Substituted fluorosulfates and their uses

Abstract

The present disclosure provides a substituted fluorosulfate and uses thereof, and in the present application, fluorine-substituted fluorosulfate and unnatural amino acid (covalent amino acid, PrUAA) with enhanced reactivity are developed.

Description

Background Art

[0001] Covalent drugs have attracted extensive attention from basic research and industry due to their unique properties. The process of covalent binding of covalent drugs to antigens is divided into two steps: first, binding to the target through reversible non-covalent interactions; then, the active groups in the drug react with the electrophilic amino acid residues on the target under the promotion of the proximity effect to form a covalently linked conjugate. The additional covalent bonds formed prevent the drug molecules from dissociating from the target, thereby prolonging the duration of action of the drug molecules. Therefore, compared with non-covalent forms of drugs, covalent drugs will have stronger and longer-lasting efficacy.

[0002] Limited by the structure of small molecule drugs, they usually bind to the "pocket" of the target protein in the form of inhibitors. Protein drugs represented by antibodies can specifically bind to large areas of interaction surfaces, thereby disrupting protein-protein interactions. In clinical practice, intact IgG antibodies have superior pharmacokinetic properties, but due to their large size, they can only bind to antigens on the surface of tissues. Fragment antibodies have better tissue permeability, but poorer half-life. If fragment antibodies are covalently bound to antigens and stay at the site of action for a long time, they can overcome the shortcoming of half-life while retaining the advantage of invasiveness.

[0003] With the help of genetic codon expansion technology, we can introduce non-natural amino acids with new chemical functional groups into target proteins, thus greatly expanding the space for protein engineering. In principle, covalent protein drugs should specifically cross-link with target antigens while avoiding reactions with active compounds or other proteins in the system. This property requires that the residues of the introduced adjacent reactive non-natural amino acids (covalent amino acids, PrUAA) must have moderate reactivity, which can not only exist stably in complex biological systems, but also undergo rapid cross-linking reactions after binding to the target. Obviously, the "head functional group" warhead of the covalent amino acid is one of the key factors affecting the cross-linking efficiency of covalent protein drugs, but there are few functional groups that meet the above conditions. Therefore, the development of biocompatible and highly adjacent reactive functional groups and corresponding covalent amino acids will greatly promote the development of covalent protein drugs. Summary of the invention

[0004] The present application provides a substituted fluorosulfate and its use. And in the present application, fluorinated fluorosulfates and related covalent amino acids with enhanced reactivity are developed. Covalent protein drugs have attracted extensive attention from basic scientific research and industry with their unique physicochemical properties. Inserting non-natural amino acids (PrUAAs) with proximity reactivity into specific sites of proteins using genetic codon expansion technology is one of the important methods to give proteins covalent binding ability. Unfortunately, the currently available covalent amino acids are limited, which greatly limits the development of covalent protein drugs. Fluorosulfates have good biocompatibility and can exist stably in vivo, but preliminary experimental results show that their proximity reactivity is poor. Therefore, we obtained fluorine-substituted fluorosulfates and PrUAAs with enhanced proximity reactivity by combining bioenzyme catalysis and chemical synthesis. On this basis, we further developed a series of covalent single-domain antibodies targeting PD-L1, and confirmed that they have stronger efficacy in restoring T cell activity, demonstrating the potential of covalent antibodies as a new generation of biological drugs.

[0005] In one aspect, the present application provides a compound having the following structure (I):

[0006]

[0007] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0008] On the other hand, the present application provides a compound having the following structure (II):

[0009]

[0010] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0011] In another aspect, the present application provides a compound having the following structure (IA):

[0012]

[0013] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0014] On the other hand, the present application provides a compound having the following structure (IP):

[0015]

[0016] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0017] On the other hand, the present application provides a compound having the following structure (II-A):

[0018]

[0019] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0020] On the other hand, the present application provides a compound having the following structure (II-P):

[0021]

[0022] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0023] On the other hand, the present application provides a compound having the following structure:

[0024] Wherein, the X is selected from electron withdrawing groups.

[0025] On the other hand, the present application provides a compound having the following structure:

[0026]

[0027] Wherein, the X is selected from electron withdrawing groups.

[0028] On the other hand, the present application provides a protein comprising the structure of any compound described in the present application.

[0029] In another aspect, the present application provides a protein comprising an unnatural amino acid having the following structure (I):

[0030] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0031] In another aspect, the present application provides a protein comprising an unnatural amino acid having the following structure:

[0032]

[0033] On the other hand, the present application provides a nucleic acid comprising a sequence encoding the protein described in any one of the present application.

[0034] In another aspect, the present application provides a synthetase comprising a mutant at position 366 and / or position 367 as shown in the sequence of SEQ ID NO: 29.

[0035] On the other hand, the present application provides a synthetase having alanine at position 366 and / or position 367 as shown in the sequence of SEQ ID NO:29.

[0036] On the other hand, the present application provides a synthetase comprising sequence SEQ ID NO: 31 and / or 34.

[0037] On the other hand, the present application provides a nucleic acid comprising a sequence encoding the synthetase described in any one of the present application.

[0038] On the other hand, the present application provides a nucleic acid comprising the sequence of SEQ ID NO: 30 and / or 33.

[0039] On the other hand, the present application provides a vector comprising the nucleic acid described in any one of the present application.

[0040] In another aspect, the present application provides a combination comprising the synthetase described in any one of the present application and the compound described in any one of the present application.

[0041] On the other hand, the present application provides a method for preparing the protein described in any of the present application, wherein the method comprises providing the synthetase described in any of the present application, the compound described in any of the present application and / or any combination described in any of the present application.

[0042] On the other hand, the present application provides a cell comprising the compound described in any one of the present application, the protein described in any one of the present application, the nucleic acid described in any one of the present application, the synthetase described in any one of the present application, the nucleic acid described in any one of the present application, the vector described in any one of the present application and / or the combination described in any one of the present application.

[0043] On the other hand, the present application provides a composition comprising the compound described in any one of the present application, the protein described in any one of the present application, the nucleic acid described in any one of the present application, the synthetase described in any one of the present application, the nucleic acid described in any one of the present application, the vector described in any one of the present application, the combination described in any one of the present application and / or the cell described in any one of the present application, and optionally a pharmaceutically acceptable adjuvant.

[0044] On the other hand, the present application provides a kit comprising the compound described in any one of the present application, the protein described in any one of the present application, the nucleic acid described in any one of the present application, the synthetase described in any one of the present application, the nucleic acid described in any one of the present application, the vector described in any one of the present application, the combination described in any one of the present application, the cell described in any one of the present application and / or the composition described in any one of the present application.

[0045] On the other hand, the present application provides a method for inhibiting the binding of PD-L1 protein to PD-L1 ligand, wherein the method comprises providing a compound described in any one of the present application, a protein described in any one of the present application, a nucleic acid described in any one of the present application, a synthetase described in any one of the present application, a nucleic acid described in any one of the present application, a vector described in any one of the present application, a combination described in any one of the present application, a cell described in any one of the present application, a composition described in any one of the present application, and / or a kit described in any one of the present application. On the other hand, the present application provides a method for cross-linking PD-L1 protein, wherein the method comprises providing a compound described in any one of the present application, a protein described in any one of the present application, a nucleic acid described in any one of the present application, a synthetase described in any one of the present application, a nucleic acid described in any one of the present application, a vector described in any one of the present application, a combination described in any one of the present application, a cell described in any one of the present application, a composition described in any one of the present application, and / or a kit described in any one of the present application.

[0046] On the other hand, the present application provides a method for activating immune cells, wherein the method comprises providing the compound described in any one of the present application, the protein described in any one of the present application, the nucleic acid described in any one of the present application, the synthetase described in any one of the present application, the nucleic acid described in any one of the present application, the vector described in any one of the present application, the combination described in any one of the present application, the cell described in any one of the present application, the composition described in any one of the present application and / or the kit described in any one of the present application.

[0047] On the other hand, the present application provides a method for preparing a compound having the following structure (M):

[0048]

[0049] wherein n is greater than 0, and X is selected from an electron withdrawing group; wherein the method comprises providing a ligase comprising a sequence selected from the group consisting of: SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 25, and SEQ ID NO: 27.

[0050] On the other hand, the present application provides a ligase comprising a sequence selected from the group consisting of: SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 25 and SEQ ID NO: 27, wherein the ligase is used to prepare a compound having the following structure (M):

[0051]

[0052] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0053] Additional aspects and advantages of the present disclosure will become apparent to those skilled in the art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be appreciated, the present disclosure may have other different embodiments, and its several details may be modified in various obvious respects, all without departing from the present disclosure. Therefore, the drawings and description should be regarded as illustrative in nature, and not restrictive.

[0054] Incorporated by Reference

[0055] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] The specific features of the invention involved in this application are shown in the attached claims. The features and advantages of the invention involved in this application can be better understood by referring to the exemplary embodiments and drawings described in detail below. The drawings are briefly described as follows:

[0057] Figure 1 Shown is the general structure of electron-withdrawing fluorine-substituted fluorosulfates with enhanced reactivity.

[0058] Figure 2 Shown is the chemical structure of fluorine-substituted phenylsulfonyl fluoride.

[0059] Figures 3A-3D Shown is an LC analysis of a model reaction to determine the proximity reactivity of fluoro-substituted phenylsulfonyl fluorides.

[0060] Figure 4 Shown are results for the vicinity reactivity of fluorine-substituted phenylsulfonyl fluorides.

[0061] Figure 5 Shown is the specific activity of TPL from different sources towards 2-fluoro-L-tyrosine synthesis.

[0062] Figure 6 Shown is the high efficiency of Cf TPL and Fn TPL in the synthesis of difluoro-substituted L-tyrosine.

[0063] Figure 7 Shown is the chemical structure of fluorine-substituted L-tyrosine synthesized by TPL.

[0064] Figure 8 Shown is the chemical structure of fluorine-substituted fluorosulfate L-tyrosine.

[0065] Figures 9A-9D Shown is an LC analysis of a model reaction to determine the proximity reactivity of fluorosulfated L-tyrosine.

[0066] Fig.10 Shown are results for the proximity reactivity of fluorine-substituted fluorosulfate L-tyrosine.

[0067] Fig.11 A-11C shows the sequencing results of the tRNA synthetase library. After four rounds of positive selection, a major clone V366A for fluorosulfate-2,6-difluoro-L-tyrosine was obtained from the random mutagenesis library. (A) Before selection. (B) After three rounds of positive selection. (C) After an additional round of positive selection.

[0068] Fig.12 Shown is the detection of amber suppression efficiency by GFP reporter gene assay. GFP N194TAG was expressed in the presence of tRNA synthetase and the corresponding PrUAA. The fluorescence intensity of each group was measured by a microplate reader and normalized by the maximum fluorescence intensity.

[0069] Fig.13 Shown is amber suppression efficiency analyzed by Western blotting. GFPN194TAG with a 6xHis tag at the C-terminus was expressed in the presence of tRNA synthetase and the corresponding PrUAA. The fluorescence intensity of each group was measured by a microplate reader and normalized by the maximum fluorescence intensity.

[0070] Fig.14 A-14D shows the results of successful incorporation of PrUAA into Nb-PD-L1 by ESI-MS. (A) For FSY, the measured molecular weight is 16147Da (calculated value is 16148Da). (B) For mF FSY, the measured molecular weight is 16166Da (calculated value is 16147Da). (C) For oF FSY, the measured molecular weight is 16166Da (calculated value is 16166Da). (D) For 2,5-diF FSY, the measured molecular weight is 16183Da (calculated value is 16184Da).

[0071] Fig.15 Shown is a comparison of the cross-linking efficiency of different gluebodies to PD-L1. The purified proteins were incubated with PD-L1 at 37°C for 1 hour before SDS-PAGE and Coomassie blue staining.

[0072] Fig.16 Shown is the quantitative analysis of luciferase activity in T cells after 12 h of co-culture with PD-L1+ aAPCs treated with the indicated protein drugs. Boxes and error bars represent mean ± standard error of the mean (n=3).

[0073] Fig.17 Shown are fluorescence images of 293T cells transfected with pCMV EGFP Y40TAG and tRNA synthetase / tRNA. Cells were incubated with the corresponding PrUAA for 24 hours after transfection and then subjected to fluorescence imaging. Scale bar = 150 μm. DETAILED DESCRIPTION

[0074] Although various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided as examples only. Without departing from the present invention, those skilled in the art may conceive of many variations, changes and replacements. It should be understood that various alternatives to the embodiments of the present invention described herein may be used.

[0075] When substituents are specified by their conventional chemical formula written from left to right, they also encompass chemically identical substituents that would result from writing the structure from right to left, e.g., -CH 2 O- is equivalent to -OCH 2 -.

[0076] Unless otherwise indicated, the term "alkyl" by itself or as part of another substituent means a straight (i.e., unbranched) or branched carbon chain (or carbon), or combinations thereof, which may be fully saturated, monounsaturated, or polyunsaturated, and may include monovalent, divalent, and polyvalent radicals. An alkyl group may include a specified number of carbons (e.g., C 1 -C 10 Meaning one to ten carbons). Alkyl is an uncyclized chain. Examples of saturated hydrocarbon groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, methyl, homologues and isomers, such as n-pentyl, n-hexyl, n-heptyl, etc. Unsaturated alkyl groups are alkyl groups having one or more double or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and higher homologues and isomers. Alkoxy is an alkyl group connected to the remainder of the molecule by an oxygen chain (-O-). The alkyl moiety may be an alkenyl moiety. The alkyl moiety may be an alkynyl moiety. The alkyl moiety may be fully saturated. The alkenyl group may include more than one double bond and / or one or more triple bonds in addition to one or more double bonds. An alkynyl group may include more than one triple bond and / or one or more double bonds in addition to one or more triple bonds.

[0077] Unless otherwise stated, the term "alkenyl" by itself or as part of another substituent means a divalent free radical derived from an alkyl group, such as, but not limited to, -CH2 CH 2 CH 2 CH 2 -. Typically, an alkyl (or alkenyl) group will have from 1 to 24 carbon atoms, with free radicals having 10 or fewer carbon atoms being more preferred. "Lower alkyl" or "lower alkenyl" is a shorter chain alkyl or alkylene group, generally having eight or fewer carbon atoms. Unless otherwise indicated, the term "alkenylene" by itself or as part of another substituent means a divalent free radical derived from an alkene.

[0078] Unless otherwise indicated, "heteroalkyl" by itself or as part of another term means a stable straight or branched chain, or combination thereof, comprising at least one carbon atom and at least one heteroatom (e.g., O, N, P, Si, and S), and wherein the nitrogen and sulfur atoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quaternized. The heteroatom (e.g., N, S, Si, or P) may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the rest of the molecule. A heteroalkyl group is a non-cyclized chain. Examples include, but are not limited to: -CH 2 -CH 2 -O-CH 3 、-CH 2 -CH 2 -NH-CH 3 、-CH 2 -CH 2 -N(CH 3 )-CH 3 、-CH 2 -S-CH 2 -CH 3 、-CH 2 -CH 2 、-S(O)-CH 3 、-CH 2 -CH 2 -S(O) 2 -CH 3 、-CH=CHO-CH 3 、-Si(CH 3 ) 3 、-CH 2 -CH=N-OCH 3 、-CH=CH-N(CH 3 )-CH 3 、-O-CH 3 、-O-CH 2 -CH 3 and -CN. It can have up to two or three heteroatoms in a row, for example, -CH 2 -NH-OCH 3and -CH 2 -O-Si(CH3) 3 . The heteroalkyl moiety may include 1, 2, 3, 4, or 5 heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may include up to 8 optionally different heteroatoms (e.g., O, N, S, Si, or P). Unless otherwise specified, the term "heteroalkenyl" by itself or as part of another term means a heteroalkyl group that includes at least one double bond. The heteroalkenyl group may optionally include one or more double bonds and / or one or more triple bonds in addition to one or more double bonds. Unless otherwise specified, the term "heteroalkynyl" by itself or as part of another term means a heteroalkyl group that includes at least one triple bond. The heteroalkynyl group may optionally include one or more triple bonds and / or one or more double bonds in addition to one or more triple bonds.

[0079] Unless otherwise stated, "heteroalkylene" by itself or as part of another term means a divalent radical derived from heteroalkyl, such as, but not limited to, -CH 2 -CH 2 -S-CH2-CH 2 -and-CH 2 -S-CH 2 -CH 2 -NH-CH 2 -. For heteroalkylene groups, heteroatoms may also occupy one or both of the chain ends (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, etc.). In addition, for alkylene and heteroalkylene linking groups, the direction in which the formula of the linking group is written does not imply the orientation of the linking group. For example, the formula -C(O)2R' represents -C(O)2R'- and -R'C(O)2-. As described above, as used herein, heteroalkyl groups include groups that are connected to the remainder of the molecule through heteroatoms, such as -C(O)R', -C(O)NR', ​​-NR'R", -OR', -SR' and / or -SO 2 R'. Where "heteroalkyl" is described after describing a specific heteroalkyl group such as -NR'R", it should be understood that the terms heteroalkyl and -NR'R" are not redundant or mutually exclusive. Rather, the specific heteroalkyl group is described for added clarity. Therefore, the term "heteroalkyl" should not be interpreted herein to exclude specific heteroalkyl groups, such as -NR'R", etc.

[0080] Unless otherwise indicated, the terms "cycloalkyl" and "heterocycloalkyl" by themselves or in combination with other terms mean cyclic versions of "alkyl" and "heteroalkyl", respectively. Neither cycloalkyl nor heterocycloalkyl is aromatic. Additionally, for heterocycloalkyl, a heteroatom may occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridinyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothiophen-2-yl, tetrahydrothiophen-3-yl, 1-piperazinyl, 2-piperazinyl, and the like. "Cycloalkylene" and "heterocycloalkylene" when used alone or as part of another substituent refer to a divalent radical derived from cycloalkyl and heterocycloalkyl, respectively.

[0081] In embodiments, the term "cycloalkyl" means a monocyclic, bicyclic or polycyclic cycloalkyl ring system. In some aspects, the monocyclic ring system is an annular hydrocarbon group containing 3 to 8 carbon atoms, wherein such groups can be saturated or unsaturated, but not aromatic. In some aspects, the cycloalkyl group is fully saturated. Examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl and cyclooctyl. The bicyclic cycloalkyl ring system is a bridged monocyclic ring or a fused bicyclic ring. In some aspects, the bridged monocyclic ring comprises a monocyclic cycloalkyl ring, wherein two non-adjacent carbon atoms of the monocyclic ring are connected by an alkylene bridge containing 1 to 3 additional carbon atoms (i.e., in the form of (CH2) w wherein w is 1, 2 or 3).

[0082] In embodiments, cycloalkyl is cycloalkenyl. The term "cycloalkenyl" is used in its ordinary sense. In certain aspects, cycloalkenyl is a monocyclic, bicyclic or polycyclic cycloalkenyl ring system. In certain aspects, a monocyclic cycloalkenyl ring system is an cyclic hydrocarbon group containing 3 to 8 carbon atoms, wherein such group is unsaturated (i.e., contains at least one cyclic carbon-carbon double bond), but is not aromatic.

[0083] In an embodiment, heterocycloalkyl is a heterocyclic radical. As used herein, the term "heterocyclic radical" means a monocyclic, bicyclic or polycyclic heterocycle. A heterocyclic monocyclic heterocycle is a 3, 4, 5, 6 or 7-membered ring containing at least one heteroatom (independently selected from the group consisting of: O, N and S), wherein the ring can be saturated or unsaturated, but not aromatic.

[0084]

[0043] The terms "halo" or "halogen," by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.

[0085] Unless otherwise indicated, the term "acyl" means -C(O)R, where R is substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0086] Unless otherwise indicated, the term "aryl" means a polyunsaturated aromatic hydrocarbon substituent, which can be a monocyclic ring or polycyclic rings (preferably 1 to 3 rings) fused together or covalently bonded (i.e., fused ring aryl). A fused ring aryl refers to a plurality of rings fused together, wherein at least one ring in the fused ring is an aryl ring. The term "heteroaryl" refers to an aryl group (or ring) containing at least one heteroatom (such as N, O or S), wherein the nitrogen atom and the sulfur atom are optionally oxidized, and the nitrogen atom is optionally quaternized.

[0087] Each of the above terms (eg, "alkyl," "heteroalkyl," "cycloalkyl," "heterocycloalkyl," "aryl," and "heteroaryl") include both substituted and unsubstituted forms of the indicated radical.

[0088] Ring substituents (e.g., cycloalkyl, heterocycloalkyl, aryl, heteroaryl, cycloalkylene, heterocycloalkylene, arylene, or heteroarylene) can be depicted as substituents on the ring rather than on a specific atom of the ring (often referred to as floating substituents).

[0089] Two or more substituents may optionally be linked to form an aryl, heteroaryl, cycloalkyl or heterocycloalkyl group. Such so-called ring-forming substituents are typically (but not necessarily) linked to a cyclic base structure.

[0090] In an embodiment, each substituted group described in the compounds herein is substituted by at least one substituent group. More specifically, in some aspects, each substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene and / or substituted heteroarylene described in the compounds herein is substituted by at least one substituent group. In some aspects, at least one or all of these groups are substituted by at least one substituent group of limited size. In some aspects, at least one or all of these groups are substituted by at least one low-priced substituent group.

[0091] Certain compounds of the present disclosure have asymmetric carbon atoms (optical or chiral centers) or double bonds; enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisomeric forms that can be defined in absolute stereochemistry as (R)- or (S)- or as (D)- or (L)- for amino acids, and individual isomers are included within the scope of the present disclosure. The compounds of the present disclosure do not include those known in the art to be too unstable to synthesize and / or separate. The present disclosure is intended to include compounds in racemic and optically pure forms. Optically active (R)- and (S)-isomers or (D)- and (L)-isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, unless otherwise indicated, the compounds include both E and Z geometric isomers.

[0092] As used herein, the term "isomers" refers to compounds that have the same number and kind of atoms, and therefore the same molecular weight, but differ in the structural arrangement or configuration of the atoms.

[0093] As used herein, the term "tautomer" refers to one of two or more structural isomers that exist in equilibrium and can be readily converted from one isomeric form to another.

[0094] Unless otherwise stated, structures depicted herein are also intended to include all stereochemical forms of the structure; i.e., the R and S configurations for each asymmetric center. Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope of the present disclosure.

[0095] Unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence or absence of one or more isotopically enriched atoms. For example, in addition to replacing a hydrogen with a deuterium or tritium, or replacing a carbon with a 13 C or 14 Compounds having the structures of the present invention except for C-enriched carbon are within the scope of the present disclosure.

[0096] The compounds of the present disclosure may also contain isotopes present in unnatural proportions on one or more atoms that constitute such compounds. For example, these compounds may be substituted with radioactive isotopes such as, for example, tritium ( 3 H), iodine-125 ( 125 I) or carbon-14 ( 14 C) Labeling. All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are within the scope of the present invention.

[0097] It should be noted that throughout the application, alternatives are written in Markush groups, for example, each amino acid position that contains more than one possible amino acid. It is specifically contemplated that each member of the Markush group should be considered separately to constitute another embodiment, rather than treating the Markush group as a single unit.

[0098] "Analog" or "analog" is used according to its ordinary meaning in chemistry and biology to refer to a compound that is structurally similar to another compound (the so-called "reference" compound) but differs in composition (e.g., by replacing an atom with an atom of a different element) or in the presence of specific functional groups, or by replacing one functional group with another, or in the absolute stereochemistry of one or more chiral centers of the reference compound. Thus, an analog is a compound that is similar or comparable in function and appearance, but different in structure or origin from the reference compound.

[0099] As used herein, "a" or "an" means one or more. As used herein, the phrase "substituted by" means that the specified group can be replaced with one or more of any or all of the substituents mentioned. For example, when a group (such as an alkyl or heteroaryl group) is "substituted by an unsubstituted C 1 -C 20 In the case of "substituted with" an unsubstituted 2 to 20-membered alkyl or unsubstituted 2 to 20-membered heteroalkyl, the group may contain one or more unsubstituted C 1 -C 20 alkyl, and / or one or more unsubstituted 2 to 20 membered heteroalkyl groups.

[0100] In addition, where a moiety is substituted with an R substituent, the group may be referred to as "R-substituted". Where a moiety is R-substituted, the moiety is substituted with at least one R substituent, and each R substituent is optionally different. Where there is one particular R group when describing a chemical species such as Formula (I), the Roman letter symbol may be used to distinguish each occurrence of the particular R group. For example, where there are multiple R 13 In the case of a substituent, each R 13 Substituents can be divided into R 13A , R 13B , R 13C , R 13D etc., where R 13A , R 13B , R 13C , R 13D Each of the above is in R 13 and optionally are different.

[0101] The description of the compounds of the present disclosure is limited by the principles of chemical bonding known to those skilled in the art. Thus, where a group may be substituted by one or more of a plurality of substituents, such substitutions are selected to conform to the principles of chemical bonding and to produce compounds that are not inherently unstable and / or that would be considered by one of ordinary skill in the art to be potentially unstable under environmental conditions such as aqueous, neutral, and several known physiological conditions. For example, a heterocycloalkyl or heteroaryl group is attached to the rest of the molecule via a ring heteroatom, according to the principles of chemical bonding known to those skilled in the art, thereby avoiding inherently unstable compounds.

[0102] One of ordinary skill in the art will understand that when a variant (e.g., a moiety or linker) of a compound or a genus of compounds (e.g., a genus described herein) is described by the name or formula of a separate compound with all valences filled in, the unfilled valences of the variant will be determined by the context. For example, when a variant of a compound described herein is attached (e.g., bonded) to the rest of the compound by a single bond, the variant is understood to represent the monovalent form of the separate compound (i.e., capable of forming a single bond due to the unfilled valences) (e.g., if the variant is named "methane" in one embodiment, but the variant is known to be attached to the rest of the compound by a single bond, one of ordinary skill in the art will understand that the variant is actually the monovalent form of methane, i.e., methyl or -CH 3 ).

[0103] As described herein, sequence complementarity can be partial, i.e., only some of the nucleic acids match according to base pairing, or complete, in which all nucleic acids match according to base pairing. Thus, two sequences that are complementary to each other may have a certain percentage of identical nucleotides (i.e., about 60% identity over a specified region, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity).

[0104] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and mimetics that function similarly to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are subsequently modified, such as hydroxyproline, -carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as naturally occurring amino acids, i.e., an α-carbon bound to a hydrogen, a carboxyl group, an amino group, and an R group (e.g., homoserine, norleucine, methionine sulfoxide, methionine methylsulfide). Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as naturally occurring amino acids. Amino acid mimetics refer to compounds that have a structure that is different from the general chemical structure of an amino acid, but function similarly to naturally occurring amino acids. The terms "non-naturally occurring amino acids" and "non-natural amino acids" refer to amino acid analogs, synthetic amino acids, and amino acid mimetics that are not found in nature.

[0105] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, which in embodiments may be conjugated to a moiety that does not consist of amino acids. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers and non-natural amino acid polymers.

[0106] In one aspect, the present application provides a compound having structural formula (I):

[0107]

[0108] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0109] On the other hand, the present application provides a compound having structural formula (II):

[0110]

[0111] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0112] For example, an electron withdrawing group (EWG) can withdraw electrons from the reaction center. When the center is an electron-rich carbon anion or an alkoxide anion, the presence of the electron withdrawing substituent plays a stabilizing role. Examples of electron withdrawing groups can be halogens (e.g., F, Cl).

[0113] For example, the compound can be a biomolecule. For example, the compound can be a protein having the above structure. For example, the compound can be a protein having a non-natural amino acid having the above structure. For example, the compound can use the above structure as an intermolecular linker. For example, the compound can use the above structure as an intramolecular linker.

[0114] For example, wherein the structure (I) and / or structure (II) and the linking group R 1 Connect the R 1 is an optionally substituted substituent. For example, the compound may be a protein having a non-natural amino acid having the structure described above. 1 It may be an R chain of amino acids. For example, the structure (I) and / or the structure (II) may be linked to an R chain of amino acids.

[0115] For example, the R 1 is a bond or is selected from the group consisting of: -S(O) 2 -、-NR 1A -, -O-, -S-, -C(O)-, -C(O)NR 1A -、-NR 1A C(O)-、-NR 1A C(O)NR 1B -, -C(O)O-, -OC(O)-, optionally substituted alkylene, optionally substituted heteroalkylene, optionally substituted cycloalkylene, optionally substituted heterocycloalkylene, optionally substituted arylene, and optionally substituted heteroarylene, wherein R 1A and R 1B Each is independently hydrogen, optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl or optionally substituted heteroaryl.

[0116] For example, where the linking group R 1 Connected to the linker R 2 , the R 2 is an optionally substituted substituent. For example, the compound may be a protein having a non-natural amino acid having the structure described above. 2 It can be a peptide bond of an amino acid.

[0117] For example, the R 2 is a bond or is selected from the group consisting of an optionally substituted peptide moiety, an optionally substituted nucleic acid moiety and an optionally substituted carbohydrate moiety.

[0118] For example, wherein the structure (I) and / or structure (II) is connected to the R 2 connect.

[0119] In another aspect, the present application provides a compound having structure (IA):

[0120]

[0121] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0122] In another aspect, the present application provides a compound having structure (IP):

[0123]

[0124] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0125] On the other hand, the present application provides a compound having the following structure (II-A):

[0126]

[0127] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0128] On the other hand, the present application provides a compound having the following structure (II-P):

[0129]

[0130] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0131] For example, wherein the n is selected from the group consisting of 1, 2, 3 and 4. For example, wherein the n is 1. For example, wherein the n is 2. For example, wherein the n is 3. For example, wherein the n is 4.

[0132] For example, wherein the compound has the following structure:

[0133]

[0134] For example, wherein the compound has the following structure:

[0135]

[0136] For example, the structure may have better reactivity.

[0137] For example, wherein the compound has the following structure:

[0138] For example, wherein the compound has the following structure:

[0139]

[0140] On the other hand, the present application provides a compound having the following structure: Wherein, the X is selected from electron withdrawing groups.

[0141] In another aspect, the present application provides a compound having the following structure:

[0142] Here, X is a self-electron-withdrawing group.

[0143] For example, wherein each of the X is independently halogen.

[0144] For example, wherein each X is independently F.

[0145] For example, wherein the compound has the following structure:

[0146] For example, wherein the compound has the following structure: For example, the structure may have better reactivity.

[0147] For example, wherein the compound has the following structure:

[0148] For example, wherein the compound has the following structure:

[0149] For example, wherein the compound has the following structure:

[0150] For example, wherein the compound has the following structure:

[0151] For example, wherein the compound has the following structure:

[0152] For example, wherein the compound has the following structure:

[0153] For example, wherein the compound has the following structure:

[0154] For example, wherein the compound has the following structure:

[0155] For example, wherein the compound has the following structure:

[0156] For example, wherein the compound has the following structure:

[0157]

[0158] In another aspect, the present application provides a protein comprising the structure of any one of the compounds described in the present application.

[0159] In another aspect, the present application provides a protein comprising a non-natural amino acid having the following structure (I):

[0160]

[0161] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0162] For example, wherein the protein comprises an unnatural amino acid having the structure of a compound described in any one of the present application.

[0163] In another aspect, the present application provides a protein comprising an unnatural amino acid having the following structure:

[0164]

[0165] For example, wherein the protein comprises the unnatural amino acid at position 108 as shown in the sequence of the PD-L1 binding protein or a fragment thereof.

[0166] For example, wherein the protein comprises the unnatural amino acid at position 108 as shown in the sequence of the anti-PD-L1 Nanobody or a fragment thereof.

[0167] For example, wherein the protein comprises the unnatural amino acid at position 108 as shown in the sequence of SEQ ID NO: 1. For example, wherein the protein may further comprise p62, LC3, the nucleotide 8-nitro cyclic guanosine monophosphate (8-nitro-cGMP), mannose-6-phosphate, N-acetylgalactosamine (GalNAc), a cell penetrating peptide and / or a lysosomal sorting sequence.

[0168] On the other hand, the present application provides a nucleic acid comprising a sequence encoding the protein described in any one of the present application.

[0169] On the other hand, the present application provides a synthetase comprising a mutant located at position 366 and / or position 367 as shown in the sequence of SEQ ID NO:29.

[0170] On the other hand, the present application provides a synthetase comprising alanine at position 366 and / or position 367 as shown in the sequence of SEQ ID NO: 29. For example, the amino acid of the synthetase of the present application comprises alanine instead of the original chFSYRS. For example, the amino acid of the synthetase of the present application comprises alanine instead of the original amino acid of SEQ ID NO: 29.

[0171] On the other hand, the present application provides a synthetase comprising the sequence of SEQ ID NO: 31 and / or 34.

[0172] On the other hand, the present application provides a nucleic acid comprising a sequence encoding the synthetase described in any one of the present invention.

[0173] On the other hand, the present application provides a nucleic acid comprising the sequence of SEQ ID NO: 30 and / or 33.

[0174] On the other hand, the application provides a vector comprising the nucleic acid described in any one of the present applications.

[0175] In another aspect, the present application provides a combination comprising the synthetase described in any one of the present application and the compound described in any one of the present application.

[0176] On the other hand, the present application provides a method for preparing the protein described in any of the present application, wherein the method comprises providing the synthetase described in any of the present application, the compound described in any of the present application and / or the combination described in any of the present application.

[0177] On the other hand, the present application provides a cell comprising the compound described in any one of the present application, the protein described in any one of the present application, the nucleic acid described in any one of the present application, the synthetase described in any one of the present application, the nucleic acid described in any one of the present application, the vector described in any one of the present application and / or the combination described in any one of the present application.

[0178] On the other hand, the present application provides a composition comprising the compound described in any one of the present application, the protein described in any one of the present application, the nucleic acid described in any one of the present application, the synthetase described in any one of the present application, the nucleic acid described in any one of the present application, the vector described in any one of the present application, the combination described in any one of the present application and / or the cell described in any one of the present application, and optionally a pharmaceutically acceptable adjuvant.

[0179] On the other hand, the present application provides a kit comprising the compound described in any one of the present application, the protein described in any one of the present application, the nucleic acid described in any one of the present application, the synthetase described in any one of the present application, the nucleic acid described in any one of the present application, the vector described in any one of the present application, the combination described in any one of the present application, the cell described in any one of the present application and / or the composition described in any one of the present application.

[0180] On the other hand, the present application provides a method for inhibiting the binding of PD-L1 protein to PD-L1 ligand, wherein the method comprises providing a compound described in any one of the present application, a protein described in any one of the present application, a nucleic acid described in any one of the present application, a synthetase described in any one of the present application, a nucleic acid described in any one of the present application, a vector described in any one of the present application, a combination described in any one of the present application, a cell described in any one of the present application, a composition described in any one of the present application, and / or a kit described in any one of the present application. On the other hand, the present application provides a method for cross-linking PD-L1 protein, wherein the method comprises providing a compound described in any one of the present application, a protein described in any one of the present application, a nucleic acid described in any one of the present application, a synthetase described in any one of the present application, a nucleic acid described in any one of the present application, a vector described in any one of the present application, a combination described in any one of the present application, a cell described in any one of the present application, a composition described in any one of the present application, and / or a kit described in any one of the present application.

[0181] On the other hand, the present application provides a method for activating immune cells, wherein the method comprises providing the compound described in any one of the present application, the protein described in any one of the present application, the nucleic acid described in any one of the present application, the synthetase described in any one of the present application, the nucleic acid described in any one of the present application, the vector described in any one of the present application, the combination described in any one of the present application, the cell described in any one of the present application, the composition described in any one of the present application, and / or the kit described in any one of the present application. .

[0182] For example, wherein the immune cell comprises a T cell.

[0183] For example, wherein the activation is detected by a luciferase assay.

[0184] For example, wherein the method may be an in vitro method.

[0185] On the other hand, the present application provides a method for preparing a compound having the following structure (M):

[0186] wherein n is greater than 0, and X is selected from an electron withdrawing group, wherein the method comprises providing a ligase comprising a sequence selected from the group consisting of: SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 25, and SEQ ID NO: 27.

[0187] On the other hand, the present application provides a ligase comprising a sequence selected from the group consisting of: SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 25 and SEQ ID NO: 27, the ligase is used to prepare a compound having the following structure (M):

[0188] Wherein, n is greater than 0, and X is selected from electron withdrawing groups.

[0189] For example, wherein the method comprises providing a ligase encoded by a sequence selected from the group consisting of: SEQ ID NO:14, SEQ ID NO:20, SEQ ID NO:24 and SEQ ID NO:26.

[0190] For example, wherein n is selected from the group consisting of: 1, 2, 3 and 4.

[0191] For example, wherein the compound comprises the following structure:

[0192]

[0193]

[0194] For example, wherein each X is independently halogen.

[0195] For example, wherein each X is independently F. For example, wherein the compound comprises the following structure:

[0196]

[0197] Example

[0198] The following examples are intended to provide a complete disclosure and description to one of ordinary skill in the art for how to make and use the invention, and are not intended to limit the scope of what the inventors believe to be their invention, nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure the accuracy of the numbers (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be considered. Unless otherwise indicated, parts are parts by weight, molecular weights are weight average molecular weights, temperatures are in degrees Celsius, and pressures are at or near atmospheric pressure. Standard abbreviations may be used, such as bp: base pair; kb: kilobase; pl: picoliter; s or sec: second; min: minute; h or hr: hour; aa: amino acid; nt: nucleotide; im: intramuscular; ip: intraperitoneal; sc: subcutaneous; and the like.

[0199] Example 1

[0200] Development of fluorine-substituted fluorosulfates with enhanced vicinity reactivity

[0201]

[0202] 5.5 g of fluorinated phenol was dissolved in 50 mL of DCM and 10 mL of Et 3 N (1.5 eq.) was added. The mixture was stirred at room temperature for 10 min. Then, the atmosphere above the solution was removed by slight vacuum, and SO was introduced from a balloon filled with gas using a needle. 2 F 2 The reaction mixture was stirred vigorously at room temperature for 6-72 hours and monitored by TLC.

[0203] Phenylsulfonyl fluoride

[0204] 1 H NMR (400MHz, DMSO) δ7.63-7.55(m,4H),7.55-7.47(m,1H). 13 C NMR (101MHz, DMSO) δ150.22(s), 131.33(s), 129.70(s), 121.48(s). 19 F NMR(377MHz,DMSO)δ38.24.MS:175.0[C 6 H 4 FO 3 S] - .

[0205] like Figure 1 As shown, the present application provides an electron-withdrawing fluorine-substituted fluorosulfate with enhanced reactivity.

[0206] like Figure 2As shown, the present application provides the chemical structure of fluorine-substituted phenylsulfonyl fluoride.

[0207] 2-Fluorophenylsulfonyl fluoride

[0208] 1 H NMR (400MHz, DMSO) δ7.70-7.57(m,2H),7.43(d,2H). 13 C NMR (101MHz, DMSO) δ163.88,161.41,150.13,132.65,118.15-116.96,116.89,110.22,110.02-108.68. 19 F NMR(377MHz,DMSO)δ38.79.MS:193.0[C 6 H 3 F 2 O 3 S] - .

[0209] 3-Fluorophenylsulfonyl fluoride

[0210] 1 H NMR (400MHz, DMSO) δ7.79(t,1H),7.64-7.52(m,2H),7.44-7.35(m,1H). 13 CNMR(101MHz,DMSO)δ154.39,151.89,136.83,131.65,126.60,124.15,118.51. 19 F NMR(377MHz,DMSO)δ39.41,-129.92.MS:193.0[C 6 H 3 F 2 O 3 S] - .

[0211] 2,6-Difluorophenylsulfonyl fluoride

[0212] 1H NMR (400MHz, DMSO) δ7.64(dt,1H),7.49(t,2H). 13 C NMR (101MHz, DMSO) δ155.53,153.00,131.68,125.76,114.19. 19 F NMR(377MHz,DMSO)δ41.12,-126.70.MS:211.0[C 6 H 2 F 3 O 3 S]- .

[0213] 2,5-Difluorophenylsulfonyl fluoride

[0214] 1 H NMR (400MHz, DMSO) δ7.92(ddd,1H),7.68(td,1H),7.47(ddt,1H). 13 C NMR (101MHz, DMSO) δ159.24,156.79,151.27,148.81,136.47,119.44,118.36,55.24. 19 F NMR(377MHz,DMSO)δ40.29,-113.99,-134.31.MS:211.0[C 6 H 2 F 3 O 3 S] - .

[0215] 2,3-Difluorophenylsulfonyl fluoride

[0216] 1 H NMR (400MHz, DMSO) δ7.73-7.59 (m, 2H), 7.44 (tdd, 1H). 13 C NMR (101MHz, DMSO) δ152.02,149.53,143.76,141.31,126.01,119.67,119.08,55.25. 19 F NMR(377MHz,DMSO)δ39.90,-134.30,-152.73.MS:211.2[C 6 H 2 F 3 O 3 S] - .

[0217] 3,5-Difluorophenylsulfonyl fluoride

[0218] 1 H NMR (400MHz, DMSO) δ7.65-7.55(m,2H),7.50(tt,1H). 13 C NMR (101MHz, DMSO) δ164.26,150.17,131.27,107.20,107.00,105.97. 19 F NMR(377MHz,DMSO)δ39.50,-106.03.MS:211.1[C 6 H 2 F3 O 3 S] - .

[0219] 2,3,6-Trifluorophenylsulfonyl fluoride

[0220] 1 H NMR (400MHz, DMSO) δ7.77(tdd,1H),7.57(tdd,1H). 13 C NMR (101MHz, DMSO) δ151.73,149.24,148.40,145.95,144.63,142.08,126.53,118.81,113.25.

[0221] 19 F NMR(377MHz,DMSO)δ41.61,-130.78,-138.40,-147.59.MS:229.1[C 6 H 1 F 4 O 3 S] - .

[0222] LC Analysis of Model Reactions to Determine the Proximity Reactivity of Phenylsulfonyl Fluoride

[0223]

[0224] To test the proximity reactivity of fluorinated phenylsulfonyl fluoride toward nucleophilic groups, a model reaction was designed in which the concentration of imidazole was 100 times that of sulfuryl fluoride to accelerate the reaction. 3 CN solution was mixed with 900 μL 110 mM imidazole solution (pH 8.5) in a 1.5 mL EP tube. The tube was placed in a thermal oscillator and reacted at 30° C. with 1000 rpm for 4 hours. The mixture was analyzed by UPLC, the absorption of the phenyl group at 260 nm was monitored, and the conversion was calculated using the following formula: product peak area / (product peak area+reactant peak area)×100%.

[0225] As in Figures 3A-3D and Figure 4 As summarized in , both the position and number of electron-withdrawing fluorine atoms have an effect on the reactivity of sulfuryl fluoride. In particular, single fluorine substitution only slightly accelerates the reaction, while double fluorine substitution significantly accelerates the reaction.

[0226] Example 2

[0227] Chemoenzymatic Synthesis of Fluorosulfate-L-Tyrosine Substituted with Fluorine

[0228] Construction of plasmid encoding tyrosine phenol lyase (TPL) mutant

[0229] The amino acid sequence encoding TPL was obtained from the Uniprot (www.uniprot.org) database, patents (CN109897845A) and literature (European Journal of Organic Chemistry, 2020, 8, 1050-1054; Journal of Industrial Microbiology and Biotechnology, 2019, 12, 1631-1641). The corresponding DNA sequence was synthesized by GENEWIZ (Shanghai, China) and codon optimized using Escherichia coli (E. coli) as the host. The synthesized gene carried a 6×His tag at the N-terminus and was flanked by Nco I and Not I endonuclease sites. The gene was digested with two corresponding restriction enzymes and inserted into a pre-digested vector pET-28a(+) with the same restriction enzymes (called pET-28a(+)-XX TPL plasmid).

[0230] Tyrosine phenol lyase SEQ ID NO: Ci TPL M379V gene 12 Ci TPL M379V protein 13 Ci TPL E313M gene 14 Ci TPL E313M protein 15 St TPL M380V Gene 16 St TPL M380V Protein 17 Eh TPL S20C N161S gene 18 Eh TPL S20C N161S protein 19 Ki TPL M66V M288I gene 20 Ki TPL M66V M288I protein 21 Mm TPL gene 22 Mm TPL protein 23 Fn-TPL gene 24 Fn-TPL protein 25 Cf TPL gene 26 Cf TPL protein 27

[0231] Preparation of Escherichia coli overexpressing TPL

[0232] Plasmid pET-28a(+)-XX TPL was transformed into BL21(DE3) by heat shock method. Transformants were plated on LB-kanamycin agar plates and incubated overnight at 37°C. Single colonies were inoculated into 10 mL LB medium containing 50 μg / mL kanamycin at 37°C. The next day, 10 mL of overnight cell culture was diluted into 1 L of fresh LB medium and stirred vigorously at 37°C. When OD600 reached 0.4-0.6, IPTG was added to a final concentration of 0.5 mM and then induced at 30°C for 12 hours. Cells were collected by centrifugation at 6,000g for 20 minutes and stored in a -80°C refrigerator before use.

[0233] General procedure for the synthesis of fluorinated tyrosine via TPL catalysis in a fed-batch process

[0234]

[0235] Fluoro-substituted tyrosine was biosynthesized in a 100 mL reaction mixture containing 50 mM sodium pyruvate, 50 mM ammonium chloride, 10 mM fluorophenol, 1.0 mM PLP, 0.1 g / L Triton X-100, 2.0 g / L sodium EDTA, and 15.0 g / L recombinant E. coli, with pH adjusted to 8.5 by ammonia. The reaction was shaken at 170 rpm at 30°C for 24 hours. During the reaction, 5.0 g / L sodium pyruvate, 2.0 g / L fluorophenol, and 3.5 g / L ammonium chloride were added every 4 hours. 19The reaction was monitored by F NMR.

[0236] After the synthesis reaction is completed, the pH value is adjusted to 1-2 with 6mol / L hydrochloric acid solution, and vigorously stirred for 1 hour, and then filtered to remove the precipitate. The filtrate is then collected and gradually titrated to pH 7.0 with ammonia (25-28%). Excess water is removed under reduced pressure until the residue is about 100mL. Thereafter, the L-tyrosine derivative generated during the ammonia titration is filtered and recovered, washed twice with ice-cold water, and once more with ethanol, and then dried at 60°C.

[0237] like Figure 5 As shown, the present application provides the specific activity of TPL from different sources on 2-fluoro-L-tyrosine synthesis.

[0238] like Figure 6 As shown, the present application shows that Cf TPL and Fn TPL exhibit high efficiency in the synthesis of difluoro-substituted L-tyrosine.

[0239] like Figure 7 As shown, the present application provides the chemical structure of the TPL-catalyzed synthesis of fluorine-substituted L-tyrosine.

[0240] 3-Fluoro-L-tyrosine

[0241] 1 H NMR (400 MHz, D 2 O)δ6.59(d,1H),6.54-6.45(m,2H),3.89-3.81(m,1H),2.78(dd,5.6Hz,1H),2.67(dd,1H); 19 F NMR (377MHz, D 2 O)δ-136.80(dt,7.7Hz); MS:198.3[C 9 H 9 FNO 3 ] - .

[0242] 2-Fluoro-L-tyrosine

[0243] 1 H NMR (400 MHz, D 2 O)δ6.71(dd,1H),6.25-6.19(m,2H),3.87(t,1H),2.85(dd,1H),2.71(dd,1H); 13 C NMR (101MHz, D 2O) δ170.79,162.65,160.23,156.69,132.15,112.00-111.29,103.10,102.85,52.95,28.58; 19 F NMR (377MHz, D 2 O)δ-115.85--116.00; MS:198.2[C 9 H 9 FNO 3 ] - .

[0244] 3,5-Difluoro-L-tyrosine

[0245] 19 F NMR (377MHz, D 2 O)δ-132.86--133.09(m); MS:216.3[C 9 H 8 F 2 NO 3 ] - .

[0246] 2,5-Difluoro-L-tyrosine

[0247] 1 H NMR (400 MHz, D 2 O)δ6.72(dd,1H),6.43(dd,1H),3.97(t,1H),2.93(dd,1H),2.79(dd,1H); 19 F NMR (377MHz, D 2 O)δ-121.24--121.43,-142.09; MS:218.1[C 9 H 10 F 2 NO 3 ] + .

[0248] 2,3-Difluoro-L-tyrosine

[0249] 1 H NMR (400 MHz, D 2 O)δ6.46(td,1H),6.30(t,1H),3.85(t,1H),2.86(dd,1H),2.72(dd,1H); 19 F NMR (377MHz, D 2 O)δ-141.33,-161.29--161.54; MS:216.3[C 9 H 8 F2 NO 3 ] - .

[0250] 2,6-Difluoro-L-tyrosine

[0251] 1 H NMR (400 MHz, D 2 O)δ6.24-6.14(m,2H),3.94(t,1H),2.93(dd,1H),2.86(dd,1H); 19 F NMR (377MHz, D 2 O)δ-114.41(d,J=9.4Hz); MS:216.2[C 9 H 8 F 2 NO 3 ] - .

[0252] General procedure for the synthesis of fluorine-substituted fluorosulfate-L-tyrosine from fluorine-substituted L-tyrosine

[0253]

[0254] 5 g of fluorinated L-tyrosine was dissolved in 50 mL of 1 M NaOH and 50 mL of dioxane, and then 10 mL of (Boc) was added dropwise under stirring at room temperature. 2 O (1 eq) 2h. The mixture was stirred for another 1h. Then, the solvent was removed under reduced pressure, and the residue was dissolved in 100 mL DCM and washed with 0.1 N HCl (2×75 mL) and saturated NaCl solution (2×75 mL). After collecting the aqueous layer and removing the solvent, it was used directly in the subsequent reaction without further purification.

[0255] A 2L two-necked round-bottom flask equipped with a magnetic stir bar was added with 5 mmol of Boc-protected fluorinated L-tyrosine, 200 mL of CH 2 Cl 2 and 800 mL of saturated borax solution. The mixture was stirred vigorously for 20 min. The reaction system was evacuated until the biphasic solution began to degas and SO 2 F 2 Repeat the filling 3 times. The reaction mixture was stirred vigorously at room temperature overnight. CH 2 Cl 2. Then, 1M HCl (210mL) aqueous solution was slowly added to the reaction mixture while stirring to precipitate a white solid. The mixture was filtered and the solid was washed with ice-cold water (3×75mL). The white solid was vacuum dried overnight to obtain Boc-protected fluorine-substituted fluorosulfate-L-tyrosine, which was used directly in the next step without further purification. 5mmol of Boc-protected fluorine-substituted fluorosulfate-L-tyrosine was treated with 4M HCl in dioxane (11mL) and the reaction mixture was stirred at room temperature for 4h, after which 50mL of ether was added to the mixture if no white solid precipitated. The solid was filtered and washed with cold ether (2×10mL) to obtain the target fluorine-substituted L-tyrosine hydrochloride. The product was analyzed by LC-MS and further purified by reverse phase preparative HPLC.

[0256] like Figure 8 As shown, the present application provides the chemical structure of fluorine-substituted fluorosulfate L-tyrosine.

[0257] Fluorosulfate-L-Tyrosine

[0258] 1H NMR (400MHz, D2O): δ (ppm) 3.23-3.41 (m, 2H), 4.32-4.34 (m, 1H), 7.45-7.53 (m, 4H); 13C NMR (400MHz, D2O): δ (ppm) 38.9, 57.2, 125.0, 135.3, 139.5, 153.5, 173.3; 19FNMR (400MHz, D2O): δ (ppm) 38.9, 57.2; MS: 264.0[M+H] + .

[0259] Fluorosulfate-L-Tyrosine

[0260] 1 H NMR (400 MHz, D 2 O)δ7.38(s,4H),4.28(dd,1H),3.34-3.24(m,1H),3.19(dd,1H); 13 C NMR (101MHz, D 2 O)δ171.04,149.44,135.18,131.51,121.59,66.53,53.82,34.87; 19 FNMR (377MHz, D 2 O)δ37.49;MS:262.2[C 9 H 9 FNO 5 S] - .

[0261] Fluorosulfate-3-fluoro-L-tyrosine

[0262] 1 H NMR (500 MHz, D 2 O): δ (ppm) 3.21-3.25 (m, 1H), 3.32-3.36 (m, 1H), 4.21-4.24 (t, 1H), 7.22-7.58 (m, 3H); 13 C NMR (500MHz, D 2 O): δ (ppm) 35.24, 54.28, 118.79, 123.79, 126.55, 136.30, 137.86, 153.14, 171.66; 19 F NMR (500MHz, D 2 O): δ (ppm)-128.22,38.82; MS: 282.0

[0263] [C 9 H 10 F 2 NO 5 S] + ,305.0[C 9 H 9 F 2 NO 5 SNa] + .

[0264] Fluorosulfate-2-fluoro-L-tyrosine

[0265] 1 H NMR (500 MHz, D 2 O): δ(ppm)3.19-3.23(m,1H),3.33-3.37(m,1H),4.18-4.20(t,1H),7.26-7.46(m,3H); 13 C NMR (500MHz, D 2 O): δ (ppm) 29.24, 53.34, 109.67, 117.50, 122.79, 133.19, 149.32, 161.54, 171.48; 19 F NMR (500MHz, D 2 O): δ (ppm)-112.16,37.85; MS: 282.0

[0266] [C 9 H 10 F 2 NO 5 S] + ,305.0[C 9 H9 F 2 NO 5 SNa] + .

[0267] Fluorosulfate-2,3-difluoro-L-tyrosine

[0268] 1 H NMR (400 MHz, D 2 O) δ7.35(t,J=7.7Hz,1H),7.25-7.18(m,1H),4.31-4.21(m,1H),3.38(dd,J=14.7,6.4Hz,1H),3.25(dd,J=14.7,7.1Hz,1H); 13 C NMR (101MHz, D 2 O))δ170.81,151.13,148.65,144.03,141.49,137.09,126.26,124.79,118.48,66.53,52.77,29.16; 19 FNMR (377MHz, D 2 O)δ39.15,-136.33,-150.44; MS:298.1[C 9 H 7 F 3 NO 5 S] - ,597.2

[0269] [C 18 H 15 F 6 N 2 O 10 S 2 ] - .

[0270] Fluorosulfate-2,5-difluoro-L-tyrosine

[0271] 1 H NMR (400 MHz, D 2 O) δ7.02(dd,J=8.8,6.4Hz,1H),6.94(dd,J=10.1,6.6Hz,1H),3.89(t,J=6.8Hz,1H),2.92(dd,J=14.7,6.4Hz,1H),2.80(dd,J=14.7,7.1Hz,1H); 13 CNMR(151MHz,D 2O)δ170.16,150.23,148.58,135.64,123.73,119.80,111.21,52.53,28.77; 19 F NMR (377MHz, D 2 O)δ39.04,-117.77,-133.37;

[0272] MS:298.2[C 9 H 7 F 3 NO 5 S] - ,597.4[C 18 H 15 F 6 N 2 O 10 S 2 ] - .

[0273] Fluorosulfate-3,5-difluoro-L-tyrosine

[0274] 1 H NMR (500 MHz, D 2 O): δ (ppm) 3.17-3.20 (m, 1H), 3.28-3.32 (m, 1H), 4.20-4.22 (t, 1H), 7.14-7.16 (d, 3H); 13 C NMR (500MHz, D 2 O): δ (ppm) 35.31, 53.87, 114.22, 125.22, 138.00, 153.28, 171.25; 19 F NMR (500MHz, D 2 O): δ (ppm)-124.96,40.65; MS: 300.0[C 9 H 9 F 3 NO 5 S] + ,323.0[C 9 H 8 F 3 NO 5 S Na] + .

[0275] Fluorosulfate-2,6-difluoro-L-tyrosine

[0276] 1H NMR(400MHz,DMSO)δ7.68(t,2H),4.03-3.92(m,1H),3.27(dd,1H),3.18(dd,1H).13C NMR(101MHz,DMSO)δ170.05,162.85,160.37,148.77,113.91,106.88,66.81,56.45,51.44,23.75,19.00.19F NMR(377MHz,DMSO)δ(ppm)40.28,-109.06.

[0277] MS:299.8[C 9 H 9 F 3 NO 5 S]+.

[0278] LC Analysis of Model Reactions to Determine the Proximity Reactivity of Fluorosulfate-L-Tyrosine Derivatives

[0279]

[0280] A similar reaction was performed to test the proximity reactivity of fluorinated L-tyrosine to nucleophilic groups: 100 μL of a 10 mM fluorinated L-tyrosine solution was mixed with 900 μL of a 110 mM imidazole solution (pH 8.5) in a 1.5 mL EP tube. The tube was placed in a thermal oscillator and reacted at 30° C. at 1000 rpm for 4 h. The mixture was analyzed by UPLC and the absorption at 260 nm was monitored. The conversion was calculated by the following formula: product peak area / (product peak area+reactant peak area)×100%.

[0281] The results are summarized in Fig. 9A- Fig. 9C and Fig.10 In the reaction, both the position and number of electron-withdrawing fluorine atoms have an effect on the reactivity of sulfuryl fluoride.

[0282] Example 3

[0283] Selection of aminoacyl-tRNA synthetases for fluorosulfate-3,5-difluoro-L-tyrosine

[0284] Construction of pBK-chFSYRS S4 mutant library plasmid

[0285] The FSYRS encoding gene was cloned from pSup chFSYRS into pBK vector by ligation-independent cloning to generate pBK chFSYRS. Briefly, the FSYRS gene was amplified with the following primers, purified and ligated with Exnase II (Vazyme, Cat: C112-01).

[0286] Primer name sequence SEQ ID pBK vector, forward TAACTGCAGTTACAGGTTAGTGTAGGCACTGC 2 pBK vector, reverse ATGGGATTCCTCAAAGCGTAAACAACGTATAAC 3 chFSYRS, forward CTTTGAGGAATCCCATATGGATAAGAAGCCGCTG 4 chFSYRS, reverse CCTGTAACTGCAGTTACAGGTTAGTAGAAATACC 5

[0287] Considering the crystal structure of OMEY-MmPylRS synthetase, four residues are adjacent to the main chain of the tyrosine derivative and may interact with the newly introduced fluorine atom. Therefore, a pBK-chFSYRS mutant library (S364NNK, V366NNK, G384NNK, G386NNK) of the chimeric Mm / MbPylRS was constructed using the iterative saturation mutagenesis (ISM) method of whole plasmid amplification, which introduces mutations during PCR by using synthetic DNA oligonucleotides containing one or more degenerate codons at the target residues. First, the pBK-chFSYRS plasmid was amplified using primers S364-V366-NNK forward and primers S364-V366-NNK reverse containing a degenerate codon (NNK). Then, the resulting library was treated with DpnI to eliminate the parental methylated DNA chain and transformed into DH10B cells. The cells were collected and the plasmid was extracted using a mini kit to obtain the pBK-chFSYRS S2 mutant library. Using the pBK-chFSYRS S2 mutant library as a template, the above process was repeated with primers G384-G386-NNK forward and G384-G386-NNK reverse containing a degenerate codon (NNK), and finally a primer with 10 7 pBK-chFSYRS S4 mutant library with 1 clone.

[0288]

[0289] Active chimeric FSYRS variants of UAA were selected through three rounds of positive selection and subsequent negative selection. The ChPheRS library in the pBK vector was first electroporated into DH10B competent cells with the negative selection plasmid pPOS-CAT112TAGchPheT-GFP190TAG, which contains the CAT and GFP dual reporter genes with amber codons (CAT is 112TAG and GFP is 190TAG), respectively. DH10B cells (100 μL) with the pPOS selection reporter gene were further transformed by electroporation with 100 ng of the pBK-chFSYRS S4 mutant library. The electroporated cells were immediately recovered with 1 mL of preheated SOC medium and vigorously stirred at 37°C for 1 hour, and then fluorosulfate-3,5-difluoro-L-tyrosine was added to a final concentration of 1 mM and vigorously stirred at 37°C for another 1 hour. The recovered cells were plated directly onto LB-agar selection plates supplemented with 1 mM fluorosulfate-3,5-difluoro-L-tyrosine, 12.5 μg mL-1 of 50 μg / ml kanamycin (Kan), 100 μg / mL ampicillin (Amp), and 34 μg / mL chloramphenicol (Cm). The selection plates were incubated at 37°C for 48 hours and then stored at room temperature. 57 clones with fluorosulfate-3,5-difluoro-L-tyrosine-dependent growth were considered qualified and further characterized by Sanger sequencing. During positive selection, the pBK-chFSYRS S4 mutant library was electroporated in parallel into DH10B competent cells with the negative selection plasmid pNEG-Barnase-Q3TAG-D45TAG-chPheT. The transformed cells were recovered at 37°C for 1 hour and then plated on LB agar containing 50 μg / mL kan, 100 μg / mL Amp and 34 μg / ml Cm and plated on LB-agar selection plates. After incubation at 37°C for 24 hours, no clones were found on the plates, indicating that the synthetase was orthogonal to the natural amino acids. Finally, a smaller synthetase library was generated based on the sequencing results and an additional round of positive selection was performed.

[0290] A unique amino acid sequence (S364S, V366A, G384G, G386G) was found in the sequencing results. Although the four sites were randomly mutated, three of them were enriched as original residues, indicating that they are highly conserved. The following primers were used to introduce alanine mutations specifically into chFSYRS to generate the pSup chFSYRS V366A plasmid:

[0291]

[0292] To further characterize pSup chFSYRS V366A ( Fig.11A-11C), to determine the fidelity and processivity of other fluorine-substituted unnatural amino acids.

[0293] Evaluation of amber suppression efficiency in E. coli

[0294] Plasmid pBAD GFP 149TAG carrying GFP-149TAG and plasmid pSupchFSYRS V366A or pSup chFSYRS V366A carrying the corresponding chimeric synthetase were co-transformed into chemically competent DH10B cells. Transformed cells were recovered in SOC medium with shaking at 37°C for 1 hour and plated on LB agar containing 34 μg / ml chloramphenicol and 100 μg / ml ampicillin at 37°C for 12 hours. Single colonies were picked and grown in 2 ml LB medium containing the required antibiotics at 37°C until OD 600 reached 0.4-0.6, and 1 mM of the corresponding unnatural amino acid was added, followed by incubation at 30°C for 30 minutes. Cell cultures were induced with 0.2% arabinose and incubated at 30°C for 10 hours. After induction, 1 ml of cell culture was collected by centrifugation and then lysed at 37°C for 10 minutes using 150 μl BugBuster protein extraction reagent (Millipore). Lysate supernatant (100 μl) was transferred to a 96-well cell culture plate (Costar). The GFP signal was recorded by a TECAN SPARK microplate reader using background subtraction and normalized by the bacterial density (OD 600) also measured by a TECAN SPARK microplate reader.

[0295] Meanwhile, 1 ml of cell culture was collected by centrifugation and resuspended with 100 μL 1x loading buffer, heated at 95°C for 30 minutes, and 10 μL of sample was loaded on 4-20% or 8-16% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) for electrophoresis and transferred to a 0.22 μm polyvinylidene fluoride (PVDF) membrane (Millipore). After protein transfer, the membrane was blocked with 5% bovine serum albumin in TBST buffer (20 mM Tris, pH 8.0, 150 mM NaCl, 0.1% Tween 20) for 1 hour at room temperature. The membrane was incubated with the primary antibody (1:1,000; His tag antibody) for 1 hour at room temperature. After incubation with the primary antibody, the membrane was washed 3 times (5 minutes each time) with TBST buffer. The membrane was then incubated with horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG antibody (1:5,000 dilution) for 1 hour at room temperature. Finally, the membrane was washed three times with TBST buffer (5 minutes each time). The Western blot bands were detected using an electrochemiluminescence (ECL) Western blotting substrate (Millipore, catalog number: WBKLS0500).

[0296] Synthetase gene / protein SEQ ID NO: chFSYRS (prokaryotic) gene 28 chFSYRS (prokaryotic) protein 29 chFSYRS V366A (prokaryotic) gene 30 chFSYRS V366A (prokaryotic) protein 31 chFSYRS (eukaryotic) gene 32 chFSYRS (eukaryotic) protein 29 chFSYRS V366A (eukaryotic) gene 33 chFSYRS V366A (eukaryotic) protein 34

[0297] The chFSYRS V366A variant showed a 9-fold increase in GFP fluorescence upon incorporation of fluorosulfate-3,5-difluoro-L-tyrosine compared to chFSYRS, confirming the positive results of the above screening ( Figure 12-13 ). In addition, chFSYRS V366A showed increased efficiency in the incorporation of fluorosulfate-2-difluoro-L-tyrosine, fluorosulfate-2,5-difluoro-L-tyrosine, and fluorosulfate-2,3-difluoro-L-tyrosine, but was less efficient than chFSYRS in the incorporation of fluorosulfate-L-tyrosine and fluorosulfate-3-difluoro-L-tyrosine. Western blot analysis of full-length GFP expression confirmed the fluorescence intensity. We propose that the amino acid residue at position 366 of the synthetase is adjacent to the meta-atom, and the fluorine atom is slightly larger than the hydrogen atom, and minimization of the alanine residue would help to reduce steric hindrance, and the methyl group of alanine may interact with the fluorine, thereby stabilizing the intermediate. Unfortunately, chFSYRS V366A was unable to mediate the incorporation of fluorosulfate-2,6-difluoro-L-tyrosine, although this PrUAA was not the one with the best neighboring reactivity among the fluorosulfate-L-tyrosines for the addition of difluoride.

[0298] Evaluation of amber suppression efficiency in mammalian cells

[0299] The incorporation of fluorine-substituted fluorosulfate-3,5-difluoro-L-tyrosine into mammalian cell proteins was further tested. EGFP with a TAG mutation at the Y40 position was synthesized by Jin Weizhi (China) and inserted into the pcDNA3.4 vector under the control of CMV to obtain pcDNA3.4-EGFP-Y40TAG as a reporter plasmid, and suppression of the Y40TAG codon will produce full-length EGFP, making the cells fluorescent. Chimeric synthetase and tRNA genes with optimized codons for human cells were synthesized by Jin Weizhi (China) and inserted into the pCMV vector by Gibson Assembly under the control of CMV and U6 promoters to obtain pCMV 8tRNA-chFSYRS and pCMV 8tRNA-chFSYRS V366A, respectively. HEK 293T cells were grown in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. Cells were co-transfected with the synthetase plasmid and the reporter plasmid at a ratio of 1:1 (μg:μg). Transfection was performed by PEI according to the manufacturer's protocol with or without the addition of the corresponding amino acids. Imaging was performed 24 hours after transfection. HEK 293T live cells were imaged in the FITC channel using an XD inverted fluorescence microscope equipped with a 10× objective (PlanFluor, SOPTOP). All images were analyzed and processed using ImageJ software (National Institutes of Health, USA).

[0300] Strong EGFP fluorescence was observed from cells transfected with chFSYRS and chFSYRS V366A plasmids when the corresponding UAA was added, which is consistent with the amber inhibition results of E. coli. It is worth noting that the cell morphology remained normal, indicating that fluorine-substituted fluorosulfate-3,5-difluoro-L-tyrosine had no obvious toxicity to HEK 93T cells, which is an important feature of fluorine-substituted fluorosulfate-3,5-difluoro-L-tyrosine, which may be due to the extremely low background reactivity of aryl fluorosulfates in cells. These results confirm that the incorporation of fluorine-substituted fluorosulfate-3,5-difluoro-L-tyrosine into proteins in mammalian cells using our tRNA synthetase is highly efficient and specific, but does not cause harmful effects.

[0301] In summary, a series of biorthogonal fluorine-substituted fluorosulfate-L-tyrosines with enhanced reactivity and the corresponding tRNA synthetases were developed. Their genetic encoding ability was verified in both Escherichia coli and mammalian cells. Since these PrUAAs can react with His, Lys and Tyr residues that are commonly present on the surface and interface of proteins through SuFEx reactions, our invention will have a wide range of applications in the development of covalent protein drugs.

[0302] Example 4

[0303] Covalently engineered PD-L1 blocking nanobodies (GlueBody) with enhanced T cell activity restoration

[0304] Expression and purification of anti-PD-L1 VHH (glue antibody) spiked with PrUAA The plasmid pBAD-Nb-PD-L1-HIS (TAG) was co-transformed into DH10B competent cells with plasmid pSupAR-chFSYRS or pSupAR-chFSYRS V366A, respectively. The transformants were plated on LB-ampicillin-chloramphenicol agar plates and incubated overnight at 37°C. A single colony was inoculated into 10 mL LB medium containing 100 μg / mL ampicillin and 34 μg / mL chloramphenicol at 37°C. The next day, 10 mL of the overnight cell culture was diluted into 1 L of fresh nutrient-rich medium (15 g Na2HPO4·12H2O, 6 g KH2PO4, 20 g tryptone, 5 g yeast extract, 5 g NaCl, 200 mg CaCl2, 200 mg MgCl2, 8 g glycerol, 0.5 g glucose) and stirred vigorously at 37°C. When OD600 reached 0.6, the bacteria were incubated with 1 mM PrUAA and induced with 0.2% arabinose when OD600 reached 0.8-1.0. After 12 hours of induction at 30°C, the bacteria were harvested by centrifugation at 6000 rpm for 30 minutes. Then, the cells were resuspended with 100 mL of binding buffer (50 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole, 1 mg / mL lysozyme and protease inhibitors). The cell suspension was sonicated in an ice-water bath using an ultrasonic disruptor (SCIENTZ, 30% output, 30 minutes, 1 second off, 1 second on), followed by centrifugation (15,000 g, 30 minutes, 4°C). The soluble fraction was collected and loaded onto a pre-packed Ni-NTA column, eluted with NTA250 buffer (50 mM Tris-HCl pH 8.0, 500 mM NaCl, 250 mM imidazole), and then immediately further purified on a superdrex 75 column and stored at -80°C for future analysis. The molecular weight of the intact wild-type and UAA-incorporated proteins was analyzed by Waters ACQUITY UPLC I-Class SQD 2MS spectrometer using electrospray ionization (ESI). The sortase-mediated protein conjugation was separated by LC using a BEH300C4 Acquity column (1.7 μm, 2.1×100 mm), and all samples were analyzed by ESI-MS in positive mode. The total mass of the protein was calculated using MassLynx V4.1 software (Waters).

[0305] ESI-MS analysis showed correct incorporation of the four PrUAAs, and no VHHs containing native amino acids or VHHs with added active molecules were detected, which validated the fidelity of incorporation and confirmed the biorthogonality of our PrUAAs ( Fig.14 A- Fig.14 D).

[0306] In vitro cross-linking of GlueBobody with PD-L1

[0307] Purified glue antibody was incubated with PD-L1 (Zhongbiology, catalog number: 10084-HNAH) in PBS buffer at 37°C for 5 hours at a molar ratio of 1:1. The amount of PD-L1 was 2 μg. A 5-fold reduced loading buffer (Kangwei Century, catalog number: CW0027) was added to the tube and heated at 95°C for 15 minutes. The samples were then separated by 8-16% SDS-PAGE gel and then stained with Coomassie Brilliant Blue. The grayscale intensity of the band was quantified on ImageJ software.

[0308] Since covalent bonds are not destroyed by denaturing conditions, SDS-PAGE was used to distinguish between covalent and non-covalent binding. The results showed that all Nb-PD-L1 containing PrUAA at site 108 were observed on SDS-PAGE to cross-link with target PD-L1 as new bands with molecular weights corresponding to Nb / Ag conjugates. Notably, Nb-PD-L1 containing fluorosulfate-2,5-difluoro-L-tyrosine (28%) and fluorosulfate-2-fluoro-L-tyrosine (26%) showed an approximately 2-fold increase in the cross-linking ratio compared to FSY (15%), indicating that fluorine addition accelerated the formation of covalent bonds ( Fig.15 ). It is noteworthy that although the proximity reactivity of fluorosulfate-3-fluoro-L-tyrosine to electrophilic imidazole is enhanced compared with fluorosulfate-2-fluoro-L-tyrosine, the glue antibody does not have the theoretical covalent binding ability, which may be due to the additional interaction between the introduced fluorine and the residues in the antigen.

[0309] PD-1 / PD-L1 blockade testing

[0310] To verify whether increased cross-linking would contribute to enhanced T cell activation recovery, we performed the following PD-1 / PD-L1 blocking assays. PD-1NFAT-Luciferase / Jurkat cells were cultured in RPMI 1640 medium containing 10% FBS, 1% Pen-Strep. PD-L1 aAPC / CHO-K1 cells were cultured in Ham F-12 (growth medium) containing 10% FBS, 1% Penn-Strep. For blocking assays, PD-L1 aAPC / CHO-K1 cells were seeded into white 96-well microplates at a density of 10,000 cells per well in 100 μL growth medium. After cell attachment, the medium was removed from the CHO-K1 cells and the cells were incubated for 22 hours with fresh growth medium supplemented with HBSS, 20nM glue antibody, after which the antibody was washed off and 10,000 PD-1NFAT-luciferase / Jurkat cells and the same drugs or controls were added to the assay medium (RPMI 1640, 10% FBS, 1% Pen-Strep). After 5-6 hours of co-culture, the cells were lysed and luciferase assays were performed using a luciferase reporter gene assay kit (Yeasen, catalog number: 11401ES76). Luminescence measurements were performed using a TECAN Spark microplate reader.

[0311] Adding antibodies that disrupt the PD-1 / PD-L1 interaction between engineered Jurkat cells and CHO-K1 cells will reduce inhibitory signals and restore T cell receptor (TCR) signaling. Therefore, CHO-K1 cells were treated with glue antibodies or controls, respectively. Both covalently engineered Nb-PD-L1 L108FSY and Nb-PD-L1 L108m-F FSY showed enhanced T cell activation compared to their non-covalent counterparts ( Fig.16 ), and stronger covalent binding will contribute to stronger activation, because the behavior of Nb-PD-L1L108m-F FSY is superior to that of Nb-PD-L1 L108FSY. Traditional antibodies bind to targets in a dynamic manner, and the dissociation of antibodies is not desirable. In contrast, glue antibodies bind to targets irreversibly, and the accumulation of blocking antibodies on cancer cells provides a stronger and more sustainable effect.

[0312] Although preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. The present invention is not limited to the specific embodiments provided in the specification. Although the present invention has been described with reference to the foregoing description, the description and illustration of the embodiments herein are not restrictive. Without departing from the present invention, a number of variations, changes and substitutions will occur to those skilled in the art. In addition, it will be understood that all aspects of the present invention are not limited to the specific descriptions, configurations or relative proportions set forth herein, which depend on various conditions and variables. It should be understood that various alternatives to the embodiments of the present invention described herein may be used to practice the present invention. Therefore, it is contemplated that the present invention should also cover any such alternatives, modifications, variations or equivalents. The appended claims are intended to define the scope of the present invention, and thereby cover methods and structures within the scope of these claims and their equivalents.

Claims

1. A compound having the following structure (IA): (I-A), in, Said n is selected from the group consisting of 1, 2, 3 and 4, and X is halogen.

2. The compound according to claim 1, wherein each of said X is independently F.

3. A compound having the following structure: ,in, The X is a halogen. The compound according to claim 3 , wherein X is F.

5. A compound having the following structure: , , , and / or ,in, The X is a halogen. The compound according to claim 5 , wherein X is F.

7. A protein comprising an unnatural amino acid having the structure (IP): (IP), where The n is selected from the group consisting of 1, 2, 3 and 4, and X is halogen, wherein the protein comprises the unnatural amino acid at position 108 as shown in the sequence of SEQ ID NO:

1.

8. The protein according to claim 7, wherein X is F.

9. The protein of claim 7, wherein the protein further comprises a proteolytic targeting moiety.

10. The protein of claim 7, wherein the protein further comprises 6-phosphate mannose, N-acetylgalactosamine GalNAc, a cell penetrating peptide and / or a lysosomal sorting sequence.

11. A nucleic acid comprising a sequence encoding the protein of any one of claims 7 to 10.

12. A cell comprising the protein according to any one of claims 7 to 10 and / or the nucleic acid according to claim 11.

13. A composition comprising the protein of any one of claims 7 to 10, the nucleic acid of claim 11 and / or the cell of claim 12, and optionally a pharmaceutically acceptable adjuvant.

14. A kit comprising the protein according to any one of claims 7 to 10, the nucleic acid according to claim 11, the cell according to claim 12 and / or the composition according to claim 13.

15. A method for inhibiting the binding of PD-L1 protein to PD-L1 ligand, wherein the method comprises providing the protein according to any one of claims 7 to 10, and the method is an in vitro method.

16. A method for activating immune cells, wherein the method comprises providing the protein according to any one of claims 7 to 10, the method is an in vitro method, and the immune cells are T cells.

17. The method of claim 16, wherein the activation is detected by a luciferase assay.

18. Use of the compound according to any one of claims 1 to 6 in the preparation of proteins.

Images