SNP molecular markers linked to anthocyanin content in tetraploid roses and their application

Abstract

The present invention relates to the field of molecular marker technology, and in particular to a tetraploid rose anthocyanin content-linked SNP molecular marker and its application. The present invention relates to a SNP marker related to the anthocyanin content of rose petals, wherein the SNP marker contains a nucleotide sequence as shown in SEQ ID NO.5, and the polymorphism is T / C. The target trait can be screened at the seedling stage, effectively shortening the traditional hybrid breeding period, and achieving accurate and efficient rose flower color molecular breeding. Through molecular marker-assisted breeding, the anthocyanin content in rose petals can be effectively increased, the cultivation of pink / red innovative rose varieties can be promoted, and natural derivative products such as plant essential oils and new food raw materials that meet public demand and have market potential can be developed, promoting the efficient transformation of multiple tissues of flowers and the innovative application of diversified products.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to a SNP molecular marker linked to anthocyanin content in a tetraploid rose and an application thereof. Background Art

[0002] Flavonoids include anthocyanidins and flavonols, which are widely present in rose petals. The red color in rose petals is mainly given by anthocyanidins, and flavonols are present in petals of all colors. Related research results have found that there are three main types of anthocyanidin aglycones in rose petals, namely pelargonidin, cyanidin and peonidin, which are mainly glucose-glycosylated at the 3,5-position or 3-position (Biolley and Jay, 1993; Mikanagi et al., 2000; Valentina et al., 2009; Lee et al., 2011). With the rapid development of genomic research, Schulz et al. (2016) conducted a genome-wide association analysis of anthocyanidins and carotenoids in rose petals, and used the genomes of wild strawberry (Fragaria vesca) and peach (Prunus persica) as references, locating the key genes in the pigment synthesis pathway on chromosome 4 of wild strawberry and chromosome 1 of peach. Raymond et al. (2018) mined genomic data and combined it with in-depth physiological and biochemical analysis to identify some biosynthetic pathways in the terpene pathway related to rose color and fragrance metabolism, and the key genes in the flavonoid synthesis pathway were successfully annotated. Next, it is possible to fine-tune the genes related to rose carotenoid metabolism based on multi-omics technology.

[0003] Due to the decoding of the diploid rose genome, the construction of the diploid genetic map is simpler and more complete than that of the tetraploid, which can ensure relatively accurate results in the process of gene positioning. The genetic background of allopolyploids in the rose stage is relatively scarce at the tetraploid level compared to diploids. However, modern rose breeding and production are mainly carried out at the tetraploid level, and the difference in ploidy results in low conversion efficiency of research results based on diploid maps. Therefore, with the rapid development of sequencing technology and analytical methods, QTL positioning research at the tetraploid level is of greater help to the production and application of roses.

[0004] Although some genes that control the formation of rose flower color have been successfully cloned and verified, due to the lack of an efficient genetic transformation system, traditional hybrid breeding is still used for variety improvement, which is relatively slow and uncertain. For innovative flower color breeding, traditional hybrid breeding alone is far from achieving higher breeding goals, so molecular markers are needed to assist breeding and cultivate more new and superior varieties with precise and efficient means. At present, there is a lack of a SNP molecular marker linked to the anthocyanin content of tetraploid roses. Summary of the invention

[0005] The invention provides a tetraploid rose anthocyanin content-linked SNP molecular marker and application thereof.

[0006] The present invention provides a SNP marker related to the anthocyanin content of rose petals, wherein the SNP marker contains a nucleotide sequence as shown in SEQ ID NO.5; the polymorphic site is located at the 40th position of the sequence as shown in SEQ ID NO.5;

[0007] SEQ ID NO.5:

[0008] AGCACTGGTTCACTAGATGAACTTGAGAAGCAAACATGA[T / C]ATCCTCCCTATACTGTTCTGAAATTTTTTGCTCTTCAAA.

[0009] Further preferably, the SNP marker contains the nucleotide sequence shown in SEQ ID NO.6; the polymorphic site is located at the 50th position of the sequence shown in SEQ ID NO.6;

[0010] SEQ ID NO.6:

[0011] TCAAGCTTCAAGCACTGGTTCACTAGATGAACTTGAGAAGCAA ACATGA[T / C]ATCCTCCCTATACTGTTCTGAAATTTTTTGCTCTTC AAATTGGCAAAGA.

[0012] More preferably, the SNP marker contains the nucleotide sequence shown in SEQ ID NO.7; the polymorphic site is located at position 60 of the sequence shown in SEQ ID NO.7;

[0013] SEQ ID NO.7:

[0014] ATGTGGGTACTCAAGCTTCAAGCACTGGTTCACTAGATGAACTT GAGAAGCAAACATGA[T / C]ATCCTCCCTATACTGTTCTGAAATTT TTTGCTCTTCAAATTGGCAAAGA.

[0015] More preferably, the SNP marker contains the nucleotide sequence shown in SEQ ID NO.8; the polymorphic site is located at position 70 of the sequence shown in SEQ ID NO.8;

[0016] SEQ ID NO.8:

[0017] ATAAATGAAGATGTGGGTACTCAAGCTTCAAGCACTGGTTCACTAGATGAACTTGAGAAGCAAACATGA[T / C]ATCCTCCCTATACTGTTCTGAAATTTTTTGCTCTTCAAATTGGCAAAGAGTCCTCCACA.

[0018] Furthermore, the SNP marker contains a nucleotide sequence as shown in SEQ ID NO.1; the polymorphic site is located at the 101st position of the sequence as shown in SEQ ID NO.1, and the polymorphism is T / C.

[0019] According to the SNP markers, the rose petals corresponding to the TT genotype have lower anthocyanin content; and the rose petals corresponding to the CT genotype have higher anthocyanin content.

[0020] The present invention also provides a primer for amplifying the SNP marker.

[0021] According to the primers, it includes: SEQ ID NO.2-4.

[0022] The present invention also provides a detection product containing the primer, and the detection product is a detection reagent, a test kit or a gene chip.

[0023] The present invention also provides the use of the SNP marker, the primer, or the detection product in identifying and / or screening the anthocyanin content trait of rose petals.

[0024] According to the application, the rose petals corresponding to the TT genotype have a lower anthocyanin content; the rose petals corresponding to the CT genotype have a higher anthocyanin content;

[0025] Preferably, the anthocyanin content of rose petals with TT genotype is between 0 and 23.62 ug / g, and the anthocyanin content of rose petals with CT genotype is between 139.02 ug / g and 3509.9 ug / g.

[0026] According to the application, the following steps are included: 1) extracting genomic DNA from rose petals to be tested;

[0027] 2) using the genomic DNA of the rose petals to be tested as a template, and performing a PCR amplification reaction using the primers;

[0028] 3) Analyze the PCR amplification products.

[0029] According to the SNP marker, the primer, the detection product or the application, the rose is a tetraploid rose.

[0030] According to the application of the SNP marker, the primer, and the gene chip in any of the following:

[0031] (1) Application in detecting or assisting in detecting the anthocyanin content in rose petals;

[0032] (2) Application in early prediction of anthocyanin content in rose petals;

[0033] (3) Application in rose molecular marker-assisted breeding;

[0034] (4) Application in rose germplasm resource improvement;

[0035] (5) Application in rose genotyping;

[0036] (6) Application in screening anthocyanin content in rose petals;

[0037] (7) Promote the cultivation of new pink or red rose varieties.

[0038] Beneficial effects of the present invention:

[0039] By obtaining molecular markers that are closely linked to the formation and accumulation of rose anthocyanins, target traits can be screened at the seedling stage based on the molecular marker sequence information, effectively shortening the years of traditional hybrid breeding and achieving accurate and efficient molecular breeding of rose flower color.

[0040] Through molecular marker-assisted breeding, the anthocyanin content in rose petals can be effectively increased, the cultivation of innovative pink / red rose varieties can be promoted, and natural derivative products such as plant essential oils and new food raw materials that meet public demand and have market potential can be developed, promoting the efficient transformation of multiple tissues of flowers and the innovative application of diversified products. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art.

[0042] Figure 1 It is a partial linkage group map of the tetraploid rose YS population genetic map provided in Example 1 of the present invention.

[0043] Figure 2 This is the QTL positioning result of anthocyanin content in the tetraploid rose YS population provided in Example 1 of the present invention.

[0044] Figure 3 This is the typing result of the KASP marker A017036 in the population provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0045] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0046] In the context of the advent of the era of omics big data, it has become an irreversible trend to integrate and analyze various omics data such as genomics, transcriptomics and metabolomics, use molecular biology methods to analyze the synthesis pathways of secondary metabolites, assist modern bioengineering technology to increase the content of related pigments in ornamental plants, and promote the comprehensive utilization of ornamental plant resources as edible and medicinal resources. Modern rose varieties with rich flower colors are good materials for studying the effects of different carotenoid types on rose ornamental and other added values, and artificial populations with good flower color separation will provide the necessary genetic support for this study.

[0047] In this embodiment, the tetraploid ancient rose variety 'Yunzhengxiawei' is used as the female parent and the modern rose variety 'Taiyangcheng' is used as the male parent for hybridization to obtain a tetraploid rose F1 generation hybrid population, which produces a total of 187 offspring, constituting a tetraploid rose YS genetic mapping population. In the established artificial F1 population, markers related to anthocyanin content are located to obtain molecular markers that are closely linked to the formation and accumulation of rose anthocyanins. The present invention performs genotyping based on the tetraploid rose reference genome: genome sequencing and assembly of tetraploid maternal materials are performed to develop a tetraploid level reference genome to assist in accurate typing. Genetic mapping and anthocyanin content positioning analysis are performed using polyploid mapping software and strategies: polyploid mapping software polymapR is used for analysis, molecular markers are typed in combination with polyploid genetic mapping strategies, and then MSTmap is used to sort and cluster markers to construct a genetic map.

[0048] Example 1 Development and application of SNP molecular markers

[0049] (1) Multi-level trait measurement: Fresh petals of the tetraploid rose YS genetic mapping population were collected and their flower color phenotype values ​​were measured using a colorimeter (NF555, Nippon Denshoku Industries Co. Ltd., Japan); anthocyanins were extracted, separated and identified from the mapping population.

[0050] (2) Tetraploid genome typing and SNP development: Assemble the tetraploid maternal genome of the population, align the population resequencing data to the tetraploid reference genome and perform accurate typing. Use BWA software (mem method alignment) to align the filtered high-quality fastq data to the 'Yunzhengxiawei' reference genome, and use samtools software to count the alignment of each sample. Use GATK software to analyze the AD value information in the vcf file and score the allele status of each SNP site. According to the ratio of the reference allele depth (ADref) and the interactive allele depth (ADalt) of each site, the sequencing value is converted into a genotype.

[0051] (3) Constructing genetic maps using polyploid strategy: For the obtained genotype data, co-segregated markers were screened out, and only marker sites with exchange between samples were retained for linkage map construction. According to the segregation ratio and the genotype information of the parents, all SNPs were divided into three data sets. The maternal data set (HA) is the marker that is only segregated in the maternal gametes; the paternal data set (AH) is the marker that is only segregated in the paternal gametes; and the HH data set is the marker that is segregated in both parental gametes. The chi-square test of marker segregation was performed on the three data sets. For the maternal and paternal data sets, the marker segregation ratio should be 1:1, and for the parental heterozygous site data set, the marker segregation ratio should be 1:2:1. The SNP markers that meet the standards are used as the starting data set for the construction of the genetic linkage map (P>1e-10). Three sets of maps were constructed for the maternal (HA), paternal (AH), and parental sites heterozygous (HH).

[0052] (4) Co-localization of multiple traits: Based on the constructed AH, HA and HH maps, QTL analysis was performed using the 24 carotenoid contents measured by the previous research group. The QTL analysis software was WinQTLCart (ver 2.5), and the analysis method was the composite interval mapping method (CIM). Rqtl was combined for auxiliary analysis to increase the accuracy of the results. The LOD threshold was determined after 1000 tests (permutation test) for each trait.

[0053] (5) Screening of SNP markers related to anthocyanin content and KASP verification: Based on the detected QTL range, multiple QTL loci with co-localization of carotenoid content were found, and the QTL locus peak marker Tag_1960032 was screened. The marker sequence information was extracted, specific primers were designed according to the typing situation, and KASP marker A017036 was developed for verification (Table 1). The marker sequence and KASP primer information are as follows:

[0054] Table 1. Labeled primers and sequence information

[0055]

[0056] For SNP marker Tag_1960032, KASP marker A017036 was developed and verified in the population (Table 2). Marker A017036 was divided into two genotypes in the population ( Figure 2 ), respectively homozygous (TT) and heterozygous (CT). The anthocyanin content of the homozygous TT genotype strain is relatively low, ranging from 0 to 23.62 ug / g, and the anthocyanin content of the heterozygous CT genotype strain is relatively high, ranging from 139.02 ug / g to 3509.9 ug / g, which is significantly higher than that of the homozygous TT genotype plant. This indicates that the anthocyanin content QTL peak marker Tag_1960032 of the present invention does have the effect of significantly increasing the anthocyanin content of rose petals; at the same time, the KASP molecular marker A017036 of the present invention can be used for tracking and identification of the anthocyanin content of rose petals and auxiliary breeding.

[0057] Table 2. KASP marker typing and phenotype corresponding results

[0058]

[0059]

[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer set, characterized in that: include: SEQ ID NO.2-4.

2. A detection product containing the primer set according to claim 1, wherein the detection product is a detection reagent, a kit or a gene chip.

3. Use of the primer set described in claim 1 and the detection product described in claim 2 in identifying and / or screening the anthocyanin content trait of tetraploid rose petals.

4. Application of SNP markers related to anthocyanin content in rose petals in identifying and / or screening anthocyanin content traits in tetraploid rose petals, characterized in that: The SNP marker is any of the following: (1) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.5, the polymorphic site is located at the 40th position of the sequence shown in SEQ ID NO.5, and its base is C or T; (2) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.6, the polymorphic site is located at the 50th position of the sequence shown in SEQ ID NO.6, and its base is C or T; (3) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.7, the polymorphic site is located at the 60th position of the sequence shown in SEQ ID NO.7, and its base is C or T; (4) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.8, the polymorphic site is located at the 70th position of the sequence shown in SEQ ID NO.8, and its base is C or T; (5) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.

1. The polymorphic site is located at the 101st position of the sequence shown in SEQ ID NO.1, and its base is C or T.

5. The application according to claim 4, characterized in that: The petals of tetraploid roses corresponding to the TT genotype have low anthocyanin content; the petals of tetraploid roses corresponding to the CT genotype have high anthocyanin content.

6. The use according to claim 5, characterized in that: The rose is a tetraploid rose obtained by hybridizing 'Yunzhengxiawei' as the female parent and 'Taiyangcheng' as the male parent. The anthocyanin content of the petals of the TT genotype tetraploid rose is between 0 and 23.62 ug / g, and the anthocyanin content of the petals of the CT genotype tetraploid rose is between 139.02 ug / g and 3509.9 ug / g.

7. The use according to claim 3, characterized in that: The following steps are involved: 1) Extract genomic DNA from petals of tetraploid rose to be tested; 2) using the genomic DNA of the tetraploid rose petals to be tested as a template and using the primer set of claim 1 to perform a PCR amplification reaction; 3) Analyze the PCR amplification products.

8. Use of the primer set of claim 1, the detection product of claim 2, or the SNP marker of claim 4 in any of the following: (1) Application in detecting or assisting in detecting the anthocyanin content in tetraploid rose petals; (2) Application in early prediction of anthocyanin content in tetraploid rose petals; (3) Application of molecular markers related to anthocyanin content in tetraploid rose petals in breeding; (4) Application in the improvement of tetraploid rose petal anthocyanin content related germplasm resources; (5) Application in genotyping of tetraploid roses; (6) Promote the breeding of new pink tetraploid rose or red tetraploid rose varieties.

Images