High-temperature resistant xylanase mutants and applications thereof

By optimizing the amino acid sequence of xylanase through genetic engineering and protein engineering, a heat-resistant xylanase mutant was designed, solving the problems of low yield, high cost and poor temperature resistance of xylanase in industrial applications, and achieving a significant improvement in heat resistance, making it suitable for the feed industry.

CN117384889BActive Publication Date: 2026-08-25QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202311344298.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-12
Publication Date
2026-08-25
Estimated Expiration
2042-07-12

AI Technical Summary

Technical Problem

Existing xylanases suffer from low yield, high cost, and poor temperature and acid resistance in industrial applications, making it difficult to meet the ever-increasing production demands.

Method used

By using genetic engineering and protein engineering methods, the amino acid sequence of xylanase was optimized, disulfide bonds were introduced, and intraenzymatic charge interactions were optimized to design a heat-resistant xylanase mutant containing specific amino acid substitutions, such as T23S, S39D, T41N, S62Q, L64M, W116V, A139G, Y144F, T149F, and N160E/V, which significantly improved its heat resistance.

Benefits of technology

After treatment at 95℃ for 5 minutes, the enzyme activity residual rate of the mutant increased by 10.0%-25.6%, especially the enzyme activity residual rate of L64M mutant, which reached as high as 87.90%, making it suitable for industrial production.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering and protein modification, and particularly relates to a high-temperature-resistant xylanase mutant and application thereof. The present application is based on wild-type xylanase PT, and provides a mutant containing at least one of the following mutation sites: T23S, S39D, T41N, S62Q, L64M, W116V, A139G, Y144F, T149F, N160E / V. Compared with the wild type, after being treated at 95 DEG C for 5 min, the enzyme activity residual rate of the xylanase single-point mutant is increased by 10.0%-25.6%, and the heat resistance is significantly enhanced. The xylanase mutant containing the L64M single-point mutation has the strongest heat resistance, and the enzyme activity residual rate is as high as 87.90%, which is beneficial to the wide application of the xylanase mutant in the feed field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering technology, specifically to a thermoresistant xylanase mutant and its applications. Background Technology

[0002] Xylan is a polypentose sugar whose main component is D-xylose. Its backbone is a polymer composed of β-(1-4)-pyranotropic D-xylose units linked by β-1,4-glycosidic bonds. Most xylans are heteropolysaccharides, with the backbone often containing arabinose, coumaric acid, etc., and the branches containing various substituted glycosyl groups, such as ferulic acid and uronic acid. Because the residues of the xylan branches are linked to lignin, pectin, dextran, etc., xylan is difficult to degrade. Xylanase plays a crucial role in the degradation process, as it can open the backbone and branches of xylan and break it down into fermentable oligosaccharides or monosaccharides, facilitating biological utilization.

[0003] Xylanase (endo-1,4-β-D-xylanxylanohydrolase EC3.2.1.8) is a hydrolase, a complex enzyme system that degrades xylan into xylooligosaccharides or xylose. It typically includes both endonucleases and exonucleases. The xylanase commonly referred to is endo-β-1,4-D-xylanase (EC3.2.1.8), which primarily degrades the xylan backbone. The hydrolysis products are mainly xylobiose or higher-order oligosaccharides, with small amounts of xylose, arabinose, and mannose. It is considered one of the most crucial enzymes in xylan degradation. Based on their pH sensitivity, xylanases can be classified as acidophilic, basophilic, and neutral enzymes. They can also be classified based on their temperature sensitivity as thermophilic, mesophilic, and cryophilic enzymes.

[0004] Xylanases have a wide range of sources; nearly a hundred species and dozens of genera of microorganisms have been identified as xylanase producers, including bacteria, fungi, actinomycetes, and some yeasts. Currently reported bacteria include *Butyrivibro* and *Clostridium*; fungi include *Penicillium*, *Trichoderma*, and *Aspergillus*; actinomycetes include *Streptomyces sp.*, *Streptomyces flavogriseus*, and *Pseudomonos*; and yeasts include *Cryptococcus albidus*. Different types of microorganisms produce different types of xylanases, and even the same microorganism can produce different xylanases.

[0005] Due to the crucial role of xylanase in the degradation of xylan, it has been widely applied in various industries, including pulp and paper, animal feed, food, energy, pharmaceuticals, and textiles. Although xylanase can be obtained from animals, plants, and microorganisms, currently, large quantities are primarily obtained through fermentation of fungi and bacteria. Acidic xylanase maintains high enzyme activity even at pH below 4.0, and it is commonly used in the feed, brewing, and food industries, demonstrating its significant production potential.

[0006] However, xylanases currently face limitations such as low yield, high cost, and difficulty in obtaining thermostable and acid-resistant enzymes. Therefore, obtaining novel xylanases with high yield and low cost suitable for commercialization using genetic engineering and protein engineering methods has become an urgent problem to be solved. Using the amino acid sequence of Pseudothermotoga thermarum DSM 5069 xylanase as a template, Shi Hao et al. analyzed the amino acid preference of thermostable xylanases and introduced strategies to optimize intramolecular interactions, including the introduction of disulfide bonds to optimize intraenzymatic charge interactions and stiffen the active site of the enzyme. This resulted in a xylanase with extremely strong thermostable properties and high activity under acidic pH conditions. This xylanase exhibited the highest enzyme activity at 95℃ and pH 5.5, and its thermostable properties were improved from 80℃ to 95℃. Shi Baojun screened an acidophilic fungus, Bisporasp.X-1, whose xylanase has an optimal pH of 2.6 and maintains more than 50% enzyme activity in the pH range of 2-4. The optimal temperature is 65℃. After incubation at 60℃ for 60 min, the enzyme activity remains basically unchanged. After incubation at 70℃ for 15 min, the remaining enzyme activity is more than 90%. After treatment for 60 min, the enzyme activity is still more than 70%. After treatment with pepsin and trypsin for 60 min, the enzyme activity is maintained at 85-100%.

[0007] Although numerous studies have improved the stability of xylanase, it still cannot meet the ever-increasing demands of industrial production. Therefore, providing a heat-resistant xylanase suitable for industrial production is of great practical significance. Summary of the Invention

[0008] The purpose of this invention is to provide a heat-resistant xylanase mutant and its applications. The mutant exhibits significantly improved heat resistance compared to the wild type, which is beneficial for its widespread application in the feed industry.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising, compared with SEQ ID NO:1, at at least one position of an amino acid substitution selected from the group consisting of: 23, 39, 41, 62, 64, 116, 139, 144, 149, 160.

[0010] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0011] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0012] In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid from the following group: T23S, S39D, T41N, S62Q, L64M, W116V, A139G, Y144F, T149F, N160E / V.

[0013] The present invention also relates to DNA molecules encoding the above-mentioned xylanase mutants.

[0014] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.

[0015] The present invention also relates to a host cell comprising the above-described recombinant expression vector.

[0016] When the plasmids were transferred into host cells, the heat resistance of the recombinant xylanase mutant was significantly improved.

[0017] In some embodiments of the present invention, the host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

[0018] In some embodiments of the present invention, the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).

[0019] The present invention also provides the application of the above-mentioned xylanase mutant in the field of feed.

[0020] This invention provides mutants containing at least one mutation site from the wild-type xylanase PT, based on the wild-type xylanase PT. Compared with the wild type, the single-site mutants of xylanase provided by this invention show a 10.0%-25.6% increase in enzyme activity residual rate after treatment at 95℃ for 5 min, and a significant improvement in heat resistance. Among them, the xylanase mutant containing the L64M single-site mutation exhibits the strongest heat resistance, with an enzyme activity residual rate as high as 87.90% after treatment at 95℃ for 5 min, achieving unexpected technical results. Detailed Implementation

[0021] This invention discloses a xylanase mutant, its preparation method and application, the DNA molecule encoding the xylanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0022] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLSIN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0023] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.

[0024] Culture medium formulation: Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast selection medium (MD medium): 2% peptone, 2% agarose; BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 1% Biotin, 1% Glycerin; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 % Biotin, 0.5% Methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0; The present invention will be further illustrated below with reference to the embodiments: Example 1 Construction of recombinant plasmid The synthesized xylanase gene (GeneBank MK138894.1) was optimized according to the codon preference of Pichia pastoris, with 6 bases GAATTC (EcoR I cleavage site) added before its start codon ATG and GCGGCCGC (Not I cleavage site) added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. This xylanase was named PT, its amino acid sequence is SEQ ID NO: 1, and its encoding nucleotide sequence is SEQ ID NO: 2.

[0025] The xylanase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, plasmid pPIC9K was digested with restriction endonucleases EcoRI and Not I. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α Escherichia coli (Invitrogen) and selected using ampicillin. To ensure accuracy, several clones were sequenced (Sangon).

[0026] The plasmid was purified from the correctly sequenced E. coli clone using the Plasmid Mini-Preparation Kit (Omega) to obtain one recombinant plasmid, which was named pPIC9K-PT.

[0027] Example 2 Screening of high-temperature resistant mutants To further improve the thermostability of xylanase PT, the applicant conducted protein structure analysis. This protein is a GHI1 family xylanase with a β-jelly roll structure. The applicant screened for numerous mutations in this enzyme using directed evolution technology.

[0028] 1.1 Design of PCR primers PT-F1 and PT-R1: PT-F1: GGC gaattc caaagtttctgtagttcagcttctc (The underlined part is the EcoRI restriction enzyme recognition site). PT-R1: ATA GGCGGCCG CTTATCATTAATCACCAATGTAAACCTT (The underlined part is the NotI restriction enzyme recognition site).

[0029] Using the PT gene (SEQ ID NO: 1) as a template, PCR amplification was performed using the above primers and the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The resulting product was transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing xylanase.

[0030] 30 μL of lysis buffer was transferred to two new 96-well plates. One plate was treated at 95 °C for 5 min. 30 μL of substrate was added to both plates, and the plates were reacted at 37 °C for 30 min. The reducing sugars produced were measured using the DNS method. Different mutants retained different activities after high-temperature treatment. The results showed that some mutations had no effect on the thermostability of xylanase, while others even worsened its thermostability or enzyme activity. Additionally, some mutations, although improving the temperature tolerance of xylanase, significantly altered its enzymatic properties, which did not meet the requirements. Finally, the following mutation sites were identified that significantly improved the thermostability of xylanase without affecting its enzyme activity and original enzymatic properties: T23S, S39D, T41N, S62Q, L64M, W116V, A139G, Y144F, T149F, N160E, and N160V.

[0031] Based on the above-mentioned wild-type xylanase PT, this invention provides mutants containing a single mutation site of T23S, S39D, T41N, S62Q, L64M, W116V, A139G, Y144F, T149F, N160E, and N160V respectively.

[0032] Example 3 Expression of xylanase in Pichia pastoris 3.1 Construction of expression vector Based on the codon preference of Pichia pastoris, the gene sequences of xylanase PT and its mutants were optimized and synthesized by Shanghai Jereh Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.

[0033] Following the method described in Example 1, the gene sequences of the synthesized xylanase PT and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μl, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM): 0.5 μL, 3' AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clone was verified, and the correct recombinant expression plasmid was obtained after sequencing.

[0034] 3.2 Construction of Pichia pastoris engineered strains 3.2.1 Preparation of competent yeast cells Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30℃ for 48 h. Activated GS115 single clones were then inoculated into 6 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 12 h. The culture was then transferred to Erlenmeyer flasks containing 30 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 4℃ and 9000 rpm for 2 min, and transferred to sterile EP tubes. The supernatant was gently discarded, and the remaining supernatant was blotted dry with sterile filter paper. The cells were resuspended in 1 mL of pre-cooled sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed once more with 1 mL of sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then resuspended in 1 mL of pre-cooled sorbitol (1... Resuspend the bacterial cells in sorbitol (1 mol / L); centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacterial cells in 100-150 μl of pre-cooled sorbitol (1 mol / L).

[0035] 3.2.2 Conversion and Screening The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.

[0036] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm for 1 day with shaking. They were then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking. 0.5% methanol was added daily to induce expression for 4 days. The cells were removed by centrifugation at 9000 rpm for 10 min to obtain fermentation supernatants containing xylanase PT and xylanase mutants, respectively.

[0037] 3.3 Xylanase activity assay (1) Definition of xylanase activity unit Under conditions of 37°C and pH 5.5, the amount of enzyme required to release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / ml is defined as one unit of enzyme activity, U.

[0038] (2) Enzyme activity assay method Take 2 ml of 1% xylan substrate (prepared with pH 5.5 acetate-sodium acetate buffer) and add it to a colorimetric tube. Equilibrate at 37°C for 10 min. Then add 2 ml of acidic xylanase enzyme solution, appropriately diluted with pH 5.5 acetate-sodium acetate buffer and equilibrated at 37°C. Mix well and incubate at 37°C for 30 min. After the reaction is complete, add 5 ml of DNS reagent and mix well to terminate the reaction. Then boil in a boiling water bath for 5 min, cool to room temperature with tap water, and dilute to 25 ml with distilled water. Mix well and use a standard blank sample as a blank control. Measure the absorbance A at 540 nm. E .

[0039] Enzyme activity calculation formula: X D =[(A E - A B )×K+ C0] ×N×1000 / (M×t).

[0040] In the formula: X D To dilute the xylanase activity in the enzyme solution, U / mL; A E The absorbance of the enzyme reaction solution; A B λ is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C0 is the intercept of the standard curve; M is the molar mass of xylose, 150.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme dilution factor; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0041] (3) Results of enzyme activity assay Enzyme activity was detected using the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain expressing xylanase PT and its mutant was 230-600 U / mL.

[0042] Example 4: Heat resistance analysis of xylanase mutants The fermentation supernatant of the recombinant Pichia pastoris strains expressing xylanase PT and its mutants obtained above was diluted to approximately 20 U / mL with acetate-sodium acetate buffer at pH 5.5. After treatment at 95℃ for 5 min, the residual enzyme activity was measured. The enzyme activity of the untreated sample was taken as 100%, and the residual enzyme activity rate was calculated. The specific results are shown in Table 1.

[0043] Table 1. Heat resistance analysis of xylanase mutants PT 70.00% T23S 81.30% S39D 80.18% T41N 79.77% S62Q 81.70% L64M 87.90% W116V 79.45% A139G 81.00% T149F 82.00% N160E 86.00% N160V 76.99% Y144F 84.79% As shown in Table 1, compared with wild-type xylanase PT, xylanase mutants containing single mutation sites (T23S, S39D, T41N, S62Q, L64M, W116V, A139G, T149F, N160E, N160V, and Y144F) exhibited significantly enhanced enzyme activity residual rates (10.0%-25.6%) after treatment at 95℃ for 5 minutes, demonstrating a substantial increase in heat resistance. Among these, the xylanase mutant containing the L64M single-point mutation exhibited the strongest heat resistance, achieving an enzyme activity residual rate as high as 87.90% after treatment at 95℃ for 5 minutes, demonstrating an unexpectedly high technical effect.

[0044] In summary, the xylanase mutant provided by this invention has stronger heat resistance and is more suitable for use in the feed industry than the wild type.

Claims

1. A xylanase mutant, characterized in that, The mutant is a xylanase with the amino acid sequence SEQ ID NO:1 in which the 144th amino acid is changed from Tyr to Phe.

2. A DNA molecule encoding the xylanase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3.

5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

6. The host cell as described in claim 4, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

7. The application of the xylanase mutant of claim 1 in the field of feed.

Citation Information

Patent Citations

  • High-temperature-resistant xylanase mutant and application thereof

    CN115029335A

  • High-temperature-resistant xylanase mutant and application thereof

    CN117384888A

  • High-temperature-resistant xylanase mutant and application thereof

    CN117384889A