A genetically recombined bacillus velezensis producing 5-amino levulinic acid and application thereof
By integrating the hemA gene of soybean slow-growing rhizobium into Bacillus belesii, a recombinant Bacillus belesii was constructed, which solved the problem of low efficiency in the production of 5-aminolevulinic acid by Bacillus belesii, and achieved efficient fermentation production and improved tobacco stress resistance.
Patent Information
- Application Number
- CN202311208377.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-19
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2043-09-19
AI Technical Summary
In the existing technology, Bacillus belye is inefficient and costly in producing 5-aminolevulinic acid, and there is a lack of efficient genetically engineered strains for this synthesis.
By integrating the hemA gene of soybean slow-growing rhizobium into the genome of Bacillus belyssus, and selecting the 2,3-butanediol reductase gene bdh, the γ-PGA synthesis gene pgsB, and the biofilm regulation gene sinI as integration sites, a recombinant Bacillus belyssus was constructed, and fermentation conditions were optimized to increase the yield of 5-aminolevulinic acid.
The fermentation concentration of 5-aminolevulinic acid was significantly increased to 17 mg/L, which is 3 times higher than that of the original strain. The fermentation broth can significantly improve the stress resistance of tobacco and enhance its POD enzyme, SOD enzyme, CAT enzyme activity and chlorophyll content.
Smart Images

Figure CN117305207B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and microbial metabolic engineering, and in particular to a recombinant Bacillus belye that produces 5-aminolevulinic acid and its applications. Background Technology
[0002] 5-Aminolevulinic acid (ALA) is an essential precursor for the synthesis of tetrapyrrole compounds such as chlorophyll, heme, and vitamin B12 in organisms, playing a crucial role in plant photosynthesis and cellular energy metabolism. ALA has wide applications in agriculture and medicine. In agriculture, ALA plays an important role as a novel plant growth regulator, a green herbicide, and a non-toxic insecticide. In clinical medicine, ALA, as a highly effective photodynamic drug with minimal side effects, is used in the diagnosis and treatment of various cancers.
[0003] Currently, the production of 5-aminolevulinic acid (ALA) is mostly through chemical synthesis, with some biosynthesis. There are two main methods for the biosynthesis of ALA: one is biomutation. Sasaki et al. (Biosynthesis, biotechnological production and applications of 5-aminolevulinic acid. Appl Microbiol Biotechnol, 2002, 58: 23-29) optimized the culture conditions of a mutant strain of Rhodobacter sphaeroides, increasing ALA yield to 1.3 g / L. However, biomutation involves complex culture conditions, a long cycle, and high costs. The other method is genetic engineering. Mariet et al. constructed engineered bacteria containing the ALA synthase gene (hemA) from Rhodobacter sphaeroides and Bradyrhizobium japonicum, respectively, obtaining high ALA yields of 3.21 g / L and 2.94 g / L, respectively. Due to its high yield, short fermentation time, and relatively low cost, recombinant engineered bacteria are a promising biotechnology for large-scale ALA production in the future. However, there are few reports on Bacillus as an engineered bacterium producing 5-aminolevulinic acid. Developing a 5-aminolevulinic acid-producing Bacillus belesii is of great significance to the field of microbial metabolic engineering technology. Summary of the Invention
[0004] To address the shortcomings of the existing technologies, this invention provides a recombinant Bacillus velezensis that produces 5-aminolevulinic acid and its applications. By integrating the hemA gene from soybean slow-growing rhizobium into the genome of Bacillus velezensis, an engineered bacterium capable of synthesizing 5-aminolevulinic acid is obtained. This is achieved through the following techniques:
[0005] In a first aspect, the present invention provides a recombinant Bacillus velezensis that produces 5-aminolevulinic acid, which is a recombinant engineered bacterium obtained by integrating the hemA gene of Bradyrhizobium japonicum into the genome of Bacillus velezensis.
[0006] Furthermore, 1-3 of the above-mentioned hemA genes were integrated into the genome of Bacillus velezensis.
[0007] Furthermore, the nucleotide sequence of the hemA gene is shown in SEQ ID No. 1.
[0008] Furthermore, the aforementioned recombinant Bacillus velezensis uses at least one of the following genes in the genome of Bacillus velezensis R9: the 2,3-butanediol reductase gene bdh, the γ-PGA synthesis gene pgsB, and the biofilm regulatory gene sinI, as the integration site for the hemA gene. The Bacillus velezensis R9 was deposited on July 5, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan, China, with accession number CCTCC NO: M 20231199.
[0009] Furthermore, by using the 2,3-butanediol reductase gene bdh, the γ-PGA synthesis gene pgsB, and the biofilm regulation gene sinI in the genome of Bacillus velezensis R9 as integration sites for the hemA gene, recombinant Bacillus velezensis R9-3 was obtained. This recombinant Bacillus velezensis R9-3 was deposited on July 5, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan, China, with accession number CCTCC NO: M 20231200.
[0010] The nucleotide sequence of the 2,3-butanediol reductase gene bdh is shown in SEQ ID No. 2; the nucleotide sequence of the γ-PGA synthesis gene pgsB is shown in SEQ ID No. 3; and the nucleotide sequence of the biofilm regulation gene sinI is shown in SEQ ID No. 4.
[0011] Generally, integrating the key gene hemA, which synthesizes 5-aminolevulinic acid (5-ALA) in the C4 pathway of soybean slow-growing rhizobium, into *Bacillus belyssiensis* yields engineered strains that produce 5-ALA. Copying three hemA genes ensures full expression of the gene, which is beneficial for increasing the concentration of 5-ALA produced during fermentation. In this invention, the integration site was selected from constitutive promoter activity and genes regulating biofilm-related functions in the *Bacillus belyssiensis* R9 genome for integration expression.
[0012] A second aspect of the present invention provides a method for constructing the above-mentioned recombinant Bacillus belye, comprising the steps of:
[0013] (1) The hemA gene of soybean slow rhizobium and the coding regions of homologous arms about 50 bp upstream and downstream of the integration site in the genome of Bacillus belysinus were cloned by PCR, and the recombinant expression plasmid was constructed by overlapping extension PCR (SOE-PCR).
[0014] (2) The above recombinant expression plasmid was transformed into Bacillus belysinus, and positive clones were obtained through resistance screening. Then, the transformed strain was obtained by colony PCR.
[0015] (3) After the first double exchange and primer verification, a single exchange strain was obtained. Then, after the second double exchange, resistance screening and sequencing verification, Bacillus belyssus producing 5-aminolevulinic acid was obtained.
[0016] The essence of double crossover is actually a second single crossover occurring on top of a single crossover. Under low-temperature culture conditions, homologous arms in plasmids integrated into the genome are prone to pairing and crossing over with homologous arms in the genome again. The result of this second crossover may be a crossover on a different homologous arm, which will integrate the target gene into the target gene site, or a crossover may occur again on the homologous arm from the first crossover, which will revert to the wild-type strain. Therefore, sequencing is needed to verify the size of the target fragment to determine whether Bacillus belesiensis R9-3 has been obtained.
[0017] In a third aspect, the present invention provides a method for producing 5-aminolevulinic acid by fermentation, specifically, inoculating the above-mentioned recombinant Bacillus belye into a fermentation medium at an inoculation rate of 1% and culturing it at 37°C and 180-200 r / min for 34-38 h.
[0018] Furthermore, the formula of the above fermentation medium is as follows: (NH4)2SO4 16-17g / L, KH2PO4 3g / L, Na2HPO4·12H2O 16-17g / L, MgSO4·7H2O 1g / L, yeast extract 2g / L, glycine 3g / L, and glucose 20g / L.
[0019] In a fourth aspect, the present invention provides the application of the above-mentioned recombinant Bacillus belye in enhancing the stress resistance of tobacco, specifically by spraying the fermentation broth of the Bacillus belye onto tobacco leaves.
[0020] In a fifth aspect, the present invention provides a product for enhancing the stress resistance of tobacco, the main functional component of which is the fermentation broth of the aforementioned recombinant Bacillus belye.
[0021] The fermentation broth of the aforementioned recombinant Bacillus belyi can significantly enhance the growth capacity of tobacco under abiotic stress, mainly by effectively increasing the activity of POD enzyme, SOD enzyme, CAT enzyme, and chlorophyll content in tobacco. This is mainly due to the presence of 5-acetylaminopropionic acid (5-ALA) in the fermentation broth, which can effectively induce the plant's resistance to stress.
[0022] Compared with the prior art, the advantages of the present invention are:
[0023] 1. The present invention provides a recombinant Bacillus berleis that produces 5-aminolevulinic acid. In a 5-aminolevulinic acid detection medium, it can ferment to produce 17 mg / L of 5-aminolevulinic acid, which is more than three times higher than that of Bacillus berleis R9. This indicates that the Bacillus berleis is an ideal engineered bacterium for producing 5-aminolevulinic acid.
[0024] 2. This Bacillus berberis can also effectively antagonize Ralstonia solanacearum, and its fermentation broth can significantly improve the growth capacity of tobacco under abiotic stress. Attached Figure Description
[0025] Figure 1 The images shown are the identification results of bdh, pgsB, and sinI as integration sites as described in Example 1, where A represents bdh site integration identification, B represents pgsB site integration identification, and C represents sinI site integration identification.
[0026] Figure 2 The figures shown are the growth characteristics and antibacterial activity results of R9-3 described in Example 2, where A is the growth curve and BC are the antibacterial wilt activity results.
[0027] Figure 3 The graph shows the detection results of 5-ALA content in strain R9-3 as shown in Example 3;
[0028] Figure 4-6 The images show the detection results of POD enzyme activity, SOD enzyme activity, CAT enzyme activity, and chlorophyll as described in Example 4.
[0029] Figure 7-9 The images show the detection results of chlorophyll a, chlorophyll b, and chlorophyll c as described in Example 4. Detailed Implementation
[0030] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0031] Example 1T2-P bdh Construction of hemA recombination integrative plasmid
[0032] Taking the bdh gene (nucleotide sequence shown in SEQ ID No. 2) in the genome of Bacillus velezensis R9 as an integration site, recombinant Bacillus velezensis R9-3 was constructed. Both Bacillus velezensis R9 and recombinant Bacillus velezensis R9-3 were deposited on July 5, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan, China, with accession numbers CCTCC NO: M 20231199 and CCTCC NO: M 20231200, respectively. The plasmid construction method included the following steps:
[0033] 1. Fragment amplification and fusion
[0034] Based on the complete genome sequence of Bacillus belyssus WLYS23 published in GeneBank (accession number CP055160.1), upstream and downstream homologous arms of the bdh gene were designed. Based on the complete genome sequence of soybean slow-growing rhizobium E109 published in GeneBank (accession number CP010313.1), the hemA gene (nucleotide sequence shown in SEQ ID No. 1) was designed. Primers (nucleotide sequences shown in SEQ ID Nos. 5-10) were designed using SnapGene software and synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0035] bdh-hemA-LF: 5'gcggatcctttgtcgcgcaatccc 3' (as shown in SEQ ID No. 5)
[0036] bdh-hemA-LR: 5'ctgggcgtaatccattgattatcactccta 3' (as shown in SEQ ID No. 6)
[0037] bdh-hemA-RF: 5'ctggcggcggagtagaccgttcagctgaat 3' (as shown in SEQ ID No. 7)
[0038] bdh-hemA-RR: 5'gcgcggccgcggtcatcaagcgcttc 3' (as shown in SEQ ID No. 8)
[0039] bdh-hemA-F: 5'taggagtgataatcaatggattacgcccag 3' (as shown in SEQ ID No. 9)
[0040] bdh-hemA-R: 5'attcagctgaacggtctactccgccgccag 3' (as shown in SEQ ID No. 10)
[0041] Genomic DNA was extracted from Bacillus belye R9 in the logarithmic growth phase and used as a template for PCR amplification of the promoter and terminator regions of the bdh gene. The PCR amplification reaction was performed in a 20 μL system, with the following reaction mixture: 2 μL template DNA, 10 μL 2× high-fidelity DNA polymerase premix (purchased from Novizan (Nanjing) Biotechnology Co., Ltd.), 1 μL upstream primer, 1 μL downstream primer, and 6 μL ddH2O. Amplification conditions were: pre-denaturation at 94℃ for 5 min, followed by cycling with the following parameters: 94℃ for 30 sec, 53℃ for 30 sec, and 72℃ for 30 sec, for a final extension at 72℃ for 10 min. The amplified PCR products were analyzed by 0.8% agarose gel electrophoresis, and the amplified fragment sizes were 500 bp, 500 bp, and 1230 bp, respectively, which were consistent with the expected sizes.
[0042] Fusion of homologous arms with the hemA gene: 1 μL of each of the amplified upstream and downstream homologous arms and the hemA gene fragment were added as templates for overlap extension PCR. Amplification was performed using primers bdh-hemA-LF and bdh-hemA-RR in the same amplification system as before. The amplification conditions were: pre-denaturation at 94℃ for 5 min, followed by cycling with the following parameters: 94℃ for 30 sec, 53℃ for 2 min 30 sec, 72℃ for 30 sec, for 30 cycles. Extension was then performed at 72℃ for 10 min. A fusion fragment of approximately 2300 bp was obtained. This PCR product was purified and recovered using a PCR product purification kit purchased from Thermo Fisher Scientific (China) Co., Ltd.
[0043] 2. Plasmid construction and transformation
[0044] The fused PCR fragment and the T2(2) plasmid (from laboratory storage, originally constructed by Professor Liu Jun of Wuhan University of Light Industry) were simultaneously digested with BamHI and NotHI restriction endonucleases from Thermo Fisher Scientific (China) Co., Ltd. The digestion system was: 10×Bufer 2.5 μL, target fragment 20 μL, BamHI 1 μL, NotHI 1 μL, ddH2O 25.5 μL. Digestion conditions: 37℃, 15 min. The digested products were purified and recovered using a PCR product purification and recovery kit and analyzed by 0.8% agarose gel electrophoresis. The sizes of the digested bands were approximately 2300 bp and 4700 bp, respectively, which were consistent with the expected sizes. The digested fragment was ligated with T4 ligase. The ligation system was: 10×DNA ligase Buffer 2 μL, T4 DNA ligase 1 μL, digested fragment 12 μL, digestion vector 4 μL, ddH2O 6 μL. Enzyme ligation conditions: overnight ligation at 4℃. The overnight ligated product was heat-shocked and transformed into E. coli DH5α competent cells, plated onto LB agar plates containing 20 μg / mL kanamycin, and incubated overnight at 37℃. The next day, a single colony was picked from the plate and streaked onto another fresh kanamycin-resistant plate. Amplification primers were designed using SnapGene software and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences are as follows:
[0045] T2-F: 5'ttaacgaattcctgcagccc 3' (as shown in SEQ ID No. 11)
[0046] T2-R: 5'ttttctacgagctccaccgc 3' (as shown in SEQ ID No. 12)
[0047] Genomic DNA was extracted from the streaked single colonies and used as a template for PCR amplification and verification. The PCR amplification reaction was carried out in a 20 μL system, with the following reaction system: 2 μL template DNA, 10 μL 2× high-fidelity DNase premix (purchased from Novizan (Nanjing) Biotechnology Co., Ltd.), 1 μL upstream primer, 1 μL downstream primer, and 6 μL ddH2O. The amplification conditions were: 94℃ pre-denaturation for 5 min followed by cycling with the following parameters: 94℃ for 30 sec, 53℃ for 1 min 30 sec, and 72℃ for 30 sec. After 30 cycles, a 72℃ extension was performed for 10 min. The amplified PCR product was analyzed by 0.8% agarose gel electrophoresis, and the amplified fragment size was 2400 bp, which was consistent with the expected size. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis. The selected positive transformants were stored at -80℃ and activated for later use. Recombinant plasmids were extracted using a bacterial plasmid extraction kit purchased from Thermo Fisher Scientific (China) Co., Ltd.
[0048] Single colonies of *Bacillus belye* R9 were picked and activated overnight. A 1% inoculum was then inoculated into 5 mL of fresh LB medium and incubated at 37°C and 180 rpm for 3 h until the OD600 value reached approximately 0.3. For optimal transformation efficiency, the OD600 value should be controlled between 0.26 and 0.32. 100 μL of the culture medium was then transferred to a 1.5 mL centrifuge tube, and 10 μL of recombinant T2-P was added. bdh Mix the hemA plasmid thoroughly (do not pipette, add slowly), incubate at 28°C for 1 hour, then incubate at 28°C and 180 rpm for 24 hours. Spread the entire culture onto Kan-resistant (20 μg / mL) plates and incubate at 28°C for 3-5 days. Pick a single colony from the Kan-resistant plate.
[0049] 3. Construction of recombinant strains for integrated expression
[0050] Transformants of the R9 strain containing the successfully validated T2 recombinant plasmid were selected and inoculated into 5 mL of LB medium containing Kan resistance (20 μg / mL). The medium was incubated at 42°C until turbidity appeared (temperature-sensitive plasmids cannot replicate at high temperatures; they can only replicate after integration into the genome, a process involving homologous arm exchange). The culture was diluted and plated onto Kan resistance (20 μg / mL) plates, incubated at 37°C, and single colonies were selected for colony PCR verification. Based on the principle of gene substitution recombination, primers for each single-exchange verification were designed (nucleotide sequences are shown in SEQ ID No. 13-16) as follows:
[0051] bdh-dan-F: 5'gctgacatccaatacggcat 3' (as shown in SEQ ID No. 13)
[0052] bdh-dan-R: 5'atgagcttcagccccctgta 3' (as shown in SEQ ID No. 14)
[0053] T2-dan-LF: 5'ttgtttgcaagcagcagatt 3' (as shown in SEQ ID No. 15)
[0054] T2-dan-RR: 5'cgaaaaacaagttaagggat 3' (as shown in SEQ ID No. 16)
[0055] L-arm single exchange: F primer is about 100bp upstream of the L-arm (bdh-dan-F), R primer is 100bp downstream of the linker fragment on the T2(2) plasmid (T2-dan-R); R-arm single exchange: F primer is 100bp upstream of the linker fragment on the T2(2) plasmid (T2-dan-F), R primer is 100bp downstream of the R-arm (bdh-dan-R). Take the corresponding primers. The PCR amplification reaction was carried out in a 20μL system, and the reaction system was as follows: template DNA 2μL, 2× high-fidelity DNase premixed solution, purchased from Novizan (Nanjing) Biotechnology Co., Ltd. 10μL, upstream primer 1μL, downstream primer 1μL, ddH2O 6μL. The amplification conditions were: 94℃ pre-denaturation for 5min followed by cycling, and the cycling parameters were 94℃ for 30sec, 53℃ Insert for 20sec, Vector for 2min, and 72℃ for 30sec. After 30 cycles, the PCR was extended at 72℃ for 10 min. The amplified PCR products were analyzed by 0.8% agarose gel electrophoresis. The identification results with bdh as the integration site are as follows: Figure 1 As shown in Figure A, the amplified fragment sizes are 290bp and 1770bp, which are consistent with the expected sizes.
[0056] The applicant also conducted related experiments using pgsB and sinI (nucleotide sequences as shown in SEQ ID No. 3-4) as integration sites, and the identification results are shown in the figures below. Figure 1 As shown in B-1C.
[0057] Example 2: Analysis of the growth characteristics and antagonistic ability of Ralstonia solanacearum Rhesus var. oryzae.
[0058] 100 μL of cryopreserved *Bacillus belyssus* R9 (control) and engineered strain R9-3 were transferred to 5 mL of LB medium and incubated at 37 °C and 180 rpm for 10–12 h in a shaker. Then, the bacterial culture was transferred to 5 mL of fresh LB medium at a 1% inoculum size and incubated at 37 °C and 180 rpm for 5–6 h, after which the OD was adjusted accordingly. 600If the values are consistent, transfer 200 μL to a 100-well cell culture plate and analyze the results using an automated growth curve analyzer. The conditions are: 37℃, low speed, sampling and analysis once per hour. The results are as follows: Figure 2 As shown in Figure A, the results indicate that the growth trend of R9-3 is similar to that of R9, but its biomass is lower than that of wild-type strain R9 between 3 and 12 hours. After 13 hours, the biomass of R9-3 is almost the same as that of R9.
[0059] Ralstonia solanacearum was inoculated into 5 mL of CPG medium (1 g acid-hydrolyzed casein, 10 g peptone, 5 g glucose) and incubated overnight at 28°C and 180 rpm. R9 and R9-3 strains were activated overnight in 5 mL of LB medium at 37°C and 180 rpm. The activated Ralstonia solanacearum was then added at a 1% inoculum to cooled CPG solid medium (1 g acid-hydrolyzed casein, 10 g peptone, 5 g glucose, 18 g agar), mixed thoroughly, and poured into plates.
[0060] Culture media of engineered bacteria R9 and R9-3 were diluted to maintain consistent OD values. First, a sterilized Oxford cup was placed in the center of the agar plate. Then, 50 μL of the diluted bacterial solution was added to the Oxford cup. R9 was used as a control, and each group was repeated three times. The plates were placed in an incubator and incubated statically at 28°C for 48 hours. The antibacterial activity was observed, and the diameter of the inhibition zone was measured with a ruler. The results of the antibacterial activity are as follows: Figure 2 As shown in B-2C, the results indicate that the engineered strain R9-3 and the two intermediate strains obtained during the construction of R9-3, namely R9-1 (which integrates a hemA gene at the bdh site) and R9-2 (which integrates a hemA gene at the bdh site and the sinI site, respectively), all exhibit significant antagonistic activity against Ralstonia solanacearum. Furthermore, compared with the wild-type strain R9, there was no significant difference in the antibacterial activity of R9-3 and the intermediate strains R9-2 and R9-1.
[0061] Example 3: Detection of 5-ALA content in strain R9-3
[0062] R9 and R9-3 engineered bacteria were inoculated into 5 mL of LB liquid medium and activated overnight at 37 °C and 180 rpm. The resulting bacterial culture was then transferred to 5-ALA detection medium at a 1% inoculation rate and cultured at 37 °C and 180 rpm for 36 h. After culturing, 1 mL of fermentation broth was transferred to a 1.5 mL black test tube and centrifuged at 4 °C and 12000 rpm for 10 min. 400 μL of the supernatant was transferred to another new 1.5 mL black test tube, and 200 μL of 2 mol / L sodium acetate (pH = 4.6) buffer and 100 μL of acetylacetone were added. The mixture was thoroughly mixed and heated in boiling water for 15 min, then cooled to room temperature. Take 700 μL of reaction solution and add 700 μL of modified Ehrlich's reagent (1 g of p-dimethylaminobenzaldehyde, added to 30 mL of glacial acetic acid, then 8 mL of perchloric acid, and diluted to 50 mL with glacial acetic acid, packaged in a brown bottle, and prepared fresh for use). Mix well and stabilize at room temperature for 30 min, then measure its absorbance at a wavelength of 554 nm.
[0063] The formulation of the 5-ALA detection medium is as follows: (NH4)2SO4 16-17 g / L, KH2PO4 3 g / L, Na2HPO4·12H2O 16-17 g / L, MgSO4·7H2O 1 g / L, yeast extract 2 g / L, glycine 3 g / L, and glucose 20 g / L.
[0064] The concentration results of 5-aminolevulinic acid produced by fermentation of R9 and R9-3 engineered bacteria are as follows: Figure 3 As shown, the concentrations were 4 mg / L and 17 mg / L, which is more than three times higher than that of Bacillus belyss R9. This indicates that the R9-3 engineered strain obtained in this invention can efficiently ferment and produce 5-aminolevulinic acid compared to the R9 strain. The Bacillus belyss R9-3 is an ideal engineered strain for producing 5-aminolevulinic acid.
[0065] Example 4: Effects of R9-3 strain fermentation broth on tobacco growth under abiotic stress
[0066] After transplanting tobacco plants with similar growth at the 3-4 leaf stage, they were placed in a climate incubator for one week and subjected to salt stress (simulated by 150 mM NaCl). An equal volume of H2O was sprayed as a blank control, and treatment with only 150 mM NaCl served as a control. Two days after the stress treatment, the tobacco leaves were sprayed with the supernatant of fermentation broths R9 and R9-3. This treatment was repeated for 5 days, after which tobacco leaves were collected for analysis. Three parallel experiments were conducted.
[0067] Extraction of crude enzyme solution: Accurately weigh 0.25g of tobacco leaves and place them in a pre-cooled mortar. Add 3mL of pre-cooled 0.05M PBS (pH 7.0), 0.1g of polyvinylpyrrolidone (PVP), and a small amount of quartz sand. Grind the mixture in an ice bath to homogenize it, and transfer the homogenate to two 2mL centrifuge tubes. Centrifuge at 12000×g for 20min at 4℃. Collect the supernatant, which is the crude enzyme solution. Dilute appropriately and store at -20℃ for later use.
[0068] 1. POD enzyme activity detection
[0069] In a colorimetric tube, add 1 mL of 0.05 M PBS (pH 7.0), 1 mL of 1% guaiacol, and 1 mL of crude enzyme solution sequentially. Shake well and incubate at 30°C for 5 min. Add 1 mL of 0.3% H₂O₂ to the tube, shake well, and quickly pour the reaction solution into a 1 cm diameter cuvette. Measure the rate of increase in OD value at 470 nm. Zero the tube using a standard tube with 1 mL of distilled water and calculate the POD activity. The formula for calculating POD activity is as follows:
[0070] POD activity (ΔOD·g) -1 ·min -1 )=(ΔOD 470 ×V T ) / (FW×t×V1)
[0071] Where t is the reaction time (min);
[0072] V T Total volume of sample solution (mL);
[0073] V1: Sample volume (mL) used during measurement;
[0074] FW: Fresh weight of the sample (g).
[0075] The results of POD enzyme activity detection are as follows: Figure 4 As shown, R9-3 can produce a high level of 5-acetylaminopropionic acid (5-ALA) through fermentation. Therefore, like 20 mg / L 5-acetylaminopropionic acid, it can effectively induce POD enzyme activity in tobacco, and both are significantly increased compared to the CK control.
[0076] 2. SOD enzyme activity detection
[0077] Take two 4 mL centrifuge tubes as controls. Add reagents according to Table 13, mix well, and completely cover one control tube with aluminum foil to shield it from light. Place the control tube and the other tubes under 4000 lx light for 20 min at a reaction temperature of 25℃. Use the shielded tube as a blank for zeroing and measure OD. 560 Absorbance values were measured in triplicate for each group. SOD activity was expressed as enzyme units per gram of fresh weight. The SOD activity detection system is shown in Table 1 below, and the calculation method is as follows:
[0078]
[0079] In the formula, A0 represents the absorbance of the light-emitting control tube.
[0080] A S : Absorbance of the sample tube;
[0081] Vt: Total volume of sample solution (mL);
[0082] V1: Sample volume (mL) used during measurement;
[0083] FW: Fresh weight of sample (g);
[0084] Table 1 SOD enzyme activity detection system
[0085] Reagent Name Dosage (mL) Final concentration 0.05 mol / L PBS 1.5 ------ 130mmol / L Met 0.3 13mmol / L 750 μmol / L NBT 0.3 75 μmol / L 20 μmol / L riboflavin 0.3 2μmol / L <![CDATA[100μmol / L EDTA-Na2]]> 0.3 10 μmol / L enzyme solution 0.1 The control was replaced with 0.1 mL of PBS buffer. distilled water 0.5 ------ Total volume 3.3 ------
[0086] The results of SOD enzyme activity detection are as follows: Figure 5 As shown, R9-3 can produce a high level of 5-acetylaminopropionic acid (5-ALA) through fermentation. Therefore, like 20 mg / L 5-acetylaminopropionic acid, it can effectively induce SOD enzyme activity in tobacco, and both are significantly increased compared to the CK control.
[0087] 3. CAT enzyme activity detection
[0088] Add 0.2 mL of crude enzyme solution, 1.5 mL of phosphate buffer, and 1 mL of distilled water sequentially to a colorimetric tube. Incubate at 25°C for 5 min, mix well, and pour into a quartz cuvette. During measurement, add 0.3 mL of 0.1 mol / L H₂O₂ to the quartz cuvette and record the absorbance at 240 nm every 1 min for a total of 4 min. Before measurement, replace 0.2 mL of crude enzyme solution with 0.2 mL of water, keeping everything else unchanged, for instrument zeroing. Inactivate the enzyme solution by placing it in boiling water for 5 min, and use this solution as a control. Measure the OD value within 1 min. 240 A decrease of 0.01 corresponds to 1 enzyme activity unit (U). The formula for calculating CAT activity is as follows:
[0089] CAT activity = (S 样 -S0)×V T / (0.1×V1×t×FW)
[0090] Wherein: S 样 The slope of the linear correlation between the absorbance of the sample and time;
[0091] S0: The slope of the linear correlation between control absorbance and time;
[0092] t: Reaction time (min);
[0093] V T Total volume of sample solution (mL);
[0094] V1: Sample volume (mL) used during measurement;
[0095] FW: Fresh weight of sample (g).
[0096] The results of CAT enzyme activity assay are as follows: Figure 6 As shown, R9-3, due to its ability to produce higher levels of 5-acetylaminopropionic acid (5-ALA) through fermentation, can effectively induce CAT enzyme activity in tobacco, just like 20 mg / L 5-acetylaminopropionic acid, with a significant increase compared to the CK control and R9.
[0097] 4. Chlorophyll detection
[0098] Take 0.3g of fresh plant leaves and place them in a mortar. Add a small amount of calcium carbonate and quartz sand, then add 2mL of a mixed extract of acetone:ethanol:water = 4.5:4.5:1. Grind in an ice bath to form a homogenate. Add another 10mL of the mixed extract and continue grinding until the tissue turns white. Let stand for 3-5 minutes. Place a filter paper disc in a funnel, moisten it with the mixed extract, and pour the extract into the funnel along a glass rod. Filter into a 50mL centrifuge tube. Rinse the mortar, glass rod, and residue several times with a small amount of the extract until colorless. Finally, pour the extract, along with the residue, into the funnel and bring the volume to 25mL. Let stand for 30 minutes. Zero the sample using the mixed extract and measure the OD values at 663nm and 645nm. The formula for calculating chlorophyll is as follows:
[0099] Chlorophyll a concentration (mg / L): Ca = 12.7A663 - 2.69A645
[0100] Chlorophyll b concentration (mg / L): Cb = 22.9A645 - 4.68A663
[0101] Total chlorophyll concentration (mg / L): C(a+b)=Ca+Cb
[0102] Chlorophyll content (mg / g) = (C*V*N) / (W*1000)
[0103] In the formula, C represents the chlorophyll content (mg / L);
[0104] V is the volume of the extraction liquid (mL);
[0105] N is the dilution factor;
[0106] W represents the fresh or dry weight of the sample (g);
[0107] 1000 means 1L = 1000mL.
[0108] The results of chlorophyll detection are as follows Figure 7-9 As shown, R9-3, due to its ability to ferment and produce high levels of 5-acetylaminopropionic acid (5-ALA), can effectively induce an increase in chlorophyll a content in tobacco leaves, similar to 20 mg / L 5-acetylaminopropionic acid, with a significant increase compared to the CK control. Figure 7 R9-3 can also effectively induce chlorophyll b content in tobacco leaves, but there is no significant difference compared with the control (CK). Figure 8 Compared to the control (CK), R9-3 also effectively induced an increase in total chlorophyll content. Figure 9 ).
[0109] The results of this embodiment demonstrate that the fermentation broth of Bacillus belye R9-3 can effectively increase the POD enzyme activity, SOD enzyme activity, CAT enzyme activity, and chlorophyll content of tobacco, and significantly improve the growth capacity of tobacco under adverse stress conditions.
[0110] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. A recombinant Bacillus belye that produces 5-aminolevulinic acid (Bacillus belye) Bacillus velezensis ), characterized in that, It is achieved by using soybean slow-growing rhizobia ( Bradyrhizobium japonicum )of hemA Recombinant engineered bacteria obtained by integrating genes into the genome of Bacillus belyssus; hemA The nucleotide sequence of the gene is shown in SEQ ID No. 1; The recombinant Bacillus belysinus is based on the genome of Bacillus belysinus R9. bdh , pgsB , sinI The gene is simultaneously the hemA The integration site of the gene was identified, resulting in the recombinant Bacillus belyssus R9-3. The bdh The nucleotide sequence of the gene is shown in SEQ ID No. 2; pgsB The nucleotide sequence of the gene is shown in SEQ ID No. 3; sinI The nucleotide sequence of the gene is shown in SEQ ID No. 4; The Bacillus belyssus R9 was deposited at the China Center for Type Culture Collection (CCTCC) in Wuhan, China on July 5, 2023, with accession number CCTCC NO: M 20231199. The Bacillus belyssus R9-3 was deposited on July 5, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan, China, with accession number CCTCC NO: M 20231200.
2. A method for producing 5-aminolevulinic acid by fermentation, characterized in that, The recombinant Bacillus berreatus of claim 1 was inoculated into a fermentation medium and cultured at 37°C and 180-200 r / min for 34-38 h.
3. A recombinant Bacillus vesiculosus according to claim 1, which enhances the resistance of tobacco to salt stress and / or resistance to Ralstonia solanacearum (… Ralstonia solanacearum Applications in ).
4. The application according to claim 3, characterized in that, The fermentation broth of the recombinant Bacillus vesiculosus was sprayed onto tobacco leaves.
5. A product for enhancing the stress resistance of tobacco, characterized in that, The fermentation broth includes the recombinant Bacillus berleis as described in claim 1, wherein the stress resistance is resistance to salt stress and / or resistance to Ralstonia solanacearum.
Citation Information
Patent Citations
Construction method of bacillus for efficiently expressing 5-aminolevulinic acid
CN117230099A