Specifically alternatively spliced transcripts and use as diagnostic markers for glioma or breast cancer

By using ARRB1Δexon13 and NCOR2Δexon21 as RNA level diagnostic biomarkers for glioma and breast cancer, the problem of complex detection in existing technologies has been solved, realizing a simple and economical diagnostic method and improving the specificity and sensitivity of detection.

CN117264960BActive Publication Date: 2026-08-25RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211616185.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-15
Publication Date
2026-08-25
Estimated Expiration
2042-12-15

AI Technical Summary

Technical Problem

Current molecular diagnostic methods for glioma and breast cancer are complex and lack simple and economical methods for detecting RNA-level biomarkers. Traditional detection methods such as pyrosequencing are costly, and RNA splicing studies are lacking in breast cancer diagnosis.

Method used

Using ARRB1Δexon13, a specific alternatively spliced ​​transcript of type B repressor protein 1 (ARRB1), and NCOR2Δexon21, a specific alternatively spliced ​​transcript of nuclear receptor co-repressor 2 (NCOR2), as diagnostic biomarkers, amplification and detection were performed using designed primers, combined with high-throughput sequencing technology, to develop a simple detection method.

Benefits of technology

It provides highly specific and sensitive diagnostic methods for gliomas and breast cancer, simplifies the testing process, reduces costs, and improves the economics and feasibility of testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117264960B_ABST
    Figure CN117264960B_ABST
Patent Text Reader

Abstract

The application discloses a specific alternative splicing transcript ARRB1 of B-type inhibin 1 Δexon13 , a specific alternative splicing transcript NCOR2 of nuclear receptor auxiliary inhibin 2 Δexon21 . The application also discloses use of a reagent for detecting the specific alternative splicing transcript ARRB1 of B-type inhibin 1 Δexon13 in preparation of a kit for detecting glioma. The application also discloses use of a reagent for detecting the specific alternative splicing transcript NCOR2 of nuclear receptor auxiliary inhibin 2 Δexon21 in preparation of a kit for detecting glioma. The application also discloses use of a reagent for detecting the specific alternative splicing transcript ARRB1 of B-type inhibin 1 Δexon13 in preparation of a kit for detecting breast cancer. The application proves that ARRB1 Δexon13 and NCOR2 Δexon21 have high specific expression in primary and recurrent glioma, and can be used as one of means for pathological diagnosis or prognosis analysis of glioma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the biomedical field and relates to two diagnostic markers, specifically the specific alternatively spliced ​​transcript of ARRB1, a type B repressor protein 1 (ARRB1), and nuclear receptor co-repressor 2 (NCOR2). △exon13 (ARRB1-S), NCOR2 Δexon21 (NCOR2-S) and its use as a diagnostic marker for glioma and breast cancer. Background Technology

[0002] Currently, molecular diagnostic biomarkers for gliomas, such as IDH1 mutations, MGMT promoter methylation, chromosomal 1p / 19q co-deletion, TERT promoter mutations, EGFR amplification or EGFRvIII rearrangement, and PTEN and TP53 mutations, have greatly advanced the molecular diagnosis of gliomas and provided a basis for personalized diagnosis and treatment. However, existing recognized glioblastoma biomarkers are concentrated at the gene or epigenetic level, and the detection methods are relatively complex. Hospital laboratories in my country still lack simple, cost-effective, and efficient detection methods to assist in the molecular diagnosis of gliomas. For example, detecting IDH mutations / MGMT promoter methylation in gliomas generally uses pyrosequencing, which is expensive and relies on testing services from external institutions.

[0003] Similarly, in the molecular subtyping and diagnosis of breast cancer, immunohistochemical methods are used to detect the expression or levels of estrogen receptor (ER), progesterone receptor (PR), HER-2, and Ki-67 in patient samples, classifying breast cancer into four types. Different treatment strategies are adopted for different subtypes. However, research on the diagnosis and subtyping of breast cancer at the RNA level remains largely unexplored.

[0004] Before mRNA matures, the process of removing introns and linking exons in precursor mRNA is called RNA splicing. Splicing of precursor mRNA is highly accurate. Through alternative splicing, the same gene can produce different mature mRNAs. Today, thanks to the maturity of high-throughput sequencing technology, scientists have discovered complex alternative splicing events in tumor cells and the tumor microenvironment. These events are particularly important in tumor development and progression, making them a novel characteristic of tumors. The alternative splicing products of some genes that play key roles in tumors perform different functions, directly influencing tumor progression and treatment, and thus possessing value as therapeutic targets. Furthermore, the frequency of alternative splicing events differs between normal and cancerous tissues; detecting the spliced ​​variant mRNAs produced by these events has value as molecular biomarkers. Therefore, cancer-related specific alternative splicing events can provide new molecular diagnostic biomarkers for clinical tumor diagnosis. There is a need to develop a novel detection method for RNA-level biomarkers that is more economical and convenient than traditional methods of detecting protein-level biomarkers.

[0005] Therefore, two problems need to be solved: first, to find biomarkers for diagnosing glioma and breast cancer at the RNA level—cancer-associated specific alternative splicing transcripts; and second, to develop new, cost-effective, and convenient detection methods for detecting biomarkers at the RNA level. Summary of the Invention

[0006] To address the aforementioned technical problems in the prior art, the present invention provides specific alternatively spliced ​​transcripts and their use as diagnostic markers for gliomas or breast cancer. These specific alternatively spliced ​​transcripts and their use as diagnostic markers for gliomas or breast cancer aim to solve the technical problem of the complexity of existing methods for detecting gliomas and breast cancer.

[0007] This invention provides a specific alternatively spliced ​​transcript of type B repressor protein 1, ARRB1. Δexon13 The nucleotide sequence of its open reading frame is shown in SEQ ID NO.1.

[0008] This invention also provides a specific alternatively spliced ​​transcript of nuclear receptor co-repressor 2, NCOR2. Δexon21 The nucleotide sequence of its open reading frame is shown in SEQ ID NO.2.

[0009] This invention also provides a specific alternatively spliced ​​transcript of ARRB1 for detecting type B repressor protein 1 (ARRB1). Δexon13The use of (ARRB1-S) reagents in the preparation of a kit for detecting gliomas; the reagents include: an upstream primer for amplifying tumor samples as shown in SEQ ID NO.3, a downstream primer for amplifying tumor samples as shown in SEQ ID NO.4, an upstream primer for amplifying cell samples as shown in SEQ ID NO.5, and a downstream primer for amplifying cell samples as shown in SEQ ID NO.6.

[0010] This invention also provides a specific alternatively spliced ​​transcript of nuclear receptor co-repressor 2 (NCOR2) for detection. Δexon21 The use of (NCOR2-S) reagents in the preparation of a kit for detecting gliomas; wherein the reagents include: an upstream primer as shown in SEQ ID NO.7 and a downstream primer as shown in SEQ ID NO.8.

[0011] This invention also provides a specific alternatively spliced ​​transcript of ARRB1 for detecting type B repressor protein 1 (ARRB1). Δexon13 The use of (ARRB1-S) reagents in the preparation of a kit for detecting breast cancer; the reagents include: an upstream primer for amplifying tumor samples as shown in SEQ ID NO.3, a downstream primer for amplifying tumor samples as shown in SEQ ID NO.4, an upstream primer for amplifying cell samples as shown in SEQ ID NO.5, and a downstream primer for amplifying cell samples as shown in SEQ ID NO.6.

[0012] This invention also provides a specific alternatively spliced ​​transcript of ARRB1, type B repressor protein 1 (ARRB1). Δexon13 Use of (ARRB1-S) in the preparation of diagnostic markers for glioma.

[0013] This invention also provides a specific alternatively spliced ​​transcript of nuclear receptor co-repressor 2 (NCOR2) for detection. Δexon21 Use of (NCOR2-S) in the preparation of diagnostic markers for glioma.

[0014] This invention also provides a specific alternatively spliced ​​transcript of ARRB1 for detecting type B repressor protein 1 (ARRB1). Δexon13 Use of (ARRB1-S) in the preparation of diagnostic markers for breast cancer.

[0015] This invention also provides a method for detecting ARRB1 in cell or tumor samples. Δexon13 (ARRB1-S), NCOR2 Δexon21 The (NCOR2-S) method includes the following steps:

[0016] 3) A step for extracting RNA from a sample;

[0017] 4) Prepare cDNA;

[0018] 1. Prepare the following mixture in a sterile, RNase-free centrifuge tube:

[0019]

[0020]

[0021] After heating the prepared mixture in a 65°C metal bath for 5 minutes, quickly cool it on ice and let it stand on ice for 2 minutes. Next, add 4 μL of gDNAwiper Mix to each tube of mixture, gently mix by pipetting, and incubate in a 42°C metal bath for 2 minutes. Next, add 2 μL of 10×RT Mix and 2 μL of HiScript II Enzyme Mix to each tube of mixture, and mix by pipetting.

[0022] 2. cDNA synthesis reaction

[0023] Perform the first-strand cDNA synthesis reaction on a PCR instrument (Bio-rad C1000 Touch) under the following conditions:

[0024] 25 5min 55 50min 85 2min

[0025] 3) Fragment amplification:

[0026] 1. Fragment amplification was performed using 2×PhantaMax Master Mix high-fidelity enzyme. The reaction system is as follows:

[0027] 2×Phanta Max Master Mix(Dye Plus) 10μL Forward Primer (10μM) 1μL Reverse Primer (10μM) 1μL template 1μL

[0028] 2. Primer design is as follows:

[0029]

[0030] 3. The PCR reaction procedure is as follows:

[0031]

[0032] 4) Steps for preparing agarose gel and electrophoresis;

[0033] 5) Steps for sequencing a PCR product:

[0034] Place the agarose gel on a clean lab bench and illuminate it with a handheld UV lamp to determine the location of long and short transcripts. Cut off the agarose gel containing the bands and perform gel-PCR product recovery. Send the recovered product to a sequencing company for Sanger sequencing to determine the base sequence of the DNA product.

[0035] The diagnostic markers of this invention are ARRB1-S and NCOR2-S. This invention validated the expression of ARRB1-S and NCOR2-S in glioma tumor tissue, demonstrating that ARRB1-S and NCOR2-S have high specific expression levels in both primary and recurrent gliomas, and can be used as one of the means for pathological diagnosis or prognostic analysis of gliomas. Furthermore, we also found that ARRB1-S has similarly high specific expression in breast cancer tissue; therefore, the expression level of ARRB1-S can be used as one of the diagnostic indicators for both gliomas and breast cancer. Attached Figure Description

[0036] Figure 1 Western blotting results of stable transgenic glioma cell line U87-MG and breast cancer cell line MDA-MB-231 are shown.

[0037] Figure 2 The results of rMATS analysis of variable shear events simultaneously regulated by AEP and tDDX3X-C are shown in the left figure; the right figure shows four representative variable shear events.

[0038] Figure 3 The visualization of the frequency of alternative splicing in ARRB1 and NCOR2 using Integrative Genomics Viewer (IGV) clearly shows the significant changes in the frequency of alternative splicing at the position of exon 13 of ARRB1 (left figure) and exon 21 of NCOR2 (right figure).

[0039] Figure 4 This study validates the alternative splicing events of ARRB1 and NCOR2 in the stable transgenic glioma cell line U87-MG and the breast cancer cell line MDA-MB-231. It demonstrates that the skipping of exons corresponding to ARRB1 and NCOR2 is simultaneously regulated by AEP and tDDX3X-C.

[0040] Figure 5The results show that ARRB1-S is not expressed in normal brain tissue, but its expression is significantly increased in primary and recurrent gliomas. Left panel: Detection of two ARRB1 transcripts, ARRB1-L and ARRB1-S, in normal brain tissue (5 cases), primary glioma (16 cases), and recurrent glioma (17 cases); Right panel: Quantification of ARRB1-L and ARRB1-S expression levels using ImageJ software. The ARRB1 exon 13 splice rate (PSI%) reflects the ARRB1-S expression level in the above tissue samples; a lower ARRB1 PSI% indicates a higher ARRB1-S expression level.

[0041] Figure 6 The results showed that NCORS2-S was not expressed in normal brain tissue, but its expression was significantly increased in primary and recurrent gliomas. Left panel: Detection of two NCORS2 transcripts, NCORS2-L and NCORS2-S, in normal brain tissue (5 cases), primary glioma (12 cases), and recurrent glioma (9 cases); Right panel: Similarly, the expression level of NCORS2-S in the above tissue samples was reflected by calculating the splice rate of NCORS2 exon 21, i.e., PSI%, (Percentage of Splicedin). The lower the NCORS2 PSI%, the higher the expression level of NCORS2-S.

[0042] Figure 7 The two transcripts of ARRB1, ARRB1-L and ARRB1-S, were detected in six pairs of breast cancer tissues and normal tissues from the same patient (left panel). ARRB1-S expression was low in normal breast tissues, while ARRB1-S expression was significantly increased in breast cancer tissues (right panel).

[0043] Figure 8 The results of Sanger sequencing of the PCR products of ARRB1-L and ARRB1-S showed that ARRB1-S had the deletion of exon 13 compared to ARRB1-L. Detailed Implementation

[0044] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below with reference to specific embodiments.

[0045] Example 1:

[0046] The applicant's previous research found that asparagine endopeptidase (AEP) is highly expressed in tumors and has post-translational modification effects on other protein molecules, such as TMOD3. After AEP cleaves TMOD3 at the N157 site, two new protein truncated variants are generated. The N-terminal protein affects tumor proliferation, while the C-terminal protein affects tumor migration. In further research on other substrates of AEP, the applicant discovered that AEP cleaves human X-chromosome-linked DEAD box helicase 3 (DDX3X). The generated truncated variant—the C-terminal truncated variant of DDX3X (tDDX3X-C)—interacts with alternative splicing regulators SRSF1, hnRNP1A, and U2AF2, and participates in the process of mRNA alternative splicing.

[0047] To further explore the specific transcripts regulated by tDDX3X-C, the applicant established a glioma cell line with tDDX3X-C complementation and performed RNA sequencing and rMATS software analysis to identify the frequency of alternative splicing events, thus screening for the specific tDDX3X-C-regulated transcript ARRB1. △exon13 NCOR2 △exon21 .

[0048] The specific operation process is as follows:

[0049] 1) Sequencing sample preparation

[0050] 1. Establishment of stable AEP knockdown and tDDX3X-C replenishment cell lines: Wild-type glioma cell line U87-MG (purchased from the Cell Bank of the Chinese Academy of Sciences) and wild-type breast cancer cell line MDA-MB-231 (purchased from the Cell Bank of the Chinese Academy of Sciences) were evenly seeded in T25 culture flasks at a cell density of 30-40%. After 24 hours, when the cells had adhered, the viral stock solution was diluted with fresh medium containing 8 μg / mL Polybrene. The old medium was aspirated, and diluted lentivirus containing AEP KD (AEP knockdown) or tDDX3X-C expression was added to the cells. The medium was changed after 24 hours. After 72 hours, fluorescence was observed using an inverted fluorescence microscope to estimate the efficiency of lentivirus infection of target cells. Then, after further screening with puromycin for 24 hours, stable transfected strains with AEP KD (AEP knockdown) and AEP KD / tDDX3X-C res (AEP knockdown with tDDX3X-C replenishment) were obtained. Infection efficiency was verified by Western blot, and stable transfected strains were established as follows: Figure 1 As shown.

[0051] 2. Cell Expansion and Sequencing: Experimental group U87-MG AEP KD (AEP knockdown), U87-MG AEP KD / tDDX3X-C res (AEP knockdown with tDDX3X-C replenishment), and control group U87-MG NC were seeded into T225 cells. After confluence, 15 mL of TRIzol lysis buffer was added, and the cells were detached using the lysis buffer until no clumps remained. The cells were then collected in sterile, enzyme-free centrifuge tubes and stored at -80°C. They were then transported to the sequencing company on dry ice for further sequencing.

[0052] 2) Sequencing results analysis

[0053] rMATS is software developed for analyzing alternative splicing in RNA-seq data. It can not only classify alternative splicing events, but also perform differential analysis of alternative splicing events between different samples.

[0054] rMATS categorizes variable splicing events into the following five types:

[0055] (1) Skipped exon (SE), exon skipping;

[0056] (2) Alternative 5'splice site (A5SS), first exon alternative splicing;

[0057] (3) Alternative 3'splice site (A3SS), the last exon is alternatively spliced;

[0058] (4) Mutually exclusion exon (MXE), selective exon skipping;

[0059] (5) Retained intron (RI)

[0060] Junction Counts were used for AS event detection in the analysis, with screening based on an absolute difference in IncLevelDifference greater than 0.01 and an FDR not greater than 0.05 between the two groups. Analysis and data visualization of the tDDX3X-C sequencing results are as follows: Figure 2 , Figure 3 As shown.

[0061] 3) Validation of sequencing results

[0062] RNA was extracted from the two stable mutant strains U87-MG AEP KD (AEP knockdown), U87-MG AEP KD / tDDX3X-Cres (AEP knockdown with tDDX3X-C complementation), and the control group U87-MG NC in step 1) for sequencing results verification. The specific steps are as described in Example 2. The verification of sequencing results is as follows: Figure 4 As shown.

[0063] The sequencing results are as follows:

[0064] ARRB1, a specific alternatively spliced ​​transcript of repressor type B protein 1 (ARRB1). Δexon13 (ARRB1-S), the open reading frame sequence of its gene is as follows:

[0065] atgggcgacaaagggacccgagtgttcaagaaggccagtccaaatggaaagctcaccgtctacctgggaaagcgggactttgtggacc

[0066] acatcgacctcgtggaccctgtggatggtgtggtcctggtggatcctgagtatctcaaagagcggagagtctatgtgacgctgacctgcg

[0067] ccttccgctatggccgggaggacctggatgtcctgggcctgacctttcgcaaggacctgtttgtggccaacgtacagtcgttcccaccgg

[0068] cccccgaggacaagaagcccctgacgcggctgcaggaacgcctcatcaagaagctgggcgagcacgcttaccctttcacctttgagat

[0069] ccctccaaaccttccatgttctgtgacactgcagccggggcccgaagacacggggaaggcttgcggtgtggactatgaagtcaaagcct

[0070] tctgcgcggagaatttggaggagaagatccacaagcggaattctgtgcgtctggtcatccggaaggttcagtatgccccagagaggcct

[0071] ggcccccagcccacagccgagaccaccaggcagttcctcatgtcggacaagcccttgcacctagaagcctctctggataaggagatcta

[0072] ttaccatggagaacccatcagcgtcaacgtccacgtcaccaacaacaccaacaagacggtgaagaagatcaagatctcagtgcgccagt

[0073] atgcagacatctgccttttcaacacagctcagtacaagtgccctgttgccatggaagaggctgatgacactgtggcacccagctcgacgtt

[0074] ctgcaaggtctacacactgacccccttcctagccaataaccgagagaagcggggcctcgccttggacgggaagctcaagcacgaagac

[0075] acgaacttggcctctagcaccctgttgagggaaggtgccaaccgtgagatcctggggatcattgtttcctacaaagtgaaagtgaagctg

[0076] gtggtgtctcggggcggcgacgtggccgtggaactgcccttcaccctaatgcaccccaagcccaaagaggaacccccgcatcgggaa

[0077] gttccagagaacgagacgccagtagataccaatctcatagaacttgacacaaatgatgacgacattgtatttgaggactttgctcgccagagactgaaaggcatgaaggatgacaaggaggaagaggaggatggtaccggctctccacagctcaacaacagatag (shown in SEQ ID NO.1).

[0078] Specific alternatively spliced transcript NCOR2 of nuclear receptor corepressor 2 (NCOR2) Δexon21 (NCOR2-S), and the open reading frame sequence of its gene is:

[0079]

[0080] like Figure 1 As shown, compared with the control group, AEP expression was effectively downregulated in U87-MG and MDA-MB-231; at the same time, physiological levels of tDDX3X-C were restored on the basis of AEP KD.

[0081] like Figure 2 As shown, rMATS analysis was performed after RNA sequencing to analyze alternative splicing events. Compared with the control group, alternative splicing events induced by the synergistic up / down regulation of AEP and tDDX3X-C were analyzed under the conditions of downregulation after AEP KD and upregulation after tDDX3X-C res, or upregulation after AEP KD and downregulation after tDDX3X-C res. The number of events is as follows. Figure 2 As shown in the left figure, the right figure represents four genes that are significantly regulated by AEP / tDDX3X-C.

[0082] like Figure 3 As shown, the sequencing results were visualized using IGV software, revealing that the alternative splicing events of exon 13 of ARRB1 and exon 21 of NCOR2 are synergistically controlled by AEP / tDDX3X-C.

[0083] like Figure 4 As shown, the splicing of exon 13 of ARRB1 and exon 21 of NCOR2 was verified in U87-MG and MDA-MB-231, respectively, demonstrating the specific regulation of ARRB1 by AEP / tDDX3X-C.

[0084] Example 2:

[0085] 1) RNA sample preparation

[0086] 1. Grinding and homogenizing of samples: Take a tissue sample the size of a soybean and place it in a mortar containing liquid nitrogen. Grind the tissue into powder using the mortar. After the liquid nitrogen evaporates, add 1 mL of RNAisolater (Vazyme, CAT.R401-01-AA) to the mortar and continue to homogenize thoroughly. Then collect the homogenate in a 1.5 mL centrifuge tube.

[0087] 2. Total RNA Extraction: Place the homogenate in a 1.5 mL centrifuge tube, incubate at room temperature for 5 minutes, centrifuge at 12000×g at 4℃ for 5 minutes, carefully aspirate the supernatant and transfer it to a new 1.5 mL centrifuge tube. Add 200 μL of chloroform to the lysis buffer, tighten the centrifuge tube cap, and mix until the solution emulsifies and turns milky white. Incubate at room temperature for 5 minutes, centrifuge at 12000×g at 4℃ for 15 minutes. Carefully remove the centrifuge tube from the centrifuge. At this point, the homogenate will separate into three layers: a colorless supernatant, a middle white protein layer, and a colored lower organic phase. Aspirate the supernatant to a new 1.5 mL centrifuge tube, add 700 μL of isopropanol, invert the centrifuge tube to mix thoroughly, incubate at room temperature for 10 minutes, centrifuge at 12000×g for 15 minutes. RNA precipitation will generally appear at the bottom of the tube.

[0088] 3. Washing the RNA precipitate: Carefully discard the supernatant, add 1 mL of 75% ethanol, gently invert the centrifuge tube to wash the wall, centrifuge at 7500×g at 4℃ for 5 minutes, and then carefully discard the supernatant.

[0089] 4. RNA Dissolution: Open the centrifuge tube cap and allow it to dry at room temperature for 10 minutes. Add 20 μL of Nase-free water to dissolve the precipitate. Measure the RNA concentration using a spectrophotometer (Thermo Scientific NanoDrop One). The product can be used immediately for reverse transcription or stored at -80°C and used within six months.

[0090] 2) Preparation of cDNA

[0091] 1. Preparation of working solution before reverse transcription: Prepare the following mixture in a sterile, RNase-free centrifuge tube:

[0092]

[0093] After heating the prepared mixture in a 65°C metal bath for 5 minutes, quickly cool it on ice and let it stand on ice for 2 minutes. Next, add 4 μL of gDNAwiper Mix to each tube of mixture, gently pipette to mix, and incubate in a 42°C metal bath for 2 minutes. Next, add 2 μL of 10×RT Mix and 2 μL of HiScript II Enzyme Mix to each tube of mixture and pipette to mix.

[0094] 2. cDNA synthesis reaction

[0095] Perform the first-strand cDNA synthesis reaction on a PCR instrument (BIO-RAD C1000 Touch) under the following conditions:

[0096]

[0097] 3) Fragment amplification:

[0098] 1. Fragment amplification was performed using 2×Phanta Max Master Mix (Dye Plus) (Vazyme, P525-01) high-fidelity enzyme. The reaction system is as follows:

[0099]

[0100] 2. Primer design is as follows (designed using SnapGene 4.3.6):

[0101]

[0102] 3. PCR reaction: The PCR procedure is as follows:

[0103]

[0104]

[0105] 4) Preparation and electrophoresis of agarose gel:

[0106] 1. Preparation of 2% agarose gel: Add 1.2g of agarose and 60mL of 1xTAE Buffer to a 250mL Erlenmeyer flask and heat in a microwave oven for 2 minutes to completely dissolve the agarose powder (Sangoku CAT.A620014-0100) in the TAE solution. Shake well several times during the process. After the agarose solution cools to 60℃, add 12μl of ethidium bromide (MCE CAT.1239-45-8) dye solution and mix thoroughly. Slowly pour the agarose solution into the gel mold, insert a comb with a central hole, and allow it to cool completely for 30 minutes.

[0107] 2. Agarose gel electrophoresis: Pour 1×TAE electrophoresis buffer into the electrophoresis tank and place the gel in the tank, ensuring the buffer completely covers the gel surface. Add a 100bp DNA ladder (Vazyme CAT.MD-104) and PCR samples to the sample wells; connect the power supply and adjust the voltage to 120V, electrophoresis for 45 minutes; after electrophoresis, disconnect the power supply, carefully remove the agarose gel, and observe the DNA bands under a gel imaging system. Based on the relative positions of the control marker and the DNA bands, confirm the size of long and short transcripts.

[0108] 5) Sequencing of PCR products:

[0109] Place the agarose gel on a clean lab bench and illuminate it with a handheld UV lamp to determine the location of long and short transcripts. Cut off the agarose gel containing the bands and perform gel-PCR product recovery. Send the recovered product to a sequencing company for Sanger sequencing to determine the base sequence of the DNA product.

[0110] result:

[0111] like Figure 5 As shown, PCR was used to detect the expression of ARRB1-S, a specific alternative splice band of ARRB1, in normal brain tissue (number of cases = 5), primary glioma (number of cases = 16), and recurrent glioma (number of cases = 17). Compared with normal tissue, ARRB1-S was specifically highly expressed in tumor tissues of primary and recurrent gliomas; no ARRB1-S was expressed in normal brain tissue.

[0112] like Figure 6 As shown, PCR was used to detect the expression of the NCOR2-specific alternative splice band NCOR2-S in normal brain tissue (number of cases = 5), primary glioma (number of cases = 12), and recurrent glioma (number of cases = 9). Compared with normal tissue, NCOR2-S was specifically highly expressed in tumor tissues of primary and recurrent gliomas; no NCOR2-S was expressed in normal brain tissue.

[0113] like Figure 7 As shown, PCR was used to detect the expression of the ARRB1-S specific alternative splice band in normal breast tissue and breast cancer parenchyma from the same case in 6 pairs of breast tissues. The expression of ARRB1-S in breast cancer parenchyma was much higher than that in normal breast tissue of the control group.

[0114] like Figure 8 As shown in the figure, PCR products from one of the primary gliomas were subjected to Sanger sequencing. The sequencing results for ARRB1-L and ARRB1-S are shown in the figure. The sequencing results demonstrate that the short transcript of ARRB1 (ARRB1-S) is generated by skipping exon13.

[0115] Results Notes: PSI, short for Percent Spliced ​​In, refers to the percentage of splicing. It is an indicator that quantifies alternative splicing to determine whether a particular exon is included in the transcript, and can be used for comparison of single samples or multiple samples between groups.

[0116] All results were quantified using ImageJ software to determine the relative expression levels of the target bands. GrphaPad software was used to perform intergroup comparisons of the quantification results, and Tukey-corrected multiple comparison tests were used for statistical analysis.

[0117] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. Specific alternatively spliced ​​transcript of nuclear receptor co-repressor 2 (NCOR2) Δexon21 The nucleotide sequence of its open reading frame is shown in SEQ ID NO.

2.

2. Detection of ARRB1, a specific alternatively spliced ​​transcript of type B repressor protein 1. Δexon13 The use of the reagents in the preparation of a kit for detecting gliomas; said reagents include: The upstream primer for amplifying tumor samples is shown in SEQ ID NO.3, the downstream primer for amplifying tumor samples is shown in SEQ ID NO.4, the upstream primer for amplifying cell samples is shown in SEQ ID NO.5, and the downstream primer for amplifying cell samples is shown in SEQ ID NO.

6.

3. Detection of the specific alternatively spliced ​​transcript NCOR2 of nuclear receptor co-repressor 2 Δexon21 The use of the reagents in the preparation of a kit for detecting gliomas, said reagents comprising: The upstream primer is shown in SEQ ID NO.7, and the downstream primer is shown in SEQ ID NO.

8.

4. Detection of ARRB1, a specific alternatively spliced ​​transcript of type B repressor protein 1. Δexon13 The use of the reagents in the preparation of a kit for detecting breast cancer, said reagents comprising: The upstream primer for amplifying tumor samples is shown in SEQ ID NO.3, the downstream primer for amplifying tumor samples is shown in SEQ ID NO.4, the upstream primer for amplifying cell samples is shown in SEQ ID NO.5, and the downstream primer for amplifying cell samples is shown in SEQ ID NO.

6.

5. ARRB1, a specific alternatively spliced ​​transcript of type B repressor protein 1. Δexon13 Use in the preparation of diagnostic markers for glioma.

6. Detection of the specific alternatively spliced ​​transcript NCOR2 of nuclear receptor co-repressor 2 Δexon21 Use in the preparation of diagnostic markers for glioma.

7. Detection of ARRB1, a specific alternatively spliced ​​transcript of type B repressor protein 1. Δexon13 Use in the preparation of diagnostic markers for breast cancer.