Quinoline derivatives for the treatment of inflammatory diseases

Abstract

The present invention relates to a compound of formula (I) or any one of its pharmaceutically acceptable salts for use in the treatment and / or prevention of an inflammatory disease: wherein: formula (II) means an aromatic ring, wherein V is C or N and when V is N, Q is N or O, provided that when Q is O, R" is not present; R' independently represents a hydrogen atom or a group selected from the group consisting of a (C1-C3)alkyl group, a halogen atom, a hydroxyl group, a -COOR1 group, a -NO2 group, a -NR1R2 group, a morpholinyl or morpholino group, a N-methylpiperazinyl group, a (C1-C3)fluoroalkyl group, a -O-P(=O)-(OR3)(OR4) group, a (C1-C4)alkoxy group and a -CN group, and can further be a group selected from the group consisting of:

Description

[0001] This application is a divisional application of Chinese Invention Patent Application No. 201580046384.3. Technical Field

[0002] This invention relates to the identification of novel quinoline derivatives that are effective for the treatment and / or prevention of inflammatory diseases, and to novel therapeutic uses of quinoline derivatives for inflammatory diseases.

[0003] The present invention also relates to the field of biomarkers associated with this inflammatory disease. Background Technology

[0004] Inflammation is the immune system's protective response to tissue damage and infection. However, in some cases, the inflammatory response can damage the body. In the acute phase, inflammation manifests as pain, fever, redness, swelling, and loss of function. Many inflammatory conditions exist that affect millions of people worldwide.

[0005] In fact, inflammatory diseases encompass a variety of conditions, including inflammatory diseases related to autoimmune disorders, inflammatory diseases of the central nervous system (CNS), arthritis, inflammatory digestive tract diseases, and inflammatory skin diseases. Among these, inflammatory bowel disease, rheumatoid arthritis, and multiple sclerosis are of particular concern.

[0006] Inflammatory bowel disease (IBD) is a complex, multifactorial disease. and Cerar, 2012). It usually refers to ulcerative colitis (UC) and Crohn's disease (CD), which are two chronic conditions involving inflammation of the intestine. IBD is common in developed countries, and in the Nordic region, up to 1 in 200 individuals are affected by these diseases. Patients with IBD present a variety of clinical challenges for physicians. DSS-induced colitis is associated with the upregulation of various pro-inflammatory cytokines, including TNFalpha and IFNgamma. Recently, it has been shown that miR-124 is specifically downregulated in pediatric patients with active UC, resulting in increased levels of transducer and activator expression of transcription factor 3 (STAT3) and transcriptional activation of its downstream targets, including pro-inflammatory cytokines (Koukos et al.; Gastroenterology; 145(4):842-52:2013). However, despite recent advances, there is still a need for safe and well-tolerated treatments with rapid onset and the ability to enhance and maintain long-term remission.

[0007] Rheumatoid arthritis (RA) is the most common autoimmune disease, with a prevalence of approximately 0.3% to 1% of the world's population, and is often associated with reduced mobility, increased social dependence, and work impairment. RA is a systemic inflammatory disease affecting the endothelial tissue of joints, known as the synovium. Rheumatoid synovial tissue is characterized by the excessive proliferation of fibroblast-like synovial cells (FLS) in the endothelial lining, along with the infiltration of macrophages, T cells, and B cells beneath the lining, as well as other inflammatory cells that promote inflammation and damage to bone and cartilage. Intra-articular and systemic expression of pro-inflammatory cytokines, particularly tumor necrosis factor-alpha (TNFα), interleukin-1 (IL-1), and IL-6 (IL-6), which are primarily produced by synovial macrophages, plays a significant role in the pathogenesis of RA, for example, by contributing to the excessive proliferation of RA FLS. RA patients are typically treated with a group of small-molecule drugs called disease-modifying antirheumatic drugs (DMARDs). DMARDs suppress the body's overactive immune and / or inflammatory systems in some way, thereby slowing the progression of the disease. RA patients who do not respond to DMARDs are treated with biological agents such as tumor necrosis factor (TNF) antagonists. However, even when TNF antagonists are effective in approximately two-thirds of patients, responding patients typically become non-responders within 5 years. Therefore, alternative treatment options are needed. Notably, novel treatments designed for RA patients in the early stages before RA becomes chronic are receiving particular attention.

[0008] Multiple sclerosis (MS) is an autoimmune inflammatory disease, a demyelinating disease of the central nervous system that destroys myelin, oligodendrocytes, and axons. MS is characterized by multifocal inflammation and infiltration of macrophages and encephalogenic T cells into central nervous system cells. Microglia are found throughout the central nervous system and are involved in the onset and progression of the CNS inflammatory response. When microglia are activated, they highly disrupt CNS function by producing neurotoxins, inflammatory cells (inflammatory protein-10, macrophage inflammatory protein-1, macrophage inflammatory protein-2, CC chemokine ligand 19, monocyte chemoattractant protein-1, monocyte chemoattractant protein-2), and antibody-producing immune cells. Microglia direct such inflammatory responses, which can lead to infiltration of the brain and spinal cord by immune cells that fight off foreign invaders and by T cells that destroy myelin proteins. During inflammation, peripheral macrophages appear in the CNS, and these cells have a highly activated phenotype that efficiently stimulates the expansion of encephalitis-inducing T cells, and these cells are thought to contribute to the destruction of neuronal tissue.

[0009] MicroRNAs (miRNAs), the most extensive non-coding RNAs, are a class of approximately 22 nt non-coding RNAs that repress gene expression by binding to the untranslated region (UTR) of the target mRNA transcript (Lai et al., Nature Genetics, vol. 30, no. 4, pp. 363–364, 2002; Bartel et al., Cell, vol. 136, no. 2, pp. 215–233, 2009). miRNA genes represent approximately 1–2% of the known eukaryotic genome. Predictions suggest that each miRNA can target more than 200 transcripts, and that a single mRNA can be regulated by multiple miRNAs (LINDOW, DNA Cell Biol., vol. 26(5), p. 339–351, 2007). miRNAs are formed from endogenous hairpin transcripts and function by base pairing with the target mRNA, resulting in either mRNA cleavage or translational repression depending on the degree of base pairing. Two processing events lead to the formation of mature miRNAs: First, the nascent miRNA transcript (pri-miRNA) is processed into a 70-nucleotide precursor (pre-miRNA), which is exported from the nucleus and cleaved in the cytoplasm to generate a short (approximately 22 nucleotides in length) mature miRNA (LEE, EMBO J., vol. 21, p; 4663-4670, 2002). miRNAs can be located intergenic or intragenic. When located intergenic, their expression is associated with other miRNAs as a cluster (Altuvia et al., Nucleic Acids Research, vol. 33, no. 8, pp. 2697–2706, 2005; Ozsolak et al., Genes and Development, vol. 22, no. 22, pp. 3172–3183, 2008). When located within a gene, that is, within a gene that encodes a protein (almost exclusively excluded from introns), they are typically expressed by the same strand as their host gene (Liu et al., Cell Research, vol. 18, no. 10, pp. 985–996, 2008; Kim et al., EMBO Journal, vol. 26, no. 3, pp. 775–783, 2007) and at a relevant level (Baskerville et al., RNA, vol. 11, no. 3, pp. 241–247, 2005).

[0010] Overexpression of a miRNA (i.e., miR-124) has been shown to inactivate inflammatory macrophages and transform them into microglia-like cells. miR-124 is believed to inhibit macrophage activation by targeting CEBPα (a transcription factor responsible for myeloid cell differentiation). Intravenous injection of liposomes containing miR-124 significantly suppressed clinical EAE symptoms and inhibited the infiltration of encephalogenic T cells and the formation of inflammatory cells in the CNS.

[0011] In fact, Ponomarev et al. (“microRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C / EBP-α-PU.1 pathway”; Nature Medicine (2011); 17:1:64-71) showed that miR-124 acts as an important regulator of microglial quiescence and as a regulator of monocyte and macrophage activation. Based on an experimental autoimmune encephalomyelitis (EAE) model, this study shows that the expression pattern of miR-124 is regulated in mice with EAE (upregulated or downregulated depending on cell type).

[0012] WO2010 / 151755 also teaches the use of miR-124 for the treatment of inflammatory diseases of the central nervous system (CNS).

[0013] Sun et al. (“microRNA-124 mediates the cholinergic anti-inflammatory action through inhibiting the production of pro-inflammatory cytokines”; Cell Research (2013); 23:1270-1283) also taught that miR-124 can mediate cholinergic anti-inflammatory effects by targeting STAT3 and TACE.

[0014] On the other hand, novel compounds have been identified, which are also referred to as "quinoline derivatives" in this invention, but are used for different indications.

[0015] Referring to the following, quinoline is a heterocyclic aromatic organic compound represented by the following formula:

[0016]

[0017] Therefore, "quinoline derivatives" include substituted quinolines, such as monosubstituted or polysubstituted quinolines.

[0018] WO2010 / 143170 teaches the use of compounds for treating conditions associated with premature aging.

[0019] WO2010 / 143169 and WO2012 / 080953 teach the use of compounds for the treatment of AIDS.

[0020] WO2010 / 143168 teaches the use of compounds for the treatment of a range of cancers. These compounds have been shown to correct defects in alternative splicing. Invention Overview

[0021] It has been found that compounds defined by formula (I) below can be used to treat and / or prevent inflammatory diseases.

[0022] Therefore, the present invention relates to compounds represented by formula (I) as defined below for the treatment and / or prevention of inflammatory diseases.

[0023] Specifically, the present invention relates to compounds represented by formula (I) as defined below for the treatment and / or prevention of inflammation and / or inflammation that may occur with the inflammatory disease described herein.

[0024] The present invention also relates to the use of at least one miRNA (the at least one miRNA being miR-124) as a biomarker for screening quinoline derivatives and, more particularly, compounds of formula (I) in vitro or in vitro, wherein the quinoline derivatives and, more particularly, compounds of formula (I) are presumed to be effective for the treatment and / or prevention of inflammatory diseases.

[0025] The present invention further relates to compounds represented by formula (Id) or (Ie) as defined below.

[0026] The present invention further relates to pharmaceutical compositions comprising at least one compound of formula (Id) or (Ie).

[0027] The present invention also relates to compounds selected from the following list:

[0028] -(8)8-Chloro-5-(3-(piperidin-1-yl)propoxy)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0029] -(9)8-chloro-N 4 -(3-(piperidin-1-yl)propyl)-N 2 -(4-(trifluoromethyl)pyridin-2-yl)quinoline-2,4-diamine

[0030] -(10)8-Chloro-N-methyl-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0031] -(11)8-chloro-N 4 -(2-morpholinoethyl)-N 2 -(4-(trifluoromethyl)pyridin-2-yl)quinoline-2,4-diamine

[0032] -(13)4,8-Dichloro-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0033] -(14)8-Chloro-N-(3-morpholinopropyl)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0034] -(15)8-Chloro-6-(2-morpholinethoxy)-N-(3-morpholinopropyl)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0035] -(16)8-Chloro-5-(2-morpholinethoxy)-N-(3-morpholinopropyl)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0036] -(17)8-Chloro-6-(2-(4-methylpiperazin-1-yl)ethoxy)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0037] -(18)8-Chloro-6-(2-(piperidin-1-yl)ethoxy)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0038] -(19)8-Chloro-6-(3-(piperidin-1-yl)propoxy)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0039] -(20)8-chloro-N-(3-fluoro-4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0040] -(21)N-(5-bromo-4-(trifluoromethyl)pyridin-2-yl)-8-chloroquinoline-2-amine

[0041] -(22)N 2 -(8-Chloroquinoline-2-yl)-N 5 -(3-(4-methylpiperazin-1-yl)propyl)-4-(trifluoromethyl)pyridine-2,5-diamine

[0042] -(28)8-Chloro-N-methyl-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0043] -(29)8-Chloro-5-(3-(piperidin-1-yl)propoxy)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0044] -(30)8-Chloro-N-(3-(piperidin-1-yl)propyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0045] -(31)8-Chloro-N-(2-morpholinoethyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0046] -(32)8-Chloro-N-(2-(pyrrolid-1-yl)ethyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0047] -(33)8-Chloro-N-(4-morpholinobutyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0048] -(34)8-chloro-N 4 -(3-(piperidin-1-yl)propyl)-N 2 -(4-(trifluoromethoxy)phenyl)quinoline-2,4-diamine

[0049] -(35)4,8-Dichloro-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0050] -(36)8-Chloro-5-(2-morpholinethoxy)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0051] -(37)N 1 -(4,8-dichloroquinoline-2-yl)-4-(trifluoromethoxy)benzene-1,2-diamine

[0052] -(38)4,8-Dichloro-N-(2-morpholinoethyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0053] -(39)8-Chloro-6-(2-morpholinethoxy)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0054] -(40)8-chloro-N 2 -(2-morpholinoethyl)-N 4 -(3-(piperidin-1-yl)propyl)-N 2 -(4-(trifluoromethoxy)phenyl)quinoline-2,4-diamine

[0055] -(41)8-Chloro-N-(2-morpholinoethyl)-N-(2-nitro-4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0056] -(42)N 1 -(8-Chloroquinoline-2-yl)-N 1 -(2-morpholinoethyl)-4-(trifluoromethoxy)benzene-1,2-diamine

[0057] -(43)8-Chloro-5-(2-morpholinethoxy)-N-(2-morpholinethyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0058] -(44)N 1 -(8-chloro-5-(2-morpholinethoxy)quinolin-2-yl)-4-(trifluoromethoxy)phenyl-1,2-diamine

[0059] -(46)8-chloro-2-((4-(trifluoromethyl)pyridin-2-yl)oxy)quinoline

[0060] -(47)4-(2-((8-chloro-2-((4-(trifluoromethyl)pyridin-2-yl)oxy)quinoline-6-yl)oxy)ethyl)morpholine

[0061] -(48)8-chloro-2-(4-(trifluoromethoxy)phenoxy)quinoline

[0062] -(49)4-(2-((8-chloro-2-(4-(trifluoromethoxy)phenoxy)quinoline-6-yl)oxy)ethyl)morpholine

[0063] -(50)4-(2-((8-chloro-2-(4-(trifluoromethoxy)phenoxy)quinoline-5-yl)oxy)ethyl)morpholine

[0064] -(51) Phosphate mono-[8-chloro-2-(4-trifluoromethyl-pyridin-2-ylamino)-quinolin-6-yl] ester

[0065] -(52) Phosphate mono-[2-(8-chloro-quinoline-2-ylamino)-5-trifluoromethoxy-phenyl] ester

[0066] -(53) Phosphate mono-[8-chloro-2-(4-trifluoromethoxy-phenylamino)-quinoline-6-yl] ester

[0067] - and their pharmaceutically acceptable salts, and more specifically selected from compounds (8), (9); (10); (11); (30); (46); (47); (48); (49) and (50) as defined above, or one of their pharmaceutically acceptable salts.

[0068] The present invention also relates to pharmaceutical compositions comprising at least one compound represented by formula (Id) or (Ie), or one of the compounds (8), (9), (10), (11), (13), (14), (15), (16), (17), (18), (19), (20), (21), (22), (28), (29), (30), (31), (32), (33), (34), (35), (36), (37), (38), (39), (40), (41), (42), (43), (44), (46), (47), (48), (49), (50), (51), (52), and (53) as defined above, and more specifically one of the compounds (8), (9), (10), (11), (30), (46), (47), (48), (49), and (50).

[0069] The present invention further relates to an in vitro or ex vivo method for increasing the expression of miR-124 in eukaryotic cells, comprising at least the following steps:

[0070] Provide eukaryotic cells;

[0071] The cells are brought into contact with quinoline derivatives, and in particular compounds of formula (I).

[0072] The present invention further relates to in vitro or ex vivo methods for screening derived compounds, and particularly compounds of formula (I), wherein the derivatized compounds, and particularly compounds of formula (I), are presumed to be effective for treating and / or preventing inflammatory diseases, and the methods comprise at least the following steps:

[0073] Provide eukaryotic cells;

[0074] The cells are brought into contact with the compound of formula (I);

[0075] The expression of miR-124 in the cells was measured; and

[0076] When the expression level of miR-124 measured in step c) increases relative to a reference value, the candidate is selected, and the candidate is presumed to be effective for the treatment and / or prevention of inflammatory diseases. Brief description of the attached diagram

[0077] Figure 1: Dextran sulfate sodium (DSS-) induced colitis model 1—Changes in the percentage of weight loss over a period of time (days) in a DSS-mouse model in the presence of a quinoline derivative compound (24) as defined below. The percentage of weight loss (%) is shown on the y-axis. DSS treatment was performed from day 3 to day 10 (x-axis). Gavage with quinoline derivatives in methylcellulose (MC) or with MC alone was performed from day 3 to day 29.

[0078] Figure 2 : Dextran sulfate sodium (DSS-) induced colitis model 2 – Changes in the percentage of weight loss over a period of time (days) in the DSS-mouse model after a second round of DSS in the presence of a quinoline derivative compound (24) as defined below. The percentage of weight loss (%) is shown on the y-axis. DSS treatment was performed over 5 days (x-axis) starting from day 12. Graviton feeding with quinoline derivatives in methylcellulose (MC) or MC alone was performed from day 3 to day 29.

[0079] Figure 3 A dextran sulfate sodium (DSS-)-induced colitis model was established—the colon was removed 2–3 days after the second DSS treatment (5 days), and changes in colon size (cm) were measured. (ns) indicates no statistically significant difference. Statistical analysis was performed using the Mann-Whitney test, with asterisks indicating significant differences (p<0.5) and two asterisks indicating highly significant differences (p<0.05).

[0080] Figure 4 A dextran sulfate sodium (DSS-)-induced colitis model—the colon was removed on day 3 of the second DSS treatment, and the number of lesions was analyzed. The lesions were observed and measured under a microscope.

[0081] Figure 5 A dextran sulfate sodium (DSS-)-induced colitis model—the colon was removed on day 3 of the second DSS treatment, and the lesion area (mm²) was measured. 2 ).

[0082] Figure 6 Collagen-induced arthritis model – changes in joint swelling (mm) over a period of time (weeks) in a cohort of an average of 10 individuals. Joint swelling (mm) is shown on the y-axis. Changes between the untreated and treated groups were assessed over 12 weeks. Invention Details

[0083] There is a need to identify novel compounds for the treatment and / or prevention of inflammatory diseases.

[0084] Novel biomarkers are also needed to evaluate the activity of candidate drugs (e.g., quinoline derivatives) against inflammatory diseases.

[0085] The purpose of this invention is to meet these needs.

[0086] Quinoline derivatives

[0087] According to the first aspect, the subject matter of the present invention relates to the use of a compound of formula (I) or any pharmaceutically acceptable salt thereof in the treatment and / or prevention of inflammatory diseases:

[0088]

[0089] in:

[0090] Z is either C or N;

[0091] V is either C or N;

[0092] It refers to an aromatic ring, where V is C or N, and when V is N, V ​​is in the ortho, meta, or para position of Z, that is, forming a pyridine, pyridazine, pyrimidine, or pyrazine group, respectively.

[0093] R independently represents a hydrogen atom, a halogen atom, or a group selected from the following: –CN group, hydroxyl group, –COOR1 group, (C1-C3) fluoroalkyl group, (C1-C3) fluoroalkoxy group, (C3-C6) cycloalkyl group, -NO2 group, -NR1R2 group, (C1-C4) alkoxy group, phenoxy group, -NR1-SO2-NR1R2 group, -NR1-SO2-R1 group, -NR1-C(=O)-R1 group, -NR1-C(=O)-NR1R2 group, -SO2-NR1R2 group, -SO3H group, -O-SO2-OR3 group, -OP(=O)-(OR3)(OR4) group, -O-CH2-COOR3 group, and (C1-C3) alkyl group, wherein the alkyl group may optionally be monosubstituted by a hydroxyl group;

[0094] Q can be N or O, provided that R does not exist when Q is O.

[0095] R1 and R2 are independently hydrogen atoms or (C1-C3) alkyl groups;

[0096] R3 and R4 independently represent hydrogen atoms, Li + Na + K + N + (Ra)4 or benzyl group;

[0097] n is 1, 2, or 3;

[0098] n' is 1, 2 or 3;

[0099] R' independently represents a hydrogen atom or a group selected from the following: (C1-C3) alkyl group, halogen atom, hydroxyl group, -COOR1 group, -NO2 group, -NR1R2 group, morpholino or morpholino group, N-methylpiperazinyl group, (C1-C3) fluoroalkyl group, (C1-C4) alkoxy group, -OP(=O)-(OR3)(OR4) group and -CN group, and may further be a group selected from the following:

[0100]

[0101] A is a covalent bond, an oxygen atom, or NH;

[0102] B is a covalent bond or NH;

[0103] m is 1, 2, 3, 4 or 5;

[0104] p is 1, 2, or 3;

[0105] Ra and Rb independently represent a hydrogen atom, a (C1-C5) alkyl group, or a (C3-C6) cycloalkyl group;

[0106] Ra and Rb, together with the nitrogen atom to which they are attached, can further form a saturated 5- or 6-membered heterocycle, which may optionally further contain a heteroatom selected from N, O and S, and the heterocycle may optionally be substituted by one or more Ra, provided that when R' is a group (IIa) or (IIIa), only the other R' groups are different from the group (IIa) or (IIIa), and n' can be 2 or 3;

[0107] R” is a hydrogen atom, a (C1-C4) alkyl group, or a group (IIa) as defined above.

[0108] According to the preferred implementation scheme, Q is N.

[0109] According to another preferred embodiment, n is 1 or 2.

[0110] According to another preferred embodiment, n' is 1 or 2.

[0111] According to another preferred embodiment, R” is a hydrogen atom, a (C1-C4) alkyl group, or a group. Where m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0112] According to another preferred embodiment, R independently represents a hydrogen atom, a methyl group, a methoxy group, a trifluoromethyl group, a trifluoromethoxy group, an amino group, a halogen atom, and a -OP(=O)-(OR3)(OR4) group, and more specifically a fluorine atom or a chlorine atom, a trifluoromethoxy group, and an amino group.

[0113] According to another preferred embodiment, R' independently represents a hydrogen atom, a halogen atom, and more specifically a fluorine or chlorine atom, an amino group, a methyl group, a -OP (=O)-(OR3)(OR4) group, or a group. Where A is O or NH; m is 2 or 3; and X1 is O, CH2 or N-CH3, provided that when R' is the group described above, n' is 1 or 2, and when n' is 2, the other R' groups are different from the groups described above.

[0114] According to one aspect of the preferred embodiment, R' alternatively independently represents a hydrogen atom, a halogen atom, and more specifically a fluorine atom or a chlorine atom, a methyl group or a group. Where A is O or NH, m is 2, and X1 is O, CH2 or N-CH3, provided that when R' is the group described, n' is 1 or 2, and when n' is 2, the other R' groups are different from the group described.

[0115] All the specific embodiments described above and below can, of course, be combined and form part of this invention.

[0116] The compounds represented by formula (I) include those represented by formulas (Ia), (Ib), (Ic), (Id) and (Ie) as defined below.

[0117] According to a specific embodiment, another subject of the present invention is the use of the compound represented by formula (Ia) in the treatment and / or prevention of inflammatory diseases:

[0118]

[0119] Where R, R', R”, n and n' are defined as above;

[0120] According to one aspect of the preferred embodiment, n is 1 or 2.

[0121] According to one aspect of the preferred embodiment, n' is 1 or 2.

[0122] According to one aspect of the preferred embodiment, R independently represents a hydrogen atom, a halogen atom, or a group selected from hydroxyl groups, (C1-C3) fluoroalkyl groups, (C1-C3) fluoroalkoxy groups, -NR1R2 groups, (C1-C4) alkoxy groups, and (C1-C3) alkyl groups.

[0123] According to one aspect of the preferred embodiment, R' independently represents a hydrogen atom, a halogen atom, or a group selected from (C1-C3) alkyl groups, hydroxyl groups, -OP(=O)-(OR3)(OR4) groups, -NR1R2 groups, or other groups. The group, wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3, provided that when R' is the group described, n' is 1 or 2, and when n' is 2, the other R' groups are different from the group described.

[0124] According to one aspect of the preferred embodiment, R” is a hydrogen atom, a (C1-C4) alkyl group, or a group. Where m is 2 or 3, and X1 is O, CH2 or N-CH3, and preferably, R” is a hydrogen atom or a methyl group.

[0125] According to specific embodiments, another subject of the present invention is the use of the compound represented by formula (Ib) in the treatment and / or prevention of inflammatory diseases:

[0126]

[0127] R, R', R”, n, and n' are defined as above.

[0128] According to one aspect of the preferred embodiment, n is 1 or 2.

[0129] According to one aspect of the preferred embodiment, n' is 1, 2, or 3.

[0130] According to one aspect of the preferred embodiment, R independently represents a hydrogen atom, a halogen atom, or a group selected from hydroxyl groups, (C1-C3) fluoroalkyl groups, (C1-C3) fluoroalkoxy groups, -NR1R2 groups, (C1-C4) alkoxy groups, -OP(=O)-(OR3)(OR4) groups, and (C1-C3) alkyl groups.

[0131] According to one aspect of the preferred embodiment, R' independently represents a hydrogen atom, a halogen atom, or a group selected from (C1-C3) alkyl groups, hydroxyl groups, -OP(=O)-(OR3)(OR4) groups, -NR1R2 groups, or other groups. The group, wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3, provided that when R' is the group described, n' is 1 or 2, and when n' is 2, the other R' groups are different from the group described.

[0132] According to one aspect of the preferred embodiment, R' alternatively independently represents a hydrogen atom, a halogen atom, or a group selected from (C1-C3) alkyl groups, hydroxyl groups, or -NR1R2 groups.

[0133] According to one aspect of the preferred embodiment, R” is a hydrogen atom, a (C1-C4) alkyl group, or a group. Where m is 2 or 3, and X1 is O, CH2 or N-CH3, and preferably R” is a hydrogen atom or a methyl group.

[0134] According to specific embodiments, another subject of the present invention is the use of the compound represented by formula (Ic) in the treatment and / or prevention of inflammatory diseases:

[0135]

[0136] R, R', R”, n, and n' are defined as above.

[0137] According to one aspect of the preferred embodiment, n is 1.

[0138] According to one aspect of the preferred embodiment, n' is 1.

[0139] According to one aspect of the preferred embodiment, R independently represents a hydrogen atom, a halogen atom, or a group selected from hydroxyl groups, (C1-C3) fluoroalkyl groups, (C1-C3) fluoroalkoxy groups, -NR1R2 groups, (C1-C4) alkoxy groups, and (C1-C3) alkyl groups.

[0140] According to one aspect of the preferred embodiment, R alternatively independently represents a hydrogen atom or a halogen atom.

[0141] According to one aspect of the preferred embodiment, R' independently represents a hydrogen atom, a halogen atom, or a group selected from (C1-C3) alkyl groups, hydroxyl groups, -NR1R2 groups, or other groups. The group, wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3, provided that when R' is the group described, n' is 1 or 2, and when n' is 2, the other R' groups are different from the group described.

[0142] According to one aspect of the preferred embodiment, R' alternatively represents a hydrogen atom or a halogen atom independently.

[0143] According to one aspect of the preferred embodiment, R” is a hydrogen atom, a (C1-C4) alkyl group, or a group. Where m is 2 or 3, and X1 is O, CH2 or N-CH3, and preferably R” is a hydrogen atom or a methyl group.

[0144] According to a specific embodiment, another subject of the present invention is the use of the compound represented by formula (Id) in the treatment and / or prevention of inflammatory diseases:

[0145]

[0146] R, R', n, and n' are defined as above.

[0147] According to one aspect of the preferred embodiment, n is 1.

[0148] According to one aspect of the preferred embodiment, n' is 1.

[0149] According to one aspect of the preferred embodiment, R independently represents a hydrogen atom, a halogen atom, or a group selected from hydroxyl groups, (C1-C3) fluoroalkyl groups, (C1-C3) fluoroalkoxy groups, -NR1R2 groups, (C1-C4) alkoxy groups, and (C1-C3) alkyl groups.

[0150] According to one aspect of the preferred embodiment, R alternatively independently represents a hydrogen atom, a (C1-C3) fluoroalkyl group, a (C1-C3) fluoroalkoxy group, or a halogen atom.

[0151] According to one aspect of the preferred embodiment, R' independently represents a hydrogen atom, a halogen atom, or a group selected from (C1-C3) alkyl groups, hydroxyl groups, -NR1R2 groups, or other groups. The group, wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3, provided that when R' is the group described, n' is 1 or 2, and when n' is 2, the other R' groups are different from the group described.

[0152] According to one aspect of the preferred embodiment, R' alternatively represents a hydrogen atom or a halogen atom independently.

[0153] According to one aspect of the preferred embodiment, R” is a hydrogen atom, a (C1-C4) alkyl group, or a group. Where m is 2 or 3, and X1 is O, CH2 or N-CH3, and preferably R” is a hydrogen atom or a methyl group.

[0154] According to specific embodiments, another subject of the present invention is the use of the compound represented by formula (Ie) in the treatment and / or prevention of inflammatory diseases:

[0155]

[0156] R, R', n, and n' are defined as above.

[0157] According to one aspect of the preferred embodiment, n is 1.

[0158] According to one aspect of the preferred embodiment, n' is 1.

[0159] According to one aspect of the preferred embodiment, R independently represents a hydrogen atom, a halogen atom, or a group selected from hydroxyl groups, (C1-C3) fluoroalkyl groups, (C1-C3) fluoroalkoxy groups, -NR1R2 groups, (C1-C4) alkoxy groups, and (C1-C3) alkyl groups.

[0160] According to one aspect of the preferred embodiment, R alternatively independently represents a hydrogen atom, a (C1-C3) fluoroalkyl group, a (C1-C3) fluoroalkoxy group, or a halogen atom.

[0161] According to one aspect of the preferred embodiment, R' independently represents a hydrogen atom, a halogen atom, or a group selected from (C1-C3) alkyl groups, hydroxyl groups, -NR1R2 groups, or other groups. The group, wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3, provided that when R' is the group described, n' is 1 or 2, and when n' is 2, the other R' groups are different from the group described.

[0162] According to one aspect of the preferred embodiment, R' alternatively represents a hydrogen atom or a halogen atom independently.

[0163] According to one aspect of the preferred embodiment, R” is a hydrogen atom, a (C1-C4) alkyl group, or a group. Where m is 2 or 3, and X1 is O, CH2 or N-CH3, and preferably R” is a hydrogen atom or a methyl group.

[0164] According to another specific embodiment, the compounds (Id) and (Ie) defined above also constitute a part of this invention.

[0165] According to a preferred embodiment of the invention, some of the compounds represented by formula (I) are novel, constitute a part of the invention, and are selected from the following (and have the numbers found in Table 1 below):

[0166] -(8)8-Chloro-5-(3-(piperidin-1-yl)propoxy)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0167] -(9)8-chloro-N 4 -(3-(piperidin-1-yl)propyl)-N 2 -(4-(trifluoromethyl)pyridin-2-yl)quinoline-2,4-diamine

[0168] -(10)8-Chloro-N-methyl-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0169] -(11)8-chloro-N 4 -(2-morpholinoethyl)-N 2 -(4-(trifluoromethyl)pyridin-2-yl)quinoline-2,4-diamine

[0170] -(13)4,8-Dichloro-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0171] -(14)8-Chloro-N-(3-morpholinopropyl)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0172] -(15)8-Chloro-6-(2-morpholinethoxy)-N-(3-morpholinopropyl)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0173] -(16)8-Chloro-5-(2-morpholinethoxy)-N-(3-morpholinopropyl)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0174] -(17)8-Chloro-6-(2-(4-methylpiperazin-1-yl)ethoxy)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0175] -(18)8-Chloro-6-(2-(piperidin-1-yl)ethoxy)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0176] -(19)8-Chloro-6-(3-(piperidin-1-yl)propoxy)-N-(4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0177] -(20)8-chloro-N-(3-fluoro-4-(trifluoromethyl)pyridin-2-yl)quinoline-2-amine

[0178] -(21)N-(5-bromo-4-(trifluoromethyl)pyridin-2-yl)-8-chloroquinoline-2-amine

[0179] -(22)N 2 -(8-Chloroquinoline-2-yl)-N 5 -(3-(4-methylpiperazin-1-yl)propyl)-4-(trifluoromethyl)pyridine-2,5-diamine

[0180] -(28)8-Chloro-N-methyl-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0181] -(29)8-Chloro-5-(3-(piperidin-1-yl)propoxy)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0182] -(30)8-Chloro-N-(3-(piperidin-1-yl)propyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0183] -(31)8-Chloro-N-(2-morpholinoethyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0184] -(32)8-Chloro-N-(2-(pyrrolid-1-yl)ethyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0185] -(33)8-Chloro-N-(4-morpholinobutyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0186] -(34)8-chloro-N 4 -(3-(piperidin-1-yl)propyl)-N 2 -(4-(trifluoromethoxy)phenyl)quinoline-2,4-diamine

[0187] -(35)4,8-Dichloro-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0188] -(36)8-Chloro-5-(2-morpholinethoxy)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0189] -(37)N 1 -(4,8-dichloroquinoline-2-yl)-4-(trifluoromethoxy)benzene-1,2-diamine

[0190] -(38)4,8-Dichloro-N-(2-morpholinoethyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0191] -(39)8-Chloro-6-(2-morpholinethoxy)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0192] -(40)8-chloro-N 2 -(2-morpholinoethyl)-N 4 -(3-(piperidin-1-yl)propyl)-N 2 -(4-(trifluoromethoxy)phenyl)quinoline-2,4-diamine

[0193] -(41)8-Chloro-N-(2-morpholinoethyl)-N-(2-nitro-4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0194] -(42)N 1 -(8-Chloroquinoline-2-yl)-N 1 -(2-morpholinoethyl)-4-(trifluoromethoxy)benzene-1,2-diamine

[0195] -(43)8-Chloro-5-(2-morpholinethoxy)-N-(2-morpholinethyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine

[0196] -(44)N 1 -(8-chloro-5-(2-morpholinethoxy)quinolin-2-yl)-4-(trifluoromethoxy)phenyl-1,2-diamine

[0197] -(46)8-chloro-2-((4-(trifluoromethyl)pyridin-2-yl)oxy)quinoline

[0198] -(47)4-(2-((8-chloro-2-((4-(trifluoromethyl)pyridin-2-yl)oxy)quinoline-6-yl)oxy)ethyl)morpholine

[0199] -(48)8-chloro-2-(4-(trifluoromethoxy)phenoxy)quinoline

[0200] -(49)4-(2-((8-chloro-2-(4-(trifluoromethoxy)phenoxy)quinoline-6-yl)oxy)ethyl)morpholine

[0201] -(50)4-(2-((8-chloro-2-(4-(trifluoromethoxy)phenoxy)quinoline-5-yl)oxy)ethyl)morpholine

[0202] -(51) Phosphate mono-[8-chloro-2-(4-trifluoromethyl-pyridin-2-ylamino)-quinolin-6-yl] ester

[0203] -(52) Phosphate mono-[2-(8-chloro-quinoline-2-ylamino)-5-trifluoromethoxy-phenyl] ester

[0204] -(53) Phosphate mono-[8-chloro-2-(4-trifluoromethoxy-phenylamino)-quinoline-6-yl] ester

[0205] - and their medicinal salts.

[0206] For the purposes of this invention, the compounds represented by formula (I) include any one of the compounds represented by formulas (Ia), (Ib), (Ic), (Id), and (Ie), as well as combinations thereof. The compounds represented by formula (I) include compounds (1) to (53) as defined in Table 1, as well as combinations thereof.

[0207] The compounds of the present invention can exist in the form of free bases or form addition salts with pharmaceutically acceptable acids.

[0208] Suitable physiologically acceptable acid addition salts of the compounds represented by formula (I) include hydrobromide, tartrate, citrate, trifluoroacetate, ascorbate, hydrochloride, tartrate, trifluoromethanesulfonate, maleate, methanesulfonate, formate, acetate, and fumarate.

[0209] The compounds shown in formula (I) and / or their salts can form solvates or hydrates, and the present invention includes all such solvates and hydrates.

[0210] The terms "hydrate" and "solvent" simply refer to the fact that the compound (I) according to the invention can be in hydrate or solvate form, that is, in combination or combination with one or more water or solvent molecules. This is merely a chemical characteristic of such compounds, and it can be applied to all organic compounds of this type.

[0211] The compounds represented by formula (I) may include one or more asymmetric carbon atoms. Therefore, they may exist in enantiomeric or diastereomeric forms. These enantiomers, diastereomers, and mixtures thereof (including racemic mixtures) are covered within the scope of this invention.

[0212] In the context of this invention, the terminology is as follows:

[0213] - "Halogen" is understood to refer to chlorine, fluorine, bromine or iodine, and specifically to chlorine, fluorine or bromine;

[0214] - "(C1-C5)alkyl", as used herein, refers to C1-C5 saturated hydrocarbons, specifically normal, secondary, or tertiary hydrocarbons. Examples include, but are not limited to, methyl, ethyl, 1-propyl, 2-propyl, butyl, and pentyl.

[0215] - "(C3-C6)cycloalkyl" as used herein refers to cyclic saturated hydrocarbons. Examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

[0216] - "(C1-C4)alkoxy" as used herein refers to the O-(C1-C4) alkyl moiety, where the alkyl group is as defined above. Examples include, but are not limited to, methoxy, ethoxy, 1-propoxy, 2-propoxy, and butoxy.

[0217] - "Fluoroalkyl group" and "fluoroalkoxy group" refer to the alkyl group and alkoxy group defined above, respectively, wherein the group is substituted by at least one fluorine atom. Examples are perfluoroalkyl groups, such as trifluoromethyl or perfluoropropyl.

[0218] - "Saturated 5- or 6-membered heterocycles" as used herein refer to saturated rings containing at least one heteroatom. Examples include, but are not limited to, morpholine, piperazine, thiomorpholine, piperidine, and pyrrolidine;

[0219] - "Patient" can be extended to humans or mammals, such as cats or dogs.

[0220] The compounds of formula (I) applicable to this invention can be prepared as WO2010 / 143170, WO2010 / 143169, WO2012 / 080953 and WO2010 / 143168, and / or as further described below.

[0221] More specifically, the compound of formula (I) can be prepared according to the synthetic route described in WO2012 / 080953, wherein R' represents a group selected from the following groups as defined above: More specifically, when A is O.

[0222] When A is N, the following synthetic route can be implemented. The quinoline derivative shown in formula (VII) can be synthesized as a building block prior to further crosslinking reactions.

[0223] To obtain the compound shown in formula (VII), the following reaction sequence can be carried out as shown in Scheme 1 below.

[0224]

[0225] The compound shown in formula (II) can be placed in pyridine, wherein R' is different from H and, as defined above, can specifically be a chlorine atom, and then the compound shown in formula (III) is added at a molar ratio of 1 to 2 (e.g., 1.5) relative to the compound shown in formula (II). The reaction mixture is stirred at a temperature of 110°C to 150°C (e.g., 130°C) for 8 to 18 hours, for example, 14 hours. Upon cooling to room temperature, the reaction mixture can be concentrated under reduced pressure, and the resulting residue can be diluted with an organic solvent such as dichloromethane. The organic phase can then be washed with a saturated aqueous solution of an inorganic base (e.g., Na₂CO₃), dried on MgSO₄, filtered, and concentrated under reduced pressure to give the compound shown in formula (IV).

[0226] The compound shown in formula (IV) can be placed in a THF / water mixture, and sodium hydroxide is added at a molar ratio of 1 to 1.5 (e.g., 1.2) relative to the compound shown in formula (IV). The reaction mixture is then stirred at room temperature for 8 to 18 hours, for example, 14 hours. Concentrated hydrochloric acid can then be added until pH 2 is reached, and the resulting solution is extracted using an organic solvent such as ethyl acetate. The organic phase is then dried over MgSO4, filtered, and concentrated under reduced pressure to obtain the compound shown in formula (V).

[0227] The compound shown in formula (V) can be placed in polyphosphoric acid at a molar ratio of 5 to 15 (e.g., 10) relative to the compound shown in formula (V), and the reaction mixture is stirred at a temperature of 110 to 150°C (e.g., 130°C) for 8 to 18 hours, for example, 14 hours. Upon cooling to room temperature, an aqueous solution of sodium hydroxide with a molar concentration of 1 to 5 M (e.g., 2 M) can be slowly added. The resulting precipitate can be filtered, washed with water, and dried in a desiccator under reduced pressure to obtain the compound shown in formula (VI).

[0228] The compound shown in formula (VI) can be placed in POCl3 at a molar ratio of 5 to 15 (e.g., 10) relative to the compound shown in formula (VI), and the reaction mixture can be stirred at a temperature of 80 to 120°C (e.g., 100°C) for 1 to 5 hours, for example, 2 hours. Water can be slowly added while cooling to room temperature. The resulting precipitate can be filtered, washed with water, and dried in a desiccator under reduced pressure to obtain the compound shown in formula (VII).

[0229] As described in WO2010 / 143170, WO2010 / 143169, WO2012 / 080953 and WO2010 / 143168, and / or further described below, the intermediate compound of formula (VII) can be crosslinked with an aniline derivative, an aminopyridine derivative, a pyrimidine derivative, a hydroxypyridine derivative, a phenol derivative or a hydroxypyrimidine derivative to form the compound of formula (I).

[0230] Subsequently, the chlorine at position 4 of the intermediate compound shown in formula (VII) can be replaced by an amine to form a quinoline derivative with the group shown in formula (IIa) (and A = NH).

[0231] When Q = N and R” is different from H, the following approaches shown in schemes 2 and 3 can be used.

[0232] To obtain the compound represented by formula (IX), as shown in Scheme 2 below, the following reaction can be carried out.

[0233]

[0234] The compound of formula (VIII) (where Alk represents a (C1-C4) alkyl group and Hal represents a halogen atom, in a molar ratio of 1 to 2, e.g., 1.1, relative to the compound shown in formula (VIII)) can be placed in an anhydrous polar solvent (e.g., anhydrous N,N-dimethylformamide) in the presence of AklHal (where Alk represents a (C1-C4) alkyl group and Hal represents a halogen atom, in a molar ratio of 1 to 2, e.g., 1.1, relative to the compound shown in formula (VIII)). The reaction mixture is stirred at room temperature for 7 to 24 hours, e.g., 16 hours. The reaction mixture can be partitioned between water and an organic solvent (e.g., ethyl acetate). The organic phases are then combined, washed with a saturated aqueous solution of physiological saline, dried on MgSO4, filtered, and concentrated under reduced pressure to give the compound shown in formula (IX).

[0235] To obtain the compound represented by formula (XII), the following reaction can be carried out as shown in Scheme 3 below.

[0236]

[0237] In the presence of NaH (molar ratio of 2 to 5, e.g., 3), the compound of formula (X) (where Z, V, n, n', R, and R' are as defined above) can be placed in an anhydrous polar solvent (e.g., anhydrous N,N-dimethylformamide), and the reaction mixture can be stirred at room temperature for 10 to 50 minutes, e.g., 30 minutes. In the presence of KI (molar ratio of 1 to 2, e.g., 1 relative to the compound of formula (X)) and an organic base (e.g., Et3N, molar ratio of 1 to 2, e.g., 1 relative to the compound of formula (X)), the compound of formula (XI) (where m, B, Ra, and Rb are as defined above) can be placed in an anhydrous polar solvent (e.g., anhydrous N,N-dimethylformamide) in a molar ratio of 1 to 2, e.g., 1 relative to the compound of formula (X), and the reaction mixture can be stirred at room temperature in an inert atmosphere (e.g., argon) for 10 to 50 minutes, e.g., 30 minutes. The activated compound (X) can then be added to compound (XI), and the resulting reaction mixture is stirred at a temperature of 70°C to 110°C (e.g., 90°C) for 2 to 10 hours, for example, 4 hours. Upon cooling to room temperature, the reaction mixture can be concentrated under reduced pressure, and the resulting residue can be eluted with an organic solvent such as ethyl acetate. The organic phase can then be washed with a saturated aqueous solution of physiological saline, dried on MgSO4, filtered, and concentrated under reduced pressure to give the compound of formula (XII).

[0238] when When substituted with an amino group as shown in formula (IIa) (where A is NH), the following approach can be implemented as shown in scheme 4.

[0239]

[0240] The compound represented by formula (XIII) (where Z, V, n', R and R' are as defined above, and X is a halogen atom, such as Br) can be placed in a polar solvent mixture, such as a mixture of dioxane / N,N-dimethylformamide. Then, in the presence of a nonnucleophilic organic base (e.g., sodium tert-butoxide or potassium tert-butoxide) at a molar ratio of 2 to 5 (e.g., 3) relative to the total amount of the compound shown in formula (XIII), in the presence of diphosphine (e.g., Xantphos (4,5-bis(diphenylphosphino)-9,9-dimethyloxanthracene) or X-Phos (2-biscyclohexylphosphino-2',4',6'-triisopropyldiphenyl)) at a molar ratio of 5 mol% to 40 mol% relative to the total amount of the compound shown in formula (XIII), and in the presence of a catalyst (e.g., Pd(OAc)2 or Pd2(dba)3) at a molar ratio of 2 mol% to 15 mol% relative to the total amount of the compound shown in formula (XIII), the compound shown in formula (XIV) (wherein B, R) is added.a and R b As defined above, the compound is added in a molar ratio of 1 to 2 (e.g., 1.5) relative to the compound represented by formula (XIII). The reaction mixture can be heated in a microwave reactor at a temperature of 90°C to 150°C (e.g., 120°C) for 30 to 100 minutes, for example, 70 minutes. The reaction mixture can be concentrated under reduced pressure, and the residue can be diluted with an organic solvent such as ethyl acetate. The organic phase can be washed with water, decanted, dried on magnesium sulfate, filtered, and concentrated under pressure to give the compound represented by formula (XV).

[0241] The compound represented by the general formula (Id) defined above can be prepared according to the following scheme 5.

[0242]

[0243] The compound of formula (XVI) (where n' and R' are as defined above, and X is a halogen atom, such as Cl) can be placed in a polar solvent such as N,N-dimethylformamide in the presence of an inorganic base such as Cs₂CO₃ (molar ratio of 2 to 5, e.g., 3) and CuI (molar ratio of 1 to 2, e.g., 1). The compound of formula (XVII) (where R, V, and n are as defined above) can then be added at a molar ratio of 1 to 2 (e.g., 1) relative to the compound of formula (XVI). The reaction mixture can be heated in a microwave reactor at a temperature of 130°C to 170°C (e.g., 150°C) for 30 to 100 minutes, e.g., 50 minutes. Upon cooling to room temperature, water can be added to the reaction mixture. Undissolved solids can be filtered through diatomaceous earth, and the resulting filtrate can be extracted using an organic solvent such as ethyl acetate. The organic phase can then be washed with a saturated aqueous solution of water and physiological saline, dried on MgSO4, filtered, and concentrated under reduced pressure to obtain the compound shown in formula (Id).

[0244] The compound represented by the general formula (Ie) defined above can be prepared according to the following scheme 6.

[0245]

[0246] The compound of formula (XVI) (where n' and R' are as defined above, and X is a halogen atom, such as Cl) can be placed in a polar solvent such as N,N-dimethylformamide in the presence of an inorganic base such as Cs₂CO₃ (molar ratio of 2 to 5, e.g., 3) and CuI (molar ratio of 1 to 2, e.g., 1). The compound of formula (XIX) (where R, V, and n are as defined above) can then be added at a molar ratio of 1 to 2 (e.g., 1) relative to the compound of formula (XVI). The reaction mixture can be heated in a microwave reactor at a temperature of 130°C to 170°C (e.g., 150°C) for 30 to 100 minutes, e.g., 50 minutes. Upon cooling to room temperature, water can be added to the reaction mixture. Undissolved solids can be filtered through diatomaceous earth, and the resulting filtrate can be extracted using an organic solvent such as ethyl acetate. The organic phase can then be washed with a saturated aqueous solution of water and physiological saline, dried on MgSO4, filtered, and concentrated under reduced pressure to obtain the compound shown in formula (Ie).

[0247] More specifically, the compound of formula (I) can be prepared by starting with the compound of formula (XX) (where R' is an OH group) via the following route, where R' represents a -OP (=O)-(OR3)(OR4) group:

[0248]

[0249] Option 7

[0250] In the presence of diethylphosphoryl chloride in a molar ratio of 1 to the compound shown in formula (XX), and in the presence of an organic base such as triethylamine in a molar ratio of 1 to 2 (e.g., 1.2) to the compound shown in formula (XX), under an inert gas atmosphere (e.g., argon) at 0°C, the compound shown in (XX) (where Z, V, n, n', R, and R' are as defined above) can be placed in an anhydrous chloroalkane solvent such as anhydrous dichloromethane. The reaction mixture can be stirred at room temperature for 7 to 24 hours, for example, 14 hours. The reaction mixture can then be concentrated under reduced pressure, and the resulting residue can be partitioned between an aqueous solution of hydrochloric acid with a molar concentration of 1 to 2 M (e.g., 1 M) and an organic solvent such as ethyl acetate. The organic phases can then be combined, washed with a saturated aqueous solution of an inorganic base such as Na2CO3, dried on MgSO4, filtered, and concentrated under reduced pressure to obtain the compound shown in formula (XXI).

[0251] The compound of formula (XXI) can be placed in a polar aprotic solvent such as acetonitrile in the presence of trimethylbromosilane in a molar ratio of 1 to 5 (e.g., 4) relative to the compound of formula (XXI). The reaction mixture can be stirred under microwave irradiation at a temperature of 50°C to 70°C (e.g., 60°C) for 15 hours to 60 minutes, for example, 30 minutes. After cooling to room temperature, a mixture of MeOH / water (95 / 5) can be slowly added. The resulting precipitate can be filtered, washed with water, and dried in a desiccator under reduced pressure to give the compound of formula (XXII).

[0252] The same process can be used to obtain the compound of formula (I) starting from the compound shown in formula (I) (where R is an OH group), where R represents the -OP(=O)-(OR3)(OR4) group.

[0253] Inflammatory diseases

[0254] Therefore, the present invention also relates to compounds of formulas (Ia), (Ib), (Ic), (Id), and (Ie) for the treatment and / or prevention of inflammatory diseases.

[0255] Surprisingly, the inventors were able to demonstrate that, based on two in vivo mouse models, the compound represented by formula (I) significantly improved symptoms associated with inflammatory diseases such as inflammatory bowel disease (IBD) and rheumatoid arthritis (RA).

[0256] The inflammatory regulatory capacity of the compound represented by formula (I) has been evaluated in two established mouse models for two inflammatory diseases (inflammatory bowel disease (IBD) and rheumatoid arthritis (RA)). A mouse model of colitis induced by sodium dextran sulfate (DSS-) was used to study inflammatory bowel disease (see [link to study model]). &Cerar; "Dextran Sodium Sulphate Colitis Mouse Model: Traps and Tricks"; Journal of Biomedicine and Biotechnology (2012); 718617). Collagen-induced arthritis models have been used to study rheumatoid arthritis, as shown by Brand et al. ("Collagen-induced arthritis"; Nature Protocols; (2007); 2(5):1269-75).

[0257] In fact, the inventors have demonstrated that in a (DSS-)-induced colitis mouse model, administration of compounds belonging to formula (I) in vivo improved colon length and reduced alterations in lymphoid organs (e.g., Peyer's Patche). The inventors have further demonstrated that in a collagen-based induced arthritis mouse model, administration of compounds of formula (I) significantly reduced swelling and downgraded inflammatory symptoms.

[0258] According to the present invention, inflammation is characterized by pain, fever, redness and swelling, and can be caused by infection, irritation or loss.

[0259] Therefore, "inflammatory diseases" refers to a group of diseases and / or disorders caused by excessive or disordered inflammation.

[0260] According to the present invention, “treatment and / or prevention of inflammatory diseases” can refer to the treatment and / or prevention of inflammatory diseases or inflammation itself (which may occur in an individual along with the inflammatory disease).

[0261] Therefore, the treatment and / or prevention of inflammatory diseases also includes the treatment and / or prevention of such inflammation.

[0262] According to the present invention, “treatment and / or prevention” of inflammatory diseases includes treating the inflammatory disease, reducing the likelihood of the development of the inflammatory disease, or delaying the occurrence of the inflammatory disease.

[0263] According to the present invention, "individual" may refer to a human or a non-human mammal, preferably a human.

[0264] In a non-limiting sense, inflammatory diseases include: inflammatory diseases associated with autoimmune diseases, inflammatory diseases of the central nervous system (CNS), arthritic diseases, inflammatory digestive tract diseases, inflammatory skin and other inflammatory diseases related to epithelial cells (e.g., bronchitis), cancer-related inflammation (e.g., colon cancer), irritation-related inflammation, and injury-related inflammation.

[0265] Therefore, inflammatory diseases can be selected from the following list: inflammatory diseases related to autoimmune diseases, inflammatory diseases of the central nervous system (CNS), arthritic diseases, inflammatory digestive tract diseases, inflammatory skin and other inflammatory diseases related to epithelial cells (e.g., bronchitis), cancer-related inflammation, irritation-related inflammation, and injury-related inflammation.

[0266] Specifically, inflammatory diseases are selected from the following list: inflammatory bowel disease, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, Alzheimer's disease, Parkinson's disease, osteoarthritis, atherosclerosis, ankylosing spondylitis, psoriasis, dermatitis, Sjogren's syndrome, bronchitis, asthma, and inflammation associated with colon cancer.

[0267] More specifically, inflammatory diseases are selected from the following list: inflammatory bowel disease, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, osteoarthritis, ankylosing spondylitis, psoriasis, Sjogren's syndrome, bronchitis, and inflammation associated with colon cancer.

[0268] More specifically, inflammatory diseases are selected from the following list: inflammatory bowel disease, rheumatoid arthritis, Crohn's disease, ulcerative colitis, multiple sclerosis, osteoarthritis, ankylosing spondylitis, and psoriasis.

[0269] Preferably, the inflammatory diseases according to the present invention include: inflammatory bowel disease, Crohn's disease, ulcerative colitis, rheumatoid arthritis, and multiple sclerosis.

[0270] Even more preferably, the inflammatory diseases according to the present invention include: inflammatory bowel disease, rheumatoid arthritis, and multiple sclerosis.

[0271] Inflammatory diseases can also include Alzheimer's disease, Parkinson's disease, asthma, atherosclerosis, and dermatitis.

[0272] Regarding dermatitis, eczema can be cited.

[0273] From the above perspective, the present invention relates to compounds of formula (I) for the treatment and / or prevention of inflammatory diseases, wherein the diseases include the inflammation described herein, as well as inflammation associated with inflammatory diseases.

[0274] Therefore, the present invention also relates to the use of compounds of formula (I) for the treatment and / or prevention of inflammatory diseases, wherein the diseases encompass the inflammation described herein, as well as inflammation associated with inflammatory diseases.

[0275] According to another aspect, the subject matter of the present invention relates to compounds (Ie), (Id), (8), (9), (10), (11), (44), (46), (47), (48), (49), (50), (51), (52), (53) or pharmaceutically acceptable salts thereof, used alone or in combination as pharmaceuticals.

[0276] According to another purpose, the present invention relates to pharmaceutical compositions comprising, alone or in combination, compounds (Ie), (Id), (8), (9), (10), (11), (44), (46), (47), (48), (49), (50), (51), (52), (53) or pharmaceutically acceptable salts thereof.

[0277] The present invention also relates to the use of compounds of formula (I) for the preparation of compositions (e.g., pharmaceuticals) for the treatment and / or prevention of inflammation, wherein the inflammation includes the aforementioned inflammation, as well as inflammation associated with inflammatory diseases.

[0278] The present invention also relates to a method for treating and / or preventing inflammatory diseases, wherein the inflammatory disease includes said inflammation and inflammation associated with said inflammatory disease, and the method includes the step of administering a compound of formula (I) to a patient in need.

[0279] miRNA-124

[0280] MicroRNAs (miRNAs) are small, single-stranded non-coding RNAs that function in the cytoplasm of cells, reducing the expression of their homologous target messenger RNAs or the translation of protein products from mRNAs. Mature miRNAs are typically about 19-23 nucleotides in length. This ability of miRNAs to inhibit the production of their target proteins regulates a variety of cellular activities, such as cell fate determination, apoptosis, differentiation, and tumor formation.

[0281] miR-124 was initially cloned in mice. Human miR-124 precursors (or miRN-124, miRNA-124, or microRNA 124) are cloned from embryonic stem cells. To date, nine haplotypes of miR-124 precursors have been identified (Guo et al., PLoS ONE, 2009, 4(11):e7944), three of which exist as human hsa-miR-124-1, hsa-miR-124-2, and hsa-miR-124-3 (SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively).

[0282] The miR-124 microRNA precursor is a small non-coding RNA molecule. The mature ~21 nucleotide microRNA is obtained from the hairpin precursor sequence through processing with the Dicer enzyme. The mature sequence of miR-124-3p is SEQ ID NO:4, and the mature sequence of miR-124-5p is SEQ ID NO:5.

[0283] According to the present invention, measuring the expression level of miR-124 encompasses measuring the expression level of either precursor or mature miR-124.

[0284] The present invention also relates to compounds of formula (I) for increasing the expression of miR-124 in biological samples.

[0285] Therefore, according to another stated objective, the present invention relates to an in vitro or ex vivo method for increasing the expression of miR-124 in eukaryotic cells, the method comprising at least the following steps:

[0286] Provide eukaryotic cells;

[0287] The cells are brought into contact with the derived compounds, particularly those of formula (I).

[0288] Methods for screening candidate compounds

[0289] A key factor for the successful development of a given drug or vaccine is the ability to efficiently and rapidly assess its efficacy. Therefore, it is important to have suitable tools, such as specific biomarkers, available for evaluating the efficacy of a drug or vaccine.

[0290] Surprisingly, miR-124 has been found to play an important role in the inflammatory process. In fact, the inventors have shown that the compound represented by formula (I) can regulate the expression of miR-124. Specifically, the inventors have shown that the compound of the present invention can upregulate (increase by up to 100-fold) the expression of miR-124 in donor-derived peripheral blood mononuclear cells (PBMCs) (via FICOLL). TM Gradient centrifugation separation).

[0291] Since the inventors have now established that the compound represented by formula (I) can regulate the expression of miR-124, the present invention also relates to in vitro or ex vivo methods for screening quinoline derivatives, particularly compounds represented by formula (I), wherein the compounds are presumed to be effective for the treatment and / or prevention of inflammatory diseases.

[0292] Therefore, according to another objective, the present invention relates to the in vitro or ex vivo use of at least one miRNA as a biomarker for screening quinoline derivatives, particularly compounds represented by formula (I), wherein the at least one miRNA is miR-124, and the compounds are presumed to be effective for the treatment and / or prevention of inflammatory diseases.

[0293] Therefore, the present invention also relates to in vitro or ex vivo methods for screening quinoline derivatives, particularly compounds of formula (I), wherein the compounds are presumed to be effective for treating and / or preventing inflammatory diseases, the method comprising at least the following steps:

[0294] Provide eukaryotic cells;

[0295] The cells are brought into contact with the compound of formula (I);

[0296] The expression of miR-124 in the cells was measured; and

[0297] When the expression level of miR-124 measured in step c) is modulated relative to a reference value, the candidate is selected, and the candidate is presumed to be effective for the treatment and / or prevention of inflammatory diseases.

[0298] According to the present invention, the "regulation" of expression levels includes both upregulation and downregulation. For the purposes of this invention, the "regulation" of miR-124 expression levels preferably refers to upregulation.

[0299] Specifically, the present invention relates to an in vitro or ex vivo method for screening quinoline derivatives, particularly compounds of formula (I), wherein the compounds are presumed to be effective for the treatment and / or prevention of inflammatory diseases, and the method comprises at least the following steps:

[0300] Provide eukaryotic cells;

[0301] The cells are brought into contact with the compound of formula (I);

[0302] The expression of miR-124 in the cells was measured; and

[0303] When the expression level of miR-124 measured in step c) increases relative to a reference value, the candidate is selected, and the candidate is presumed to be effective for the treatment and / or prevention of inflammatory diseases.

[0304] According to one implementation, the presence or expression level of miR-124 is measured by eukaryotic cells obtained from biological samples and compared with a control reference value.

[0305] Specifically, the "biological sample" applicable to this invention can be a biological fluid, such as blood, plasma or serum, saliva, intercellular fluid, or urine; a cell sample, such as a cell culture, cell line, stem cell line, or a sample containing peripheral blood mononuclear cells (PBMCs); or a tissue biopsy, such as oral tissue, gastrointestinal tissue, skin, oral mucosa tissue, or various samples obtained from clinical trials. The sample can be a crude sample or can be purified to various degrees before storage, processing, or measurement.

[0306] Specifically, the biological samples suitable for use in this invention are peripheral blood mononuclear cells (PBMCs) or samples containing PBMCs. Therefore, the biological samples of this invention can be obtained from peripheral whole blood using common techniques in the art, such as density gradient centrifugation, more specifically fibrominated plasma. TM gradient.

[0307] PBMC samples (especially those using FICOLL) TM Gradient-processed samples tend to contain lymphocytes (T cells, B cells, and NK cells), monocytes, and dendritic cells. The incidence of these populations varies among individuals in humans.

[0308] Therefore, in a non-limiting sense, eukaryotic cells include any type of cell as defined above, such as lymphocytes (T cells, B cells, and NK cells), monocytes, and dendritic cells.

[0309] Prior to implementing this invention, the step of collecting biological samples for the purposes and methods of this invention is performed, and the steps described are not steps according to the purposes or methods of this invention.

[0310] Samples for miRNA evaluation can be obtained at any desired interval. For example, samples can be obtained hourly, twice daily, daily, weekly, monthly, every other month, yearly, etc. These samples can be tested immediately or stored for later testing.

[0311] The sample can be purified prior to testing. In some embodiments, miR-124 can be isolated from the remaining cellular contents prior to testing. Furthermore, if desired, miR-124 molecules can be isolated from the remaining mRNA in the sample. For example, miR-124 can be isolated from mRNA based on size differences prior to testing.

[0312] The control reference values ​​used for comparison with the miR-124 expression levels measured in the biological samples being tested were obtained from the control samples.

[0313] Control samples can be obtained from a variety of sources. In some embodiments, control samples are taken from patients prior to treatment or before the presence of disease (e.g., archived blood samples). In other embodiments, control samples are taken from members of a healthy, disease-free population. In yet another embodiment, cell testing can be performed on control cell cultures, such as cell cultures untreated with the test compound or those already treated with a reference compound (e.g., DMSO, methylcellulose (MC), or water).

[0314] According to one implementation scheme, in order to determine or monitor inflammatory diseases in patients, control reference values ​​can be obtained from isolated biological samples obtained from individuals or groups of individuals who are known not to have the stated condition.

[0315] According to another embodiment, in order to determine or monitor the efficacy of treatment for inflammatory diseases in patients, a control reference value may be obtained from isolated biological samples of an individual or group of individuals, wherein the individual or group of individuals is known not to have the condition and / or not to have received a treatment whose efficacy is to be determined or monitored. Alternatively, the control reference value may be obtained from isolated biological samples obtained from patients, wherein the patients have inflammatory diseases and have received a treatment whose efficacy is to be determined or monitored, the isolated biological samples being obtained from the patients prior to treatment administration.

[0316] Technicians can use a variety of methods to measure the presence or expression level of the miR-124 biomarker.

[0317] For example, nucleic acid tests or arrays can be used to assess the presence and / or expression level of miR-124 in a sample.

[0318] The sequence of miR-124 can be used to prepare corresponding nucleotides, which serve as complementary probes or primers in various nucleic acid assays to detect the expression or presence of the miR-124 biomarker in samples, for example, but not limited to Northern blotting and PCR-based methods (e.g., real-time reverse transcription-PCR or qRT-PCR). Methods such as qRT-PCR can be used to accurately quantify the amount of miRNA in a sample.

[0319] Every process known to those skilled in the art can be used to obtain the sense and antisense probes or primers according to the invention, specifically as described in Sambrook et al. (Molecular Cloning: Laboratory Manual, 3...). rd Those described in ED., 2001, Cold Spring Harbour, NY.

[0320] Methods related to the detection and quantification of RNA or DNA are well known in the art. Those skilled in the art may refer to, for example, Wang et al. (1989, Proc Natl Acad Sci USA, Vol. 86: 917-921), Wong et al. (2005, BioTechniques, Vol. 39(1): 75-85), Nolan et al. (2006, Nat Protoc, Vol. 1(3): 1559-1582), Klinck et al. (2008, Cancer Research, Vol. 68: 657-663), or the general review published by Bustin (2000, Journal of Molecular Endocrinology, Vol. 25: 169-193).

[0321] Isolation nucleic acid probes suitable for measuring the presence or expression level of miR-124 are nucleic acid probes that can specifically hybridize with miR-124, such as precursor or mature miR-124.

[0322] Such nucleic acid probes may contain 18 to 30 nucleotides, particularly 20 to 27, preferably 20 to 25, more preferably 20, 22 or 25, and even more preferably about 25 nucleotides. As previously shown, such nucleic acid probes can be prepared according to any method known in the art.

[0323] Various methods and formulas are known in the art for predicting the optimal hybridization temperature for a given probe and a given target.

[0324] Therefore, those skilled in the art can easily calculate the optimal hybridization temperature based on a set of probes, a given target sequence, and specific hybridization conditions.

[0325] Advantageously, the optimal hybridization temperature of the probe is 40°C to 60°C, and more specifically 45°C to 55°C, and preferably about 48°C.

[0326] Examples of buffers used for hybridization of the nucleic acid probes and biomarkers of the present invention include a buffer containing 100 mM MES, 1 M [Na+], 20 mM EDTA, and 0.01% Tween-20 as a hybridization buffer; a buffer containing 6X SSPE and 0.01% Tween-20 as a non-strict washing buffer; and a buffer containing 100 mM MES, 0.1 M [Na+], and 0.01% Tween-20 as a strict washing buffer.

[0327] In one embodiment, the method for nucleic acid detection and quantification can be a fluorescent dye-based method, wherein the concentration of the nucleic acid is assessed by measuring the fluorescence intensity of a ligand, such as a dye, that binds to the nucleic acid. Fluorescent dyes are well known in the art.

[0328] Alternatively, spectrophotometry can be used to quantify the nucleic acid.

[0329] In another embodiment, the method for nucleic acid detection and quantification can be a hybridization-based method. The hybridization-based method may include PCR and quantitative PCR (qRT-PCR or q-PCR) techniques, or reverse transcriptase / polymerase-based techniques. Advantageously, the method may include or further combine with a sequencing step.

[0330] These methods may include: (i) a step of extracting cellular mRNA; (ii) a step of reverse transcribing the mRNA into DNA using reverse transcriptase; and (iii) a step of amplifying the DNA obtained from the preceding steps. Typically, starting from the same sample, the following nucleic acids are amplified: (a) DNA obtained after the reverse transcription step of the target mRNA; and (b) DNA or multiple DNAs obtained after the reverse transcription of mRNA, wherein the mRNA is constitutively and persistently expressed by the cells (Householding Genes), such as RNA encoded by the genes MRPL19, PUM1, and GADPH.

[0331] The amplified DNA can be quantified after separation by electrophoresis and measurement of DNA bands. Results relating to the target mRNA can be expressed in relative units compared to the mRNA encoded by the *Household* gene. In some embodiments, the separation step of the amplified DNA is performed after agarose gel electrophoresis, followed by staining of the DNA bands with ethidium bromide, and then quantification of the DNA contained in these migrating bands using densitometry. In other embodiments, a microchannel device can be used, in which the amplified DNA is separated by capillary electrophoresis and then quantified using a laser beam to measure the emitted signal. Such a device can be... Devices, such as those from the GX series, use the trademarks of Caliper LifeSciences (Hopkinton, MA, USA).

[0332] Quantitative results obtained via qRT-PCR can sometimes provide more information than quantitative data and can simplify testing standards and quality management. Therefore, in some implementations, qRT-PCR-based assays can be used to measure miRNA levels during cell-based assays. qRT-PCR methods can also be used to monitor patient treatment. Commercially available methods are qRT-PCR-based methods (e.g., TaqMann® Array). TM ).

[0333] Any suitable assay platform can be used to determine the expression or presence of miRNAs in a sample. For example, the assay can take the form of a dipstick, membrane, chip, disk, test strip, filter, microsphere, slide, multiwell plate, or optical fiber. The assay system can have a solid support on which oligonucleotides corresponding to the miRNAs are attached. The solid support can include, for example, plastic, silicon, metal, resin, glass, membrane, particles, precipitate, gel, polymer, sheet, sphere, polysaccharide, capillary, lamina, or slide. The assay components can be prepared or packaged together as a kit for detecting miRNAs.

[0334] In some embodiments, oligonucleotide arrays can be prepared or purchased for testing the activity of quinoline derivatives or drug candidates in biological samples. The array typically comprises a solid support and at least one oligonucleotide in contact with the support, wherein said oligonucleotide corresponds to at least a portion of the miR-124 biomarker. In some embodiments, a portion of the miR-124 biomarker contains at least 5, 10, 15, 20, or more bases.

[0335] According to one implementation, the presence or expression of miR-124 can be tested in conjunction with other miRNAs (also used as biomarkers). In such implementations, the array can be used to assess the expression or presence of multiple miRNAs in a sample, including miRNA-124. Generally, the method includes the steps of: a) contacting the sample with an array containing a probe set under conditions sufficient for specific binding to occur; and b) examining the array to detect the presence of any detectable markers, thereby evaluating the amount of each target miRNA in the sample. The use of expression arrays can obtain a miRNA expression profile for a given sample.

[0336] The methods for preparing the test or the arrays for testing miRNAs are disclosed in the art and do not need to be described in further detail herein.

[0337] Nucleic acid arrays can be used to detect the presence or differential expression of miRNAs in biological samples. Polynucleotide arrays (e.g., DNA or RNA arrays) typically contain regions of polynucleotides (“capture agents”) arranged in a predetermined configuration on a support. The array is “addressable” because these regions (often referred to as “array features”) have different predetermined locations (“addresses”) on the array support. Specific miRNA targets will be detected in regions on the array at specific predetermined locations (i.e., “addresses”) (i.e., “features” or “points” of the array). Polynucleotide arrays are typically fabricated on a planar support by depositing pre-obtained polynucleotides onto the support in a site-specific manner or by synthesizing polynucleotides in situ on the support specifically. Arrays for detecting miRNA expression can be fabricated by depositing precursor units (e.g., nucleotide or amino acid monomers) or pre-synthesized capture agents, e.g., by contact- or jet-based methods or photolithography. After depositing the polynucleotide capture agent onto the support, the support is typically treated (e.g., washed and blocked) and stored before use.

[0338] The array for detecting miRNA expression has at least two, three, four, or five different target probes. However, in some embodiments, the target array may comprise a probe set having at least 10, at least 20, at least 50, at least 100, at least 200, at least 500, at least 1000, or more probes capable of detecting a corresponding number of miRNAs. In some embodiments, the target array may comprise at least some or all of the probes for detecting identified miRNAs in an organism, or may comprise orthologous probes derived from multiple organisms.

[0339] Under conditions that promote specific binding of miRNAs in the sample to one or more capture agents present on the array to reveal the observed binding pattern, a nucleic acid array can be contacted with a sample containing miRNA analytes or a labeled sample. This binding pattern can be detected when the array is interrogated. For example, a suitable label (e.g., a fluorescent compound) can be used to label the target miRNA in the sample, and then, after the array is exposed to the sample, the label on the array can be precisely observed (e.g., by observing the fluorescent pattern). The observed binding pattern can indicate the presence and / or concentration of one or more miRNA components in the sample.

[0340] The labeling of miRNAs can be carried out using methods well-known in the art, such as using DNA ligases, terminal transferases, or by labeling the RNA backbone. In some embodiments, miRNAs can be labeled using fluorescent markers. Exemplary fluorescent dyes include, but are not limited to, xanthracene dyes, fluorescein dyes, rhodamine dyes, fluorescein isothiocyanate (FITC), 6-carboxyfluorescein (FAM), 6-carboxy-21,41,7',4,7-hexachlorofluorescein (HEX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE or J), N,N,N',N'-tetramethyl6-carboxyrhodamine (TAMRA or T), 6-carboxy-X rhodamine (ROX or R), 5-carboxyrhodamine 6G (R6G5 or G5), 6-carboxyrhodamine 6G (R6G6 or G6), and rhodamine 110; cyan dyes, such as Cy3, Cy5, and Cy7 dyes; Alexa dyes, such as Alexa-fluor-555; coumarin, diethylaminocoumarin, umbelliferone; benzylimine dyes, such as Hoechst 33258; and phenanthridine dyes, such as Texas. Red; bromoethylfiridine dyes; acridine dyes; carbazole dyes; phenoxazine dyes; porphyrin dyes; polyacetylenic dyes, BODIPY dyes, quinoline dyes, Pyrene, fluorescein triazine, Rl 10, Eosin, JOE, R6G, tetramethylrhodamine, Lissamine, ROX, Naptho fluorescein, etc.

[0341] In some embodiments, nucleotide arrays for evaluating immunomodulatory activity can be prepared or purchased from, for example, Affymetrix. The array may comprise a solid support and a plurality of oligonucleotides in contact with the support. The oligonucleotides may be present at specific addressable sites on the solid support; each oligonucleotide corresponds to at least a portion of a miRNA sequence that is differentially expressed when cells or patients are treated with a quinoline derivative or a drug candidate. The miRNA sequence includes at least one miR-124 sequence.

[0342] When arrays are used to evaluate miRNAs, a typical approach may include the following steps: 1) obtaining an array containing surface-binding target probes; 2) hybridizing the miRNA population to the surface-binding probes under conditions sufficient to provide specific binding; 3) washing after hybridization to remove unbound nucleic acids from the hybridization; and 4) detecting the hybridized miRNAs. The reagents used in each of these steps and the conditions under which they are used may vary depending on the specific application.

[0343] Hybridization can be performed under suitable hybridization conditions, which can be varied in terms of rigor as needed. Typical conditions are sufficient to generate probe / target complexes on the array surface between complementary binding members (i.e., between the target probe bound to the surface and the complementary miRNA in the sample). In some embodiments, stringent hybridization conditions may be employed. Hybridization is typically performed under stringent hybridization conditions. Standard hybridization techniques known in the art (e.g., under conditions sufficient to provide specific binding of the target miRNA in the sample to the probe on the array) are used to hybridize the sample with the nucleic acid array. The selection of suitable conditions (including temperature, salt concentration, polynucleotide concentration, hybridization time, stringency of washing conditions, etc.) depends on the experimental design, including the sample source, the characteristics of the capture agent, the expected degree of complementarity, etc., and can be determined by routine experimentation for those skilled in the art. Generally, for nucleic acid hybridization, “stringent hybridization” and “stringent hybridization washing conditions” are sequence-dependent and vary under different experimental conditions. Hybridization can be performed over approximately 12 to approximately 24 hours. The stringency of the washing conditions can affect the degree to which the miRNA sequence specifically hybridizes with the complementary capture agent. Those of ordinary technical skill would readily recognize that alternative, but comparable, hybridization and washing conditions could be used to provide similar rigorous conditions.

[0344] As shown, in one implementation, the Affymetrix Genechip miRNA Array2.0 can be used to perform miRNA expression profiling experiments according to the protocol described in the instructions.

[0345] In a specific implementation plan, the The hybridization described herein is performed using the Hybridization, Wash, and Stain Kit (Affymetrix Ref. #900720). Advantageously, the hybridization is performed according to the manufacturer's provided protocol.

[0346] Following miRNA hybridization, the bound polynucleotides on the array surface are typically washed to remove unbound nucleic acids. Any standard washing protocol can be used, where the washing conditions are usually stringent, as described above. For example, washing buffers (Ref. #900721 ​​and #900722) sold by Affymetrix can be used to perform the washing step. Then, standard techniques for reading the array are used to detect the hybridization of the target miRNA and the probe. For example, reading the hybridized array can be performed by illuminating the array and reading the position and intensity of the fluorescence obtained at various features of the array to detect the miRNA / probe binding complex.

[0347] The presence or expression level of miR-124 relative to a control (e.g., a control reference value obtained from a healthy donor) can indicate inflammatory disease. Specifically, a reduced or inhibited presence or decreased expression level of the miRNA relative to a control reference value (i.e., a control reference value obtained from a healthy donor) can indicate inflammatory disease.

[0348] Therefore, in one embodiment, the use of the present invention may include obtaining or measuring the expression level of miR-124 in an isolated biological sample, and comparing said measured expression level with a control reference value. Observing the regulation of said measured level relative to said control reference value may indicate an inflammatory disease, or treatment of said inflammatory disease.

[0349] In the presence of a drug candidate, an increased or upregulated level of miR-124 expression relative to a control reference (i.e., treatment not achieved with the drug candidate, such as a quinoline derivative) indicates that the drug candidate is presumably effective for the treatment and / or prevention of inflammatory diseases.

[0350] Therefore, when miR-124 obtained from a sample is “increased” or “upregulated” in a biological sample compared to a control reference, this increase can be approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 90%, 100%, 200%, 300%, 500%, 1,000%, 5,000% or higher of the comparative control reference (i.e., not treated with quinoline derivatives).

[0351] Specifically, the measured expression level of miR-124 relative to the control reference value can be at least 2 times, preferably at least 4 times, preferably at least 6 times, preferably at least 8 times, and more preferably at least 10 times.

[0352] According to a preferred embodiment, the measured expression level of miR-124 can be at least 100 times relative to the control reference value.

[0353] According to one embodiment, the use or method according to the invention can be implemented for optimizing a patient's dosing regimen. Patients may produce varying responses to a given quinoline derivative (specifically, a compound represented by formula (I)) depending on a variety of factors such as age, health, genetic background, presence of other complications, disease progression, and other co-administered medications. It is useful to use miR-124 biomarkers to assess and optimize quinoline derivative dosing regimens in patients, such as dosage and / or dosing schedules. In this regard, miR-124-based biomarkers can also be used to track and regulate the treatment effectiveness of individual patients over time. Biomarkers can be used to gather information needed to make decisions in patient treatment, thereby increasing or decreasing the dosage of the agent as needed. For example, miR-124-based biomarkers can be used to examine patients receiving quinoline derivatives to see if the dosage will be effective or if a more aggressive treatment plan is required. The amount of medication administered, the timing of administration, the frequency of administration, and the duration of administration can be adjusted based on the measurement of the miR-124 biomarker.

[0354] The miR-124 biomarker can also be used to track patient compliance during individualized treatment regimens or clinical trials. Patient compliance can be tracked at predetermined intervals to ensure that patients included in the trial are taking medication as directed. Furthermore, the miR-124 biomarker can be used to examine patients receiving quinoline derivatives to determine whether they are adhering to the prescribed dosage regimen. Increased expression levels of the biomarker compared to untreated control samples indicate adherence to the regimen.

[0355] Therefore, without departing from the scope of the invention, the control reference value can be obtained from eukaryotic cells derived from healthy donors and / or biological samples from donors who have not been previously treated with the given candidate drug (e.g., the given quinoline derivative).

[0356] The biomarkers of the present invention can be implemented for evaluating and tracking the potency of quinoline derivatives, specifically compounds of formula (I). Thus, the presence or expression level of miR-124 in isolated biological samples obtained from patients previously treated with quinoline derivatives, such as compounds of formula (I), can be measured.

[0357] Next, the presence or expression level of miR-124 in the isolated biological samples was measured and compared with the control reference value.

[0358] When an increased level of miR-124 expression is observed relative to a control reference, the measurement indicates the activity of a quinoline derivative, specifically a compound represented by formula (I).

[0359] In another implementation, when an increased level of miR-124 expression is observed relative to a control reference, the measurement can indicate a patient's response to treatment with the quinoline derivative, specifically the compound represented by formula (I).

[0360] In another implementation, when an increase in the measured level is observed relative to a control reference value, the measurement indicates the effectiveness of treatment using the quinoline derivative, specifically the compound represented by formula (I).

[0361] In another embodiment, when an increased expression level of miR-124 is observed relative to a control reference value, the measurement indicates the therapeutic efficacy of the quinoline derivative, specifically the compound of formula (I), as a therapeutic agent for the prevention and / or treatment of inflammatory diseases.

[0362] In another embodiment, when an increased level of miR-124 expression is observed relative to a control reference, if the control reference is measured from a biological sample (derived from a patient treated with another dosage regimen), the measurement indicates the therapeutic efficacy of the quinoline derivative, specifically the compound of formula (I), as a therapeutic agent for the prevention and / or treatment of inflammatory diseases.

[0363] The chemical structures and spectral data of some compounds represented by formula (I) are shown in Table I and Table II below (see Examples).

[0364] Table I

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372]

[0373] The embodiments provided herein are merely exemplary, and those skilled in the art will recognize or be able to ascertain numerous equivalents of particular compounds, materials, and processes using only conventional experimentation. All such equivalents are considered to be within the scope of this invention and are covered by the appended claims. Example

[0374] Example 1: 8-Chloro-N 4 -(3-(piperidin-1-yl)propyl)-N 2 -(4-(trifluoromethyl)pyridin-2-yl)quinoline-2,4-diamine; compound (9)

[0375] o-Chloroaniline (5.3 mL, 50 mmoles, 1 eq.) was placed in pyridine (8 mL). Diethylmalonate (11.4 mL, 75 mmoles, 1.5 eq.) was then added, and the reaction mixture was stirred at 130 °C for 14 hours. Upon cooling to room temperature, the reaction mixture was concentrated under reduced pressure, and the resulting residue was diluted with dichloromethane. The organic phase was then washed with a saturated aqueous solution of Na₂CO₃, dried over MgSO₄, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel to provide ethyl 2-[(2-chlorophenyl)carbamoyl]acetate (2.7 g, 22%).

[0376] 1 H NMR(300MHz,CDCl3)δ9.74(br s,1H),8.38(dd,J=8.1,1.5Hz,1H),7.40(dd,J=8.1,1.5Hz,1H),7.28(td,J=8.1,1.5Hz,1 H), 7.07 (td, J = 8.1, 1.5Hz, 1H), 4.30 (q, J = 7.1Hz, 2H), 3.54 (s, 2H), 1.34 (t, J = 7.1Hz, 3H).

[0377] Ethyl 2-[(2-chlorophenyl)carbamoyl]acetate (2.4 g, 9.93 mmoles, 1 eq.) was placed in a mixture of THF (9.9 mL) and water (3.8 mL). Sodium hydroxide (477 mg, 11.92 mmoles, 1.2 eq.) was then added, and the reaction mixture was stirred at room temperature for 14 hours. Concentrated hydrochloric acid was then added until pH 2 was reached, and the resulting solution was extracted with ethyl acetate. The organic phase was then dried over MgSO4, filtered, and concentrated under reduced pressure to give 2-[(2-chlorophenyl)carbamoyl]acetic acid (2 g, 94%).

[0378] 1 H NMR (300MHz, MeOD) δ7.98 (dd, J = 8.1, 1.5 Hz, 1H), 7.45 (dd, J = 8.1, 1.5 Hz, 1H), 7.30 (td, J = 8.1, 1.5 Hz, 1H), 7.16 (td, J = 8.1, 1.5 Hz, 1H), 3.54 (s, 2H).

[0379] The reaction mixture formed by 2-[(2-chlorophenyl)carbamoyl]acetic acid (3.7 g, 17.32 mmoles, 1 eq.) in polyphosphoric acid (17 g, 173.2 mmoles, 10 eq.) was stirred at 130 °C for 14 h. The reaction mixture was cooled to room temperature, and then a 2 M aqueous solution of sodium hydroxide was slowly added. The resulting precipitate was filtered, washed with water, and dried under reduced pressure in a desiccator to give 8-chloroquinoline-2,4-diol (3 g, 89%).

[0380] 1 H NMR (300MHz, DMSO) δ11.66 (br s, 1H), 10.40 (br s, 1H), 7.78 (d, J = 7.8Hz, 1H), 7.66 (d, J = 7.8Hz, 1H), 7.17 (t, J = 7.8Hz, 1H), 5.81 (s, 1H).

[0381] MS(ESI)[MH] - =194.1

[0382] The reaction mixture of 8-chloroquinoline-2,4-diol (1.5 g, 7.67 mmoles, 1 eq.) in POCl3 (7.1 mL, 76.7 mmoles, 10 eq.) was stirred at 100 °C for 2 hours. The reaction mixture was cooled to room temperature, and then water was slowly added. The resulting precipitate was filtered, washed with water, and dried under reduced pressure in a desiccator to give 2,4,8-trichloroquinoline (1.6 g, 90%).

[0383] 1 H NMR (300MHz, DMSO) δ8.21 (d, J = 8.4 Hz, 1H), 8.14 (d, J = 8.4 Hz, 1H), 8.11 (s, 1H), 7.78 (t, J = 8.4 Hz, 1H).

[0384] The reaction mixture formed from 2,4,8-trichloroquinoline (1 g, 4.30 mmoles, 1 eq.), 2-amino-4-trifluoromethylpyridine (768 mg, 4.73 mmoles, 1.1 eq.), Pd(OAc)₂ (19 mg, 0.09 mmol, 2 mol%), XantPhos (50 mg, 0.09 mmol, 2 mol%), and Cs₂CO₃ (3.9 g, 12.04 mmoles, 2.8 eq.) in t-BuOH (17.2 mL) was heated at 90 °C for 2 days. Upon cooling to room temperature, the reaction mixture was concentrated under reduced pressure, and the resulting residue was diluted with ethyl acetate. The organic phase was then washed with water, dried over MgSO₄, filtered, and concentrated under reduced pressure. The residue obtained by column chromatography on silica gel was purified to give (4,8-dichloro-quinoline-2-yl)-(4-trifluoromethyl-pyridin-2-yl)-amine (13) (588 mg, 38%).

[0385] 1 H NMR (300MHz, CDCl3) δ9.40 (s, 1H), 8.46 (d, J = 5.4Hz, 1H), 8.06 (dd, J = 8.1, 1.5Hz, 1H), 7.86 (d d,J=8.1,1.5Hz,1H),7.81(s,1H),7.40(t,J=8.1Hz,1H),7.25(s,1H),7.22(d,J=5.4Hz,1H).

[0386] MS(ESI)[M+H] + =358.1

[0387] The reaction mixture of (4,8-dichloro-quinolin-2-yl)-(4-trifluoromethyl-pyridin-2-yl)-amine (200 mg, 0.54 mmol, 1 eq.), 3-(piperidin-1-yl)propyl-1-amine (94 μL, 0.59 mmol, 1.1 eq.), CuI (10 mg, 0.05 mmol, 0.1 eq.), L-proline (9 mg, 0.11 mmol, 0.2 eq.), and potassium carbonate (148 mg, 1.01 mmol, 2 eq.) in DMSO (1.4 mL) was stirred at 90 °C under an inert argon atmosphere for 24 hours. The reaction mixture was then partitioned between ethyl acetate and water. The aqueous phase was further extracted with dichloromethane upon decantation. The combined organic phases were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel to give 8-chloro-N 4 -(3-piperidin-1-yl-propyl)-N 2-(4-trifluoromethyl-pyridin-2-yl)-quinoline-2,4-diamine (9) (48 mg, 7%).

[0388] 1 H NMR (300MHz, CDCl3) δ9.55 (s, 1H), 8.40 (d, J = 4.8Hz, 1H), 7.85 (s, 1H), 7.77 ( d,J=7.8Hz,1H),7.72(d,J=7.8Hz,1H),7.62(s,1H),7.18(t,J=7.8Hz,1H),7 .10(d,J=4.8Hz,1H),5.88(s,1H),3.41–3.31(m,2H),2.59(t,J=5.4Hz,2H), 2.57–2.43(m,4H),2.01–1.92(m,2H),1.79–1.70(m,4H),1.65–1.54(m,2H).

[0389] 13 C NMR (75MHz, CDCl3) δ154.9,154.0,152.3,148.5,144.2,132.2,129.7,121 .7,119.7,118.4,112.4,109.8,88.0,59.6,55.1,44.9,26.1,24.4,23.4.

[0390] MS(ESI)[M+H] + =464.2

[0391] Example 2: 2-N-(8-chloroquinoline-2-yl)-5-N-[3-(4-methylpiperazin-1-yl)propyl]-4-(trifluoromethyl)pyridine-2,5-diamine; Compound (22)

[0392] A reaction mixture formed from 2,8-dichloroquinoline (198 mg, 1.0 mmol, 1 eq.), 5-bromo-4-(trifluoromethyl)pyridine-2-amine (241 mg, 1.0 mmol, 1 eq.), Pd(OAc)₂ (4.5 mg, 0.02 mmol, 2 mol%), XantPhos (11.6 mg, 0.02 mmol, 2 mol%), and Cs₂CO₃ (782 mg, 2.4 mmoles, 2.4 eq.) in t-BuOH (4 mL) was heated in a microwave reactor at 120 °C for 70 min. Upon cooling to room temperature, the reaction mixture was concentrated under reduced pressure, and the resulting residue was diluted with ethyl acetate. The organic phase was then washed with water, dried over MgSO₄, filtered, and concentrated under reduced pressure. The residue obtained by column chromatography on silica gel was purified to give N-[5-bromo-4-(trifluoromethyl)pyridin-2-yl]-8-chloroquinoline-2-amine (21) (300 mg, 75%).

[0393] 1 H NMR (300MHz, CDCl3) δ9.71 (s, 1H), 8.51 (s, 1H), 8.06 (d, J = 9.0Hz, 1H), 7.81 (m, 2H), 7.65 (d, J = 7.8Hz, 1H), 7.33 (t, J = 7.8Hz, 1H), 7.00 (d, J = 9.0Hz, 1H).

[0394] MS(ESI)[M+H] + =403.7

[0395] The reaction mixture formed by N-[5-bromo-4-(trifluoromethyl)pyridin-2-yl]-8-chloroquinoline-2-amine (101 mg, 0.250 mmol, 1 eq.), 3-(4-methylpiperazin-1-yl)propyl-1-amine (64 μL, 0.375 mmol, 1.5 eq.), Pd2(dba)3 (28 mg, 0.030 mmol, 12 mol%), XantPhos (43.4 mg, 0.075 mmol, 30 mol%), and sodium tert-butoxide (72 mg, 0.75 mmol, 3 eq.) in a mixture of dioxane (1 mL) / DMF (0.1 mL) was heated in a microwave reactor at 120 °C for 70 min. Upon cooling to room temperature, the reaction mixture was concentrated under reduced pressure, and the resulting residue was diluted with ethyl acetate. The organic phase was then washed with water, dried over MgSO4, filtered, and concentrated under reduced pressure. The residue obtained by column chromatography on silica gel was purified to give 2-N-(8-chloroquinoline-2-yl)-5-N-[3-(4-methylpiperazin-1-yl)propyl]-4-(trifluoromethyl)pyridine-2,5-diamine (22) (52 mg, 43%).

[0396] 1 H NMR(300MHz, CDCl3)δ9.39(s,1H),7.97–7.86(m,2H),7.82(br s,1H),7.73(d,J=7.5Hz,1H),7.56(d,J=7.5Hz,1H),7.23(t,J=7.5Hz,1H),6.94(d,J= 9.0Hz,2H),3.34–3.22(m,2H),2.80–2.44(m,10H),2.37(s,3H),1.87(t,J=6.0Hz,2H).

[0397] MS(ESI)[M+H] + =479.0

[0398] Example 3: 8-Chloro-N-methyl-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine; Compound (28)

[0399] 8-chloro-N-[4-(trifluoromethoxy)phenyl]quinoline-2-amine, i.e., compound (24), was synthesized as described in Example 5 of WO2010 / 143169.

[0400] The reaction mixture of 8-chloro-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine (24) (340 mg, 1.0 mmol, 1 eq.), potassium tert-butoxide (124 mg, 1.1 mmol, 1.1 eq.), and iodomethane (69 μL, 1.1 mmol, 1.1 eq.) in DMF (2 mL) was stirred at room temperature for 4 hours. The reaction mixture was then partitioned between ethyl acetate and water. The combined organic phases were dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel to give 8-chloro-N-methyl-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine (28) (247 mg, 70%).

[0401] 1 H NMR (300MHz, CDCl3) δ7.69 (d, J = 9.0 Hz, 2H), 7.49 (d, J = 7.8 Hz, 1H), 7.36–7.25 (m, 4H), 7.14 (t, J = 7.8 Hz, 1H), 6.75 (d, J = 9.0 Hz, 1H), 3.69 (s, 3H).

[0402] MS(ESI)[M+H] + =353.1

[0403] Example 4: 8-Chloro-N-(3-(piperidin-1-yl)propyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine; Compound (30)

[0404] 8-chloro-N-[4-(trifluoromethoxy)phenyl]quinoline-2-amine, i.e., compound (24), was synthesized as described in Example 5 of WO2010 / 143169.

[0405] The reaction mixture formed by 8-chloro-N-[4-(trifluoromethoxy)phenyl]quinoline-2-amine (24) (500 mg, 1.47 mmol, 1 eq.) and NaH (177 mg, 4.43 mmol, 3 eq.) in anhydrous DMF (2 mL) was stirred at room temperature for 30 min. The reaction mixture formed by 1-(3-chloropropyl)piperidine hydrochloride (292 mg, 1.47 mmol, 1 eq.), KI (245 mg, 1.47 mmol, 1 eq.), and Et3N (205 μL, 1.47 mmol, 1 eq.) in anhydrous DMF (5 mL) was stirred at room temperature for 30 min under an inert argon atmosphere. Then, activated quinoline was added to the piperidine chain, and the resulting reaction mixture was stirred at 90 °C for 4 h. The reaction mixture was then concentrated under reduced pressure, and the residue was diluted with ethyl acetate. The organic phase was washed with a saturated aqueous solution of physiological saline, dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel to give 8-chloro-N-(3-(piperidin-1-yl)propyl)-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine (30) (472 mg, 69%).

[0406] 1 H NMR (300MHz, CDCl3) δ7.73–7.63(m,2H),7.48(d,J=7.9Hz,1H),7.39–7.26(m,4H),7.13(t,J=7.9Hz,1H),6.6 7(d,J=9.1Hz,1H),4.26–4.14(m,2H),2.52–2.33(m,6H),2.11–1.97(m,2H),1.64–1.52(m,4H),1.45(s,2H).

[0407] 13 C NMR (75MHz, CDCl3) δ156.5,147.3,144.1,143.5,137.1,130.8,129.7,129.1,126.4, 124.7, 122.7, 122.4, 118.9 (t, J = 222Hz), 112.5, 56.9, 54.5, 49.6, 25.6, 24.6, 24.3.

[0408] MS(ESI)[M+H] + =464.4

[0409] Example 5: 8-Chloro-2-((4-(trifluoromethyl)pyridin-2-yl)oxy)quinoline; Compound (46)

[0410] A reaction mixture of 2,8-dichloroquinoline (79 mg, 0.4 mmol, 1 eq.), 2-hydroxy-4-(trifluoromethyl)pyridine (65 mg, 0.4 mmol, 1 eq.), CuI (76 mg, 0.4 mmol, 1 eq.), and Cs₂CO₃ (391 mg, 1.2 mmol, 3 eq.) in DMF (6 mL) was heated in a microwave reactor at 150 °C for 50 min. Upon cooling to room temperature, water was added to the reaction mixture. Undissolved solids were filtered through diatomaceous earth, and the filtrate was extracted twice with ethyl acetate. The organic phase was washed with a saturated aqueous solution of water and physiological saline, dried over MgSO₄, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel to give 8-chloro-2-{[4-(trifluoromethyl)pyridin-2-yl]oxy}quinoline (46) (68 mg, 52%).

[0411] 1 H NMR (300MHz, CDCl3) δ8.40(d,J=7.2Hz,1H),8.34(d,J=8.8Hz,1H),8.18(d,J=8.8Hz,1H),7.90(d ,J=7.2Hz,1H),7.85(d,J=7.9Hz,1H),7.56(t,J=7.9Hz,1H),6.98(s,1H),6.53(d,J=7.9Hz,1H).

[0412] 13 C NMR (75MHz, CDCl3) δ161.6,151.2,143.4,142.3,138.7,138.2,137.4,133.4,130.6,129.1,127.6,126.7,120.2,119.7,102.3.

[0413] MS(ESI)[M+H] + =325.1

[0414] Example 6: 8-Chloro-2-(4-(trifluoromethoxy)phenoxy)quinoline; Compound (48)

[0415] The reaction mixture of 2,8-dichloroquinoline (2 x 79 mg, 2 x 0.4 mmol, 1 eq.), 4-(trifluoromethoxy)phenol (2 x 52 μL, 2 x 0.4 mmol, 1 eq.), CuI (2 x 76 mg, 2 x 0.4 mmol, 1 eq.), and Cs₂CO₃ (2 x 391 mg, 2 x 1.2 mmol, 3 eq.) in DMF (2 x 6 mL) was heated in a microwave reactor at 150 °C for 50 min. Upon cooling to room temperature, water was added to the reaction mixture. Undissolved solids were filtered through diatomaceous earth, and the filtrate was extracted twice with ethyl acetate. The organic phase was washed with a saturated aqueous solution of water and physiological saline, dried over MgSO₄, filtered, and concentrated under reduced pressure. The residue obtained by column chromatography on silica gel was purified to give 8-chloro-2-[4-(trifluoromethoxy)phenoxy]quinoline 48 (212 mg, 78%).

[0416] 1 H NMR (300MHz, CDCl3) δ8.12(d,J=8.8Hz,1H),7.73(d,J=8.1Hz,1H),7.66(d,J =8.1Hz,1H),7.46(d,J=9.1Hz,2H),7.38–7.22(m,3H),7.12(d,J=8.8Hz,1H).

[0417] 13 C NMR (75MHz, CDCl3) δ 161.5, 151.9, 145.9, 142.7, 140.5, 132.0, 130.3, 127.0, 126.4, 125.1, 122.8, 122.2, 119.0 (t, J = 255Hz), 113.6.

[0418] MS(ESI)[M+H] + =340.1

[0419] The structures of other compounds of this invention were confirmed by NMR spectroscopy.

[0420] Table II

[0421]

[0422]

[0423]

[0424]

[0425]

[0426] Pharmacological data

[0427] The compounds of the present invention are the subject of pharmacological testing, and their relevance as active substances in the treatment, and especially in the prevention of inflammatory diseases, has been demonstrated.

[0428] Example 7: Regulation of miR-124 expression by quinoline derivatives in an in vivo model of inflammatory bowel disease

[0429] A. Materials and Methods

[0430] In vitro studies

[0431] Using FICOLL TM Gradient Extraction PBMC

[0432] For the purposes stated herein, according to the standard scheme, via FICOLL TM Gradient centrifugation was used to separate peripheral blood mononuclear cells (PBMCs) from healthy donors.

[0433] In short, pour 60-70 mL of the buffy coat into a 175 cm³ container. 2 In a flask, the volume was adjusted to 300 mL using PBS to obtain a leukocyte layer diluted approximately 5-fold. Then, at ambient temperature, 38 mL of the diluted leukocyte layer was added to 50 mL of Falcon. TM tube (containing 12 mL FICOLL) TM In (Histopack-1077)). Centrifuge the preparation at 515 rcf for 30 minutes at ambient temperature. Use pipettes. By Falcon TM The lymphocyte loops were recovered from the tubes and then washed with PBS at ambient temperature by centrifugation at 290 rcf for 10 minutes until the supernatant became clear.

[0434] Then, the cells were resuspended in RPMI Glutamax medium (Life Technologies Ref61870-010) at 37°C to achieve a density of 1.5 x 10⁻⁶ cells / mL. 6 Cells / mL, wherein the culture medium was supplemented with 10% fetal bovine serum (FCS) (Thermo Fischer Ref SV30160.03) and was unactivated. Cells were incubated at 37°C in 5% CO2 for 48 hours.

[0435] Cells treated with screened molecules

[0436] Screening was performed using a 6-well plate. The molecules to be screened were added to each well, wherein each well contained 3.10... 6 Cells / 4 ml RPMI supplemented with 10% fetal bovine serum and 40 U / mL IL-2 (Peprotech Ref 200-02). 100% DMSO (4 μL) was added to the wells and tested as a negative control.

[0437] As described below in this invention, various inspection conditions are set, and the final corresponding volume in the orifice is adjusted accordingly:

[0438] 1) In 100% DMSO Quinoline derivatives (5 μM and final volume 4 μL);

[0439] 2) Antiretroviral drugs Maraviro, Efavirone, Darunavir, and AZT (all drugs were 10 μM and the final volume was 4 μL).

[0440] Incubate each well at 37°C in 5% CO2 for 3 days. Change the medium according to the standard protocol (day 3). Briefly, centrifuge the plates at 290 rcf for 5 minutes and remove 3 mL of supernatant. Then, add 3 mL of RPMI supplemented with 10% fetal bovine serum and 40 U / mL IL-2, and use 3 μL of the stock solution of 5 mM selected molecules in 100% DMSO or 3 μL of 100% DMSO as a negative control.

[0441] miRNA extraction (day 6)

[0442] Use 15mL Falcon TM Cells were recovered from the tubes, centrifuged at 290 rcf for 5 minutes, washed in 10 mL of PBS, and then centrifuged again at 290 rcf for 5 minutes. The cells were then resuspended in 1 mL of PBS and counted.

[0443] Recycle 6x10 6 Cells were collected and centrifuged at 290 rcf for 5 minutes. Cell clusters were then transferred to 300 μL of the Macherey-Nagel sample. Lyse the miRNA in ML lysis buffer as described in the miRNA Extraction Kit (Macherey Nagel Ref 740971) and then store at -20°C.

[0444] Add 5 μL of 2x10 to each sample 8 Copy / μL spiked control (Ce_miR-39 obtained from) (Ref. 219610 of SEQ ID NO. 6). Adapted from Macherey Nagel. miRNA extraction was performed using the miRNA extraction kit protocol, with an RNA elution volume of 50 μL and a miRNA elution volume of 30 μL, and the samples were then stored at -20°C.

[0445] Reverse transcription of miRNA (Day 6)

[0446] Used from The miScript RT II reverse transcription (RT) kit was used to perform a reverse transcription step on 12 μL of miRNA using miScriptHiSpec buffer and then stored at -20°C.

[0447] Quantitative PCR of miRNA (Day 6)

[0448] Use the miScript Use the Green PCR kit and miScript PrimerAssays to perform the quantitative PCR step according to the manufacturer's protocol.

[0449] Composition of the miScript reaction mixture for 384-well plates:

[0450]

[0451] (*) cDNA was prepared using the miScript II RT kit.

[0452] According to the manufacturer's plan, in The reaction was repeated in triplicate in 384-well plates on a Roche 380 Real-Time PCR system. Cycling conditions were also set according to the manufacturer's protocol.

[0453]

[0454] Relative quantification by qPCR is known in the art and is described in further detail below.

[0455] relative quantification

[0456] Use miScript Primer Assays(Hs_miR-124a,Hs_miR-26a and Hs_miR-191, or –Refer to references ms00006622, ms00029239 and ms00003682), for miR-124 qPCR (Hs_miR-124a), dilute to 1 / 10 in H2O. thAlternatively, for reference / housekeeping gene qPCR (Hs_miR-26a and Hs_miR-191), dilute to 1 / 100. th .

[0457] Using the average of three cross points (Cp) values ​​derived from miR-124 and the average of three cross points from miR-26a and miR-191, without efficiency correction (2 -ΔΔCp In the case of ), a relative quantitative model is used for analysis.

[0458] B. Result

[0459] In the presence of different compounds as shown in formula (I), evaluate a group of donors (test 1 to 7 donors for each compound).

[0460] Using the protocol described above, the mean fold change in miR-124 expression (compared to DMSO) was assessed by relative quantification with different donors (1 to 7), and is presented in Table III below:

[0461] Table III

[0462]

[0463] Therefore, experimental evidence suggests that the quinoline derivatives represented by formula (I) mentioned above are significantly better than the reference values ​​established on untreated PBMCs. Upward Expression level of miR-124 in PBMCs.

[0464] Conversely, in PBMCs obtained from four donors, known antiretroviral drugs (maravirol, efavirenz, darunavir, or AZT) did not have any significant effect on the overexpression of miR-124.

[0465] Example 8: Effects of quinoline derivatives on (DSS-)-induced colitis model

[0466] A. Materials and Methods

[0467] mouse model

[0468] DSS model

[0469] A commonly used mouse model of inflammatory bowel disease is the dextran sulfate sodium (DSS-)-induced colitis model. The typical histological changes in acute DSS-colitis are mucin depletion, epithelial degeneration, and gradual disruption of the mucosal barrier, which leads to inflammation and colitis.

[0470] Over 9 days, three groups of 6-week-old C57BL / 6 mice (n=8 per group) were administered DSS (2.5%) in their drinking water. Figure 1-2 Weight loss and water consumption were measured daily. Water consumption was determined by measuring the reduction in volume of drinking water in each device. Mice were treated by force-feeding with 200 μL of 0.5 MC alone (DSS+MC group) or with 40 mg / kg of compound 24 (DSS+MC+24 group). DSS treatment was discontinued and replaced with drinking water at the time point when control mice lost up to 20% of their body weight (DSS). Other treatments continued for 21 days.

[0471] Three groups of 16-week-old C57BL / 6 mice (n=7 per group) were treated with 2.5% DSS in drinking water. Figure 3 Mice were treated by force-feeding with either 200 μL of 0.5 MC (DSS+MC group) alone or with 40 mg / kg of compound 24 (DSS+MC+24 group). Mice were treated with DSS for 6 days, and all mice were euthanized at the time point when control mice lost up to 15% of their body weight (DSS), and colons were harvested for further analysis.

[0472] The colon was measured using a ruler, and complete colons (fixed in formalin and embedded in paraffin) were prepared according to the Swiss roll protocol (Whittem et al.; "Murine Colitis Modeling using Dextran Sulfate Sodium (DSS)", J Vis Exp 2010(35)1652) for histological analysis. 4 μm sections were dewaxed and stained with hematoxylin and eosin for analysis of lesion size and other alterations. Figure 4-6 We compared mice that were untreated during the DSS cycle with mice treated with quinoline derivatives suspended in methylcellulose or with methylcellulose (MC) alone. Statistical analysis was performed using the Mann-Whitney test, with an asterisk indicating a significant difference (p<0.5) and two asterisks indicating a highly significant difference (p<0.05).

[0473] B. Result

[0474] The proposed results were established using quinoline derivative compounds (24), for which the following structures are presented for reference:

[0475]

[0476] After 5 days of treatment with quinoline derivatives in mice administered DSS, the apparent weight loss was less than 1% on average, in contrast to MC or untreated mice showing a weight loss of 10% to 20%. Figure 1 and 2 ).

[0477] Notably, we observed higher water consumption in the drug-treated mice, reflecting the disease-controlling effect of the quinoline derivative. During the second administration of DSS, quinoline derivative treatment also significantly controlled weight loss in mice, indicating that the mice were not unresponsive and that the quinoline derivative was suitable for repeated administration. After one cycle of DSS, the colon length in the quinoline derivative-treated mice (6.4 cm ± 0.6 cm) was significantly larger than that in the MC-treated mice (5.9 cm ± 0.8 cm) and the untreated mice (5.8 cm ± 0.8 cm). Figure 3 This difference was even more pronounced in mice that received two cycles of DSS. The colon length in mice treated with quinoline derivatives (5.7 cm ± 0.9 cm) was significantly larger than that in mice treated with MC only (4.3 cm ± 0.5 cm) and untreated mice (4.4 cm ± 0.4 cm). Figure 3 Mice from different groups developed a considerable number of injuries. Figure 4 However, the average size of the lesion area was significantly smaller than that of mice treated with quinoline derivatives, i.e., 2.1 mm. 2 With 8.4mm 2 (MC-treated mice only) Figure 5 This difference was maintained in mice exposed to two DSS cycles (3.8 mm). 2 With 12.2mm 2 ).

[0478] Finally, we observed a reduction in changes in lymphoid organs (e.g., Pierre lymphoid aggregates) after two DSS cycles, suggesting that treatment with quinoline derivatives modulates the immune response.

[0479] Example 9: Effects of quinoline derivatives on collagen-induced arthritis models

[0480] A. Materials and Methods

[0481] mouse model

[0482] Collagen-induced arthritis model:

[0483] Multiple groups of 9- to 10-week-old DBA / 1 mice were intradermally immunized with type II bovine collagen, which was emulsified with Freund's adjuvant at a 1:1 ratio. Mice were challenged 21 days after primary immunization, and the phenotypic appearance of arthritis was assessed every two days by monitoring the thickness of each hind paw ankle joint. Hind paw ankle joint thickness was measured using a thiometer with dial calipers (0 to 10 mm). Mice were treated daily for 2 weeks with either a quinoline derivative candidate suspended in methylcellulose or methylcellulose (MC) alone, and disease development was then monitored. Statistical analysis was performed using the Mann-Whitney test, with asterisks indicating statistical significance (p < 0.5).

[0484] B. Result

[0485] Of the 10 mice treated with the tested quinoline derivative compound (24), only 1 mouse showed signs of inflammation (in contrast, 8 out of 10 mice treated with MC developed the disease). Mice treated with the quinoline derivative showed significantly reduced swelling (1.9 mm vs. approximately 2.2 mm) compared to mice treated with MC alone. Figure 6 ).

[0486] Therefore, the test results of the compounds disclosed in this invention show that the compounds can be used to treat and / or prevent the inflammatory diseases further described above.

[0487] In this regard, an effective amount of the compound can be administered to an individual suffering from an inflammatory disease.

[0488] Therefore, the compound according to the invention can be implemented in a pharmaceutical composition, wherein the pharmaceutical composition may contain an effective amount of the compound and one or more pharmaceutical excipients.

[0489] Choose the excipients mentioned above based on the dosage form and the required method of application.

[0490] In this context, they may be present in combination with suitable excipients in any form of medicine suitable for enteral or parenteral administration, such as tablets or coated tablets, hard gelatin, soft capsules and other capsules, suppositories or oral solutions (e.g., suspensions, syrups), or injectable solutions or suspensions.

[0491] The compound can be administered via any route of administration. For example, it can be administered orally, parenterally, intravenously, transdermally, intramuscularly, rectally, sublingually, via mucosally, intranasally, or by other means. Furthermore, the compound represented by formula (I) can be administered in the form of pharmaceutical compositions and / or unit dosage forms.

[0492] Specifically, the pharmaceutical compositions of the present invention can be administered orally and / or parenterally.

[0493] Suitable dosage forms include, but are not limited to, capsules, tablets (including instant and sustained-release tablets), powders, syrups, oral suspensions, and solutions for parenteral administration.

[0494] The pharmaceutical composition may also contain another anti-inflammatory agent known to those skilled in the art, as well as compounds according to the invention.

[0495] sequence list

[0496] SEQ ID N°1

[0497] AGGCCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCCUG

[0498] SEQ ID N°2

[0499] AUCAAGAUUAGAGGCUGCUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCAUACAAUUAAGGCACGGGUGAAUGCCAAGAGCGGAGCCUACGGCUGCACUUGAA

[0500] SEQ ID N°3

[0501] UGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCUAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGGCGCCUCC

[0502] SEQ ID N°4

[0503] UAAGGCACGCGGUGAAUGCC

[0504] SEQ ID N°5

[0505] CGUGUUCACAGCGGACCUUGAU

[0506] SEQ ID N°6

[0507] UCACCGGGUGUAAAUCAGCUUG

Claims

1. Use of a compound of formula (I) or any one of its pharmaceutically acceptable salts: ###0001### (I) wherein: Z is C or N; V is C or N; R independently represents a hydrogen atom, a methyl group, a methoxy group, a trifluoromethyl group, a trifluoromethoxy group, an amino group, a halogen atom or a -0-P(=0)-(OR3)(OR4) group; Q is N or O, with the proviso that when Q is O, R" is not present; R" represents a hydrogen atom, a (C1-C5)alkyl group or a (C3-C6)cycloalkyl group; n is 1, 2 or 3; n' is 1, 2 or 3; in the manufacture of a medicament for the treatment and / or prevention of an inflammatory disease.

2. Use according to claim 1, wherein R independently represents a fluorine or chlorine atom, a trifluoromethoxy group or an amino group.

3. Use according to claim 1, wherein the halogen atom is a fluorine or chlorine atom.

4. Use according to claim 1, wherein Q is N. refers to an aromatic ring, wherein V is C or N, and when V is N, V is in the ortho, meta or para position of Z, i.e. forming a pyridine, pyridazine, pyrimidine or pyrazine group, respectively; 5. Use according to claim 1, said compound being selected from the group consisting of: ###0002### wherein R, R', R", n and n' are as defined in any one of claims 1 to 4.

6. Use according to claim 5, said compound being ###0003### wherein R, R', R", n and n' are as defined in claim 1. R3and R4independently represent a hydrogen atom, Li + , Na + , K + , N + (Ra)4or a benzyl group; 7. Use of 8-chloro-N-(4-(trifluoromethoxy)phenyl)quinolin-2-amine in the manufacture of a medicament for the treatment and / or prevention of Crohn's disease. ​ ​ R' independently represents a hydrogen atom, a halogen atom, an amino group, a methyl group, a -0-P(=0)-(OR3)(OR4) group or a group wherein A is O or NH, m is 2 or 3, and X1is O, CH2or N-CH3, provided that when R' is said group, n' is 1 or 2, and when n' is 2, the other R' group is different from said group; or alternatively, R' independently represents a hydrogen atom, a halogen atom, a methyl group or a group wherein A is O or NH, m is 2, and X1is O, CH2or N-CH3, provided that when R' is said group, n' is 1 or 2, and when n' is 2, the other R' group is different from said group; R" is a hydrogen atom, a (Ci-C4)alkyl group or a group wherein m is 2 or 3, and X1is O, CH2or N-CH3; ​ ​ ​ ​ ​ ​ ​ ​ ​

Images