number of root tips in wheat;

[0007] (A2) Preparation of products for identifying or assisting in identifying the total root tip number of wheat;

[0008] (A3) Compare the total number of root tips of the wheat to be tested;

[0009] (A4) preparing a product for comparing the total number of root tips of the wheat to be tested;

[0010] (A5) Breeding wheat plants, lines, varieties, or cultivars with a relatively large number of total root tips;

[0011] (A6) preparing a product for breeding wheat plants, lines, varieties or cultivars with a relatively large number of total root tips;

[0012] (A7) Screening and eliminating wheat plants with relatively few total root tips;

[0013] (A8) preparing a product for screening and removing wheat plants with relatively few total root tips;

[0014] The specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at the SNP site is T or C. The specific SNP site corresponds to the physical position 454111247 bp of the wheat reference genome Chinese Spring RefSeq v1.0 (https: / / urgi.versailles.inra.fr / blast_iwgsc / ) (the same below).

[0015] In a second aspect, the present invention claims the use of a substance for detecting single nucleotide polymorphisms at specific SNP sites on the wheat genome in any of the following:

[0016] (A1) Identify or assist in identifying the total number of root tips in wheat;

[0017] (A2) Preparation of products for identifying or assisting in identifying the total root tip number of wheat;

[0018] (A3) Compare the total number of root tips of the wheat to be tested;

[0019] (A4) preparing a product for comparing the total number of root tips of the wheat to be tested;

[0020] (A5) Breeding wheat plants, lines, varieties, or cultivars with a relatively large number of total root tips;

[0021] (A6) preparing a product for breeding wheat plants, lines, varieties or varieties with a relatively large number of total root tips;

[0022] (A7) Screening and eliminating wheat plants with relatively few total root tips;

[0023] (A8) preparing a product for screening and removing wheat plants with relatively few total root tips;

[0024] The specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at the SNP site is T or C.

[0025] The substance used to detect the single nucleotide polymorphism of the specific SNP site on the wheat genome may be the KASP primer described in the third aspect below or the reagent or kit described in the fourth aspect below.

[0026] In a third aspect, the present invention claims KASP primers for identifying or assisting in identifying the total root tip number of wheat.

[0027] The KASP primers claimed in the present invention for identifying or assisting in identifying the total root tip number of wheat are composed of primer 1, primer 2 and primer 3; the primer 1 is a single-stranded DNA having a fluorescent tag sequence A and positions 22 to 45 of SEQ ID No. 1 from the 5' end to the 3' end; the primer 2 is a single-stranded DNA having a fluorescent tag sequence B and positions 22 to 45 of SEQ ID No. 2 from the 5' end to the 3' end; and the primer 3 is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID No. 3 in the sequence listing.

[0028] Wherein, the fluorescent tag sequence A is the fluorescent tag sequence FAM, and its nucleotide sequence is the 1st to 21st positions of SEQ ID No.1; the fluorescent tag sequence B is the fluorescent tag sequence HEX, and its nucleotide sequence is the 1st to 21st positions of SEQ ID No.2.

[0029] Furthermore, the primer 1 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 1; the primer 2 is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 2.

[0030] In a fourth aspect, the present invention claims protection for a reagent or kit for identifying or assisting in identifying the total root tip number of wheat.

[0031] The kit claimed in the present invention contains the reagents; the reagents contain the KASP primers described in the third aspect above.

[0032] In a fifth aspect, the present invention claims protection for a specific DNA molecule.

[0033] The specific DNA molecule claimed in the present invention is shown in SEQ ID No. 4, wherein Y at position 37 of SEQ ID No. 4 is T or C.

[0034] In a sixth aspect, the present invention claims the use of the KASP primer described in the third aspect above, or the reagent or kit described in the fourth aspect above, or the specific DNA molecule described in the fifth aspect above in any of the following:

[0035] (A1) Identify or assist in identifying the total number of root tips in wheat;

[0036] (A2) Preparation of products for identifying or assisting in identifying the total root tip number of wheat;

[0037] (A3) Compare the total number of root tips of the wheat to be tested;

[0038] (A4) preparing a product for comparing the total number of root tips of the wheat to be tested;

[0039] (A5) Breeding wheat plants, lines, varieties, or cultivars with a relatively large number of total root tips;

[0040] (A6) preparing a product for breeding wheat plants, lines, varieties or varieties with a relatively large number of total root tips;

[0041] (A7) Screening and eliminating wheat plants with relatively few total root tips;

[0042] (A8) preparing a product for screening and removing wheat plants with relatively few total root tips;

[0043] (A9) Wheat breeding.

[0044] In (A9), the breeding objective is to obtain wheat varieties with a greater total number of root tips (higher yield, more stable yield).

[0045] In a seventh aspect, the present invention claims protection for any one of the following methods:

[0046] Method I: A method for comparing the total number of root tips of wheat to be tested, comprising the following steps:

[0047] (D1) detecting nucleotides at a specific SNP site on the genome of the wheat to be tested to determine the genotype of the wheat to be tested, and determining the total root tip number of the wheat to be tested according to the genotype of the wheat to be tested as follows: the total root tip number of the wheat to be tested with a C:C genotype is greater than or is more than the total root tip number of the wheat to be tested with a T:T genotype;

[0048] The specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at the SNP site is T or C;

[0049] The T:T genotype is a homozygous type in which the nucleotide at the specific SNP site on the wheat genome is T;

[0050] The C:C genotype is a homozygous type in which the nucleotide at the specific SNP site on the wheat genome is C.

[0051] Method II: A method for breeding wheat plants, lines, strains, or varieties with a relatively large number of total root tips, comprising the following steps:

[0052] Detecting nucleotides at specific SNP sites on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, selecting the wheat to be tested with a C:C genotype as a parent for breeding, and selecting wheat with a C:C genotype in each breeding generation, ultimately obtaining wheat plants, lines, varieties, or varieties with a relatively large total number of root tips;

[0053] The specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at the SNP site is T or C;

[0054] The C:C genotype is a homozygous type in which the nucleotide at the specific SNP site on the wheat genome is C.

[0055] Method III: A method for screening and eliminating wheat plants with relatively few total root tips, comprising the following steps:

[0056] Detecting the nucleotides at a specific SNP site on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, and screening out the wheat to be tested with a T:T genotype;

[0057] The specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at the SNP site is T or C;

[0058] The T:T genotype is a homozygous type in which the nucleotide at the specific SNP site on the wheat genome is T.

[0059] In the above method, the detection of the nucleotide at the specific SNP site on the genome of the wheat to be tested can be completed by direct sequencing, or it can be carried out according to a method comprising the following steps: using the reagent or kit described in the fourth aspect above to perform PCR amplification on the genomic DNA of the wheat to be tested, scanning the amplified product for fluorescence signals, and then determining the genotype of the specific SNP site in the genome of the wheat to be tested as follows: if the fluorescence signal of the amplified product of the wheat to be tested is the signal corresponding to the fluorescent label sequence A, then the wheat to be tested is a T:T genotype; if the fluorescence signal of the amplified product of the wheat to be tested is the signal corresponding to the fluorescent label sequence B, then the wheat to be tested is a C:C genotype.

[0060] In the present invention, the wheat can be selected from the hybrid offspring of Doumai and Shi 4185 or the 165 wheat materials in Table 2.

[0061] The present invention used Doumai and Shi 4185 to construct a recombinant inbred line (RIL) population consisting of 262 families. This study used a genetic map constructed with a 90K chip to conduct QTL analysis of root tip number in this RIL population and detected a QTL that was stable under multiple environmental conditions. It was located on chromosome 5DL and flanked by markers. IAAV6218 and Kukri_c46526_103 , with a physical range of 449.6-454.1 Mb; it can explain 10.16% of the phenotypic variation and is tentatively named QNRT.caas-5DL , and its closely linked KASP marker Kasp-Kukri_c46526_103 (Position 37 of SEQ ID No. 4 on wheat chromosome 5D is T or C) can be used for molecular marker-assisted breeding. Statistics of the average total root tip number of wheat varieties with TT and CC genotypes from 165 natural varieties showed that CC homozygous wheat varieties (total root tip number 226.7) had significantly higher total root tip number than TT homozygous wheat varieties (total root tip number 172.5). This invention is of great significance for breeding wheat varieties with a higher total root tip number (higher and more stable yields). BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Positioning of Doumai×Shi 4185 RIL population QNRT.caas-5DL curve chart.

[0063] Figure 2 for Kasp-Kukri_c46526_103 Genotyping results of 165 wheat varieties (red indicates Shi 4185 genotype CC, blue indicates Doumai genotype TT, green indicates heterozygous TC, and pink indicates test failure). DETAILED DESCRIPTION

[0064] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0065] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0066] Soybean and wheat: recorded in the article "Dong Yan. Cloning, functional marker development and association analysis of the wheat stem water-soluble carbohydrate synthesis gene TaSST[D]. Chinese Academy of Agricultural Sciences, 2016." The public can obtain it from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0067] Stone 4185: recorded in the article "Dong Yan. Cloning, functional marker development and association analysis of the wheat stem water-soluble carbohydrate synthesis gene TaSST[D]. Chinese Academy of Agricultural Sciences, 2016." The public can obtain it from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0068] Example 1: Molecular marker of wheat total root tip number QNRT.caas-5D and its application

[0069] 1. Phenotypic testing

[0070] For the RIL population of Doumai / Shi 4185, plump, uniformly sized wheat seeds were selected, soaked in 10% H₂O solution for 10 minutes, rinsed three times with deionized water, and then cultured on moist filter paper at 25°C. Seedlings of uniform growth at the one-leaf, one-heart stage were transferred to Hoagland medium (16 h light / 8 h dark, 22-25°C) and continued to be cultured, with the nutrient solution changed every three days. After 21 days, the roots were rinsed with deionized water, and the roots and aerial parts were cut at the nodes, placed in ziplock bags, and temporarily stored in a refrigerator at 4°C. The roots were placed in a transparent root tray filled with deionized water and scanned using a WinRHIZOLA6400XL (Epson) large-format root scanner. The total root tip number of each sample was analyzed using WinRHIZO Pro software.

[0071] 2. Construction of linkage map

[0072] Genomic DNA from young leaves of 262 families was extracted using the CTAB method. DNA concentration was measured using a NanoDrop 2000c spectrophotometer, and DNA samples were adjusted to a standard concentration of 50 ng / μl. DNA quality was then tested on a 0.8% agarose gel. DNA of acceptable quality was used for SNP typing. SNP analysis was performed using a 90K SNP array developed in collaboration between the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and Affymetrix Axiom.

[0073] The 90K SNP array contains 80,547 markers, 11,526 of which differ between the parents. After removing markers with heterozygous or deletion rates greater than 10% between the parents, 10,631 markers remained. Using the bin function in IciMapping 4.1 to remove redundant markers, 9,354 markers remained. Markers were then grouped based on their genetic distances and chromosomal locations, resulting in 34 linkage groups containing a total of 1,507 markers.

[0074] 3. QTL Analysis

[0075] QTL analysis was performed using the IciMapping 4.1 ICIM-ADD method with an LOD value of 3.0. A stable QTL was located on chromosome 5DL and named QNRT.caas-5DL ( Figure 1 ). The flanking marks are IAAV6218 and Kukri_ c46526_103 The physical interval is 449.6-454.1 Mb. Under different environmental conditions, it can explain 10.16% of the phenotypic variation. Kukri_c46526_103 Convert to Kasp-Kukri_c46526_103 , which was subsequently used to detect the genotypes of 165 wheat varieties.

[0076] 4. Molecular Markers Kasp-Kukri_c46526_103 Development

[0077] Molecular markers Kasp-Kukri_c46526_103 Located on wheat chromosome 5D, a primer set suitable for identifying total root tip number in wheat using allele-competitive, specific PCR was designed and synthesized. The KASP primer set consists of three primers: upstream primer F1, upstream primer F2, and downstream primer R, and is used to amplify the target sequence encompassing this SNP.

[0078] Upstream primer F1: 5'- GAAGGTGACCAAGTTCATGCT GAGAAGGGATGGAGATAGATCAAT-3' (SEQ ID No. 1, the underlined part is the specific fluorescent tag sequence FAM);

[0079] Upstream primer F2: 5'- GAAGGTCGGAGTCAACGGATT GAGAAGGGATGGAGATAGATCAAC-3' (SEQ ID No. 2, the underlined part is the specific fluorescent tag sequence HEX);

[0080] Downstream primer R: 5′-AGCAGTCTTCTTCTCCCTCG-3′ (SEQ ID No. 3).

[0081] Kasp-Kukri_c46526_103 The site is the 37th nucleotide from the 5' end of SEQ ID No. 4 in the wheat genome (corresponding to the last base at the 3' end of the two upstream primers), which is T or C (represented by Y in the 37th position of SEQ ID No. 4). The genotype of this site can be TT homozygous, CC homozygous, and TC heterozygous.

[0082] SEQ ID No.4:

[0083] GAAATYCGTAAAGGAGAAGGGATGGAGATAGATCAA[Y]TCATTCAGAATCCAGACCCGAGGGAGAAGAAGACT (Y in the square brackets is T or C).

[0084] Since genomic DNA is a double-stranded DNA molecule composed of two reverse-complementary single-stranded DNA molecules, the DNA molecule encoding the protein is generally named the sense DNA molecule; the DNA molecule that is reverse complementary to the sense DNA molecule is named the antisense DNA molecule. Kasp-Kukri_c46526_103 The genotypes of the loci are all positive-sense DNA genotypes.

[0085] The upstream primer F1 is used to amplify the case where the nucleotide at the SNP site (sense chain) on wheat chromosome 5D is T, and the upstream primer F2 is used to amplify the case where the nucleotide at the SNP site (sense chain) on wheat chromosome 5D is C; the downstream primer R is a universal primer.

[0086] The single-stranded DNA molecules shown in SEQ ID No. 1 and SEQ ID No. 3 amplify a fragment in which the nucleotide at the SNP site (sense strand) on the wheat 5D chromosome is homozygous for T.

[0087] The single-stranded DNA molecule shown in SEQ ID No. 2 and the single-stranded DNA molecule shown in SEQ ID No. 3 amplify a fragment in which the nucleotide at the SNP site (positive strand) on the wheat 5D chromosome is homozygous for C.

[0088] The single-stranded DNA molecules shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3 amplify a fragment in which the nucleotides at the SNP site (positive strand) on wheat chromosome 5D are hybridized with T and C.

[0089] 5. Polymorphism Detection

[0090] The experimental materials are 165 wheat varieties, see Table 1 for details.

[0091] On the one hand, for 165 wheat varieties, the total number of root tips of each wheat variety was detected using the method in step one.

[0092] On the other hand, using Kasp-Kukri_c46526_103 Mark and test all experimental materials. The specific operations are as follows:

[0093] Genomic DNA was extracted from young leaves of 165 wheat varieties using the CTAB method. The quality and concentration of the genomic DNA must meet PCR requirements: agarose gel electrophoresis reveals a single DNA band with no apparent smearing; an A260 / A280 ratio between 1.8 and 2.0 (DNA samples free of protein contamination), an A260 / A230 ratio between 1.8 and 2.0 (DNA samples with low salt ion concentrations), and no significant absorbance at 270 nm (DNA samples free of phenol contamination) as measured by a Nanodrop 2100 UV spectrophotometer (Thermo). The concentration of the genomic DNA in the wheat samples to be tested should be between 50 and 200 ng / μL.

[0094] The genomic DNA of the wheat to be tested is used as a template and PCR amplification is performed using the KASP primer set synthesized in step 4 to obtain a PCR amplification product.

[0095] The reaction system consisted of 2.0 μl of KASP 2× Master Mix (LGC, Catalog No. 13448166), 0.048 μl of KASP primers (a mixture of three primers, total concentration 50 μM, with a molar ratio of two upstream primers to one downstream primer of 2:2:5), and 1.952 μl of template DNA (50 ng / μl). Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000™ Thermal Cycler).

[0096] The reaction program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, 65°C-55°C (touch down program was selected, decreasing 1°C per cycle) for 1 min, and amplification for 10 cycles; denaturation at 94°C for 20 s, 57°C for 1 min, and continued amplification for 41 cycles.

[0097] The PCR amplification products were placed in an autofocus fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMGLABTECH) to read the final fluorescence data, and then the data were imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping. The FAM fluorescent tag sequence was observed at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the HEX fluorescent tag sequence was observed at an excitation wavelength of 528 nm and an emission wavelength of 560 nm. The fluorescent signal color was used to determine the wheat strain to be tested. Kasp-Kukri_c46526_103 The specific judgment principle is as follows: If the wheat to be tested is based on Kasp-Kukri_c46526_103 The site shows a blue fluorescent signal, then the wheat to be tested is based on Kasp- Kukri_c46526_103 The genotype of the locus is TT homozygous, which is consistent with that of soybean and wheat; if the wheat to be tested is based onKasp-Kukri_ c46526_103 The site shows a red fluorescent signal, then the wheat to be tested is based on Kasp-Kukri_c46526_103 The genotype of the locus is CC homozygous, which is consistent with Shi 4185; if the wheat to be tested is based on Kasp-Kukri_c46526_103 The site shows a green fluorescent signal, then the wheat to be tested is based on Kasp-Kukri_c46526_103 The genotype of the locus is TC heterozygous.

[0098] The results are shown in Tables 1, 2 and Figure 2 Among the 165 wheat varieties, 146 varieties showed the Shi 4185 genotype CC (red), with a total root tip number of 226.7; 9 varieties showed the Doumai genotype TT (blue), with a total root tip number of 172.5; the statistical test showed QNRT.caas-5DL The gene effects reached significant differences ( P <0.05).

[0099] Table 1. Genotype detection results and total root tip number of 165 wheat varieties

[0100]

[0101] Note: “-” indicates missing phenotypic or genotypic data.

[0102] Table 2 QNRT.caas-5DL Effect of total root tip number in 165 natural populations

[0103]

[0104] Note: * indicates significant difference.

[0105] It can be seen that using Kasp-Kukri_c46526_103 The genotype of the locus can identify the total root tip number of wheat. Kasp-Kukri_c46526_103 The total number of root tips of the tested wheat with the C:C homozygous genotype at the locus was significantly higher than that of the tested wheat with the T:T homozygous genotype.

[0106] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. Use of a specific SNP site on the wheat genome as a marker for breeding wheat plants, lines, varieties, or cultivars with a relatively high number of total root tips, characterized by: The specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at the SNP site is T or C.

2. Use of primers for detecting specific SNP sites on the wheat genome in any of the following: (A1) Breeding wheat plants, lines, varieties, or cultivars with a relatively large number of total root tips; (A2) preparing a product for breeding wheat plants, lines, varieties or varieties with a relatively large number of total root tips; The specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at the SNP site is T or C.

3. The use according to claim 2, characterized in that: The primer is a KASP primer; The KASP primers include primer 1 as shown in SEQ ID No. 1, primer 2 as shown in SEQ ID No. 2, and primer 3 as shown in SEQ ID No. 3; The product is a reagent or a kit.

4. A method for breeding wheat plants, lines, strains, or varieties with a relatively high total number of root tips, characterized by: The method comprises the following steps: Detecting nucleotides at specific SNP sites on the genome of the wheat to be tested, determining the genotype of the wheat to be tested, selecting the wheat to be tested with a C:C genotype as a parent for breeding, and selecting wheat with a C:C genotype in each breeding generation, ultimately obtaining wheat plants, lines, varieties, or varieties with a relatively large total number of root tips; The specific SNP site is located at position 37 of SEQ ID No. 4 on wheat chromosome 5D, and the nucleotide at the SNP site is T or C; The C:C genotype is a homozygous type in which the nucleotide at the specific SNP site on the wheat genome is C.

5. The method according to claim 4, wherein: Detecting nucleotides at a specific SNP site on the genome of the wheat to be tested specifically includes the following steps: performing PCR amplification on the genomic DNA of the wheat to be tested using KASP primers, scanning the amplified product for fluorescent signals, and determining the genotype of the specific SNP site in the genome of the wheat to be tested; wherein the KASP primers include primer 1 as shown in SEQ ID No.1, primer 2 as shown in SEQ ID No.2, and primer 3 as shown in SEQ ID No.3; wherein positions 1-21 of the sequence shown in SEQ ID No.1 are fluorescent label sequence A, and positions 1-21 of the sequence shown in SEQ ID No.2 are fluorescent label sequence B; If the fluorescent signal of the amplified product of the wheat to be tested is the signal corresponding to the fluorescent tag sequence A, the wheat to be tested is of T:T genotype; if the fluorescent signal of the amplified product of the wheat to be tested is the signal corresponding to the fluorescent tag sequence B, the wheat to be tested is of C:C genotype.