A dual-target gene for precision treatment of bladder cancer

Abstract

The present invention discloses a dual-targeted gene circuit for precision treatment of bladder cancer, and relates to the field of artificial gene application technology. The dual-targeted gene includes an A gene circuit and a B gene circuit, wherein the A gene circuit is shown in SEQ ID NO:1, and its structure is: an artificial promoter dCas9-VPR for monitoring the activity of the TGF-β / Smad pathway, and the artificial promoter for monitoring the activity of the TGF-β / Smad pathway is shown in SEQ ID NO:2; the B gene circuit is shown in SEQ ID NO:3, and its structure is an artificial promoter ribozyme BAX-ribozyme for monitoring the activity of the MAPK / ERK pathway, and the artificial promoter for monitoring the activity of the MAPK / ERK pathway is shown in SEQ ID NO:4. The present invention achieves specific intervention in bladder cancer cells by reprogramming the oncogenic signaling pathway of cells without affecting normal cells.

Description

Technical Field

[0001] The present invention relates to the field of artificial gene application technology, and in particular to a dual-targeting gene for precise treatment of bladder cancer. Background Art

[0002] Bladder cancer (BC) is a highly aggressive and complex malignancy within the urinary system. Although multiple treatment options exist, including chemotherapy, radiotherapy, and gene therapy, the associated side effects and limited efficacy of these treatments pose significant challenges in the management of BC. The screening of tumor biomarkers is an important step in cancer diagnosis, treatment, and prognosis assessment. The rapid development and widespread application of bioinformatics have provided strong support for the screening of tumor biomarkers. Bioinformatics enables researchers to analyze large amounts of biological data to identify patterns and correlations that may not be obvious with traditional research methods. By applying bioinformatics techniques to bladder cancer research, we can gain a deeper understanding of the molecular mechanisms of this disease.

[0003] Synthetic biology uses tools from disciplines such as genetic engineering, systems biology, and computer engineering to design or even create biological systems according to specific needs. In 2000, Science reported the synthesis of two artificial gene networks, an oscillator and a switch, which officially opened an important branch of synthetic biology research called gene circuits. Common regulatory modes in gene circuits are similar to "switches" and "logic gates" in electronic components. "Switches" are molecular structures that can perform specific recognition functions, such as riboswitches and RNA switches. Boolean logic gates are the core of gene circuit design and can perform Boolean logic functions (not, and, or). The "and" gate is a basic digital logic gate that can integrate multiple input signals and output signals only when all input signals are present. For example, Kemmer et al. designed a gene circuit that uses the "and" gate to regulate uric acid balance in vivo. The gene circuit can reduce uric acid levels by expressing urate oxidase under conditions of high uric acid stimulation. Further experiments showed that when the gene circuit device was implanted into transgenic mice with urate oxidase deficiency, uric acid levels were significantly reduced and uric acid crystal deposition in the kidneys was also significantly reduced. Xie et al. constructed a multi-input RNAi-based logic circuit for identifying specific HeLa cancer cells. Synthetic biology is an emerging field that uses engineering methods and genomic knowledge to design, build, and optimize novel biological systems, which has been widely used in the medical field. One of the most commonly used tools in synthetic biology is the CRISPR / Cas9 system, which can precisely edit DNA sequences. However, the traditional form of Cas9 protein is limited by double-stranded DNA breaks, which limits its application in gene regulation. To overcome this limitation, a variant called Cas9 nuclease-inactive mutant (dCas9) was developed. dCas9 lacks the catalytic activity of Cas9, but can still bind to RNA and form a stable complex with DNA. Therefore, dCas9 can be used for gene expression regulation by using RNA to guide targeting of specific DNA sequences. In the gene regulation application of dCas9, the RNA bound by the Cas9 protein is usually used as a guide RNA (gRNA) to direct dCas9 to a specific DNA sequence. Gene activation or repression can be achieved by combining dCas9 with a functional unit (transcription activator or repressor). Using the CRISPR-dCas9 gene editing tool to precisely regulate gene expression is convenient, easy to operate and efficient.

[0004] Artificial gene circuits are systems composed of multiple genes that can be designed as controllable signal transduction networks. By regulating the internal signal transduction of cells, artificial gene circuits can achieve precise killing of tumor cells, thereby improving the therapeutic effect. The signal transduction network can be regarded as a "switch", and artificial gene circuits are usually constructed using logic gates to control gene expression. Common logic gates include AND gates, OR gates, and NOT gates, which correspond to the "and", "or", and "not" relationships in logical operations, respectively. Artificial gene circuits are usually composed of signal sensors, transcription factors, effector genes, and feedback loops. Although the engineering principles of most gene circuits have been established, they can only be induced by a single or a few exogenous small molecule inducers, endogenous RNA molecules, or cell surface antigens as "trigger factors" to control gene regulation. At present, we lack the overall identification and control of the signal network of bladder cancer-related pathways. However, signal transduction molecules do not act independently during the development of cancer, but form a network through interaction. A variety of gene circuits, including AND gates, can sense and process various endogenous signals and have been used for cancer identification and treatment. For example, Nissim et al. synthesized an RNA-sensing AND gate circuit that generates a combined immune-modulatory output only when two synthetic cancer-specific promoters are active. Chung et al. constructed an efficient synthetic pathway using modular synthetic proteins to reprogram cancer signals to achieve therapeutic release. Although modular combination technology in gene circuit construction has been widely used, many previous studies have only reported the regulation of a few target molecules in the signaling pathway, lacking targeted identification and regulation based on signaling networks. Summary of the invention

[0005] In response to the above-mentioned problems in the prior art, the present invention provides a dual-targeted gene for precision treatment of bladder cancer, which we call a logic "AND" gate dual-targeted gene circuit (LAG-DTGC). This circuit establishes a logic "AND" gate in the targeted cells and uses tumor-specific molecules as recognition signals. By reprogramming the oncogenic signaling pathways in the cells, we can control the expression of apoptosis-related genes, thereby specifically intervening in bladder cancer cells without affecting normal cells. This innovative cancer treatment method embodies the potential of a unified, targeted strategy. LAG-DTGC provides enhanced specificity and effectiveness in cancer treatment because it targets specific molecular mechanisms involved in cancer progression while leaving normal cells alone.

[0006] The technical solution adopted by the present invention is as follows:

[0007] A dual-targeting gene for precision treatment of bladder cancer, comprising gene A and gene B, wherein the gene A is shown in SEQ ID NO:1, and its structure is: an artificial promoter for monitoring TGF-β / Smad pathway activity-dCas9-VPR, and the artificial promoter for monitoring TGF-β / Smad pathway activity is shown in SEQ ID NO:2; the gene B is shown in SEQ ID NO:3, and its structure is an artificial promoter for monitoring MAPK / ERK pathway activity-ribozyme-BAX-ribozyme, and the artificial promoter for monitoring MAPK / ERK pathway activity is shown in SEQ ID NO:4.

[0008]

[0009] SEQ ID NO:2: AGTATGTCTAGACTGAAGTATGTCTAGACTGAAGTATGT CTAGACTGACTCGAGGATATCAAGATCTGGCCTCGGCGGCCAAGCTTAGAC ACTAGAGGGTATATAATGGAAGCTCGACTTCCAG

[0010] SEQ ID NO:3: AGTATGTCTAGACTGAAGTATGTCTAGACTGAAGTATGT CTAGACTGACTCGAGGATATCAAGATCTGGCCTCGGCGGCCAAGCTTAGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTCGAGCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCGACGGGACCAAACCTCCCGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGATGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACAGCTTTGGACTT

[0011] SEQ ID NO:4: AGGATGTCCATATTAGGACATCTAGGATGTCCATATTAG GACATCTAGGATGTCCATATTAGGACATCTAGGATGTCCATATTAGGACATCTAGGATGTCCATATTAGGACATCTAGATCTGGCCTCGGCGGCCAAGCTTAGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG

[0012] In summary, compared with the prior art, the present invention has the following advantages and beneficial effects:

[0013] Based on the concepts of synthetic biology engineering and bioinformatics methods, this invention constructs a gene LAG-DTGC with a dual-target recognition "AND" gate, which is designed to accurately identify and kill bladder cancer cells without affecting normal cells. In order to test the specificity of these potential bladder cancer targets, we selected two targets (CNTN1 and COL14A1) for verification. CNTN1 is a cell surface neural adhesion protein that plays a key role in the development of neural morphology and synapse formation. Studies have shown that the expression of CNTN1 in tumor cells is closely related to the malignancy and prognosis of various tumors such as breast cancer, prostate cancer, colon cancer, ovarian cancer and lung cancer. COL14A1 is a collagen that plays a supporting structural and cell adhesion role in the extracellular matrix. Studies have shown that the expression level of COL14A1 is significantly increased in various tumors such as breast cancer, colon cancer, lung cancer and liver cancer, and is closely related to the invasiveness and prognosis of the tumor. In addition, COL14A1 is also involved in regulating multiple signaling pathways, such as TGF-β, Wnt and NF-κB pathways. Through dual luciferase reporter gene experiments, we found that CNTN1 has a negative regulatory relationship with the potential downstream pathway TGF-β / Smad, while COL14A1 has a negative regulatory relationship with the potential downstream pathway MAPK / ERK. This lays the foundation for the construction of LAG-DTGC that can recognize tumor-specific molecules as recognition signals, and achieve specific intervention in bladder cancer cells by reprogramming the cell's oncogenic signaling pathways without affecting normal cells. The successful construction of LAG-DTGC highlights the potential of synthetic biology in cancer treatment. Through further optimization and testing, this approach may lead to a new generation of cancer treatments that are more precise, more effective, and less toxic than traditional therapies. This new paradigm not only provides a promising approach for cancer treatment, but also provides inspiration for the potential of interdisciplinary collaboration in biomedical research. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The present invention is a route for constructing the dual-targeting gene LAG-DTGC and the related reaction mechanism;

[0015] Figure 2Figure 1 is a graph showing the experimental relationship between the stable clones infected with lentivirus and the gene circuits carrying the logic "AND" gate, where A is a band graph showing the expression of BAX protein between 5637 cells carrying the gene circuits carrying the logic "AND" gate and cells not carrying the gene circuits by Western blot analysis; B is a bar graph showing the protein expression by measuring the grayscale value of Figure A; C is a stable clone carrying the gene circuits carrying the logic "AND" gate constructed by infection with lentivirus, using Western blot analysis; Blot analysis shows the experimental band diagram of BAX protein expression between SV-HUC1 cells carrying the logic "AND" gate gene circuit and cells without it; D is a protein expression bar graph obtained by measuring the gray value of Figure C; E is a diagram of cell apoptosis between SV-HUC1 cells carrying the logic "AND" gate gene circuit (experimental group) and cells without it (control group), and 5637 cells carrying the logic "AND" gate gene circuit (experimental group) and cells without it (control group); F is a bar graph of apoptosis rate obtained by measuring the apoptosis of Figure E, and the error bars represent the mean ± standard deviation. Each experiment was repeated at least three times (ns P>0.05, *P<0.05, **P<0.01, ***P<0.001);

[0016] Figure 3 Figure 1 is a graph of CCK8 experimental results, where A is a comparison of the proliferation capacity between experimental cells carrying the logic "AND" gate gene circuit and control cells not carrying the logic "AND" gate gene circuit in the SV-HUC1 cell line; B is a comparison of the proliferation capacity between experimental cells carrying the logic "AND" gate gene circuit and control cells not carrying the logic "AND" gate gene circuit in the 5637 cell line; C is a bar graph of the proliferation capacity between experimental cells carrying the logic "AND" gate gene circuit and control cells not carrying the logic "AND" gate gene circuit in the SV-HUC1 cell line and the 5637 cell line; D is a microscopic graph of the proliferation capacity between experimental cells carrying the logic "AND" gate gene circuit and control cells not carrying the logic "AND" gate gene circuit in the SV-HUC1 cell line and the 5637 cell line, and the error bars represent the mean ± standard deviation, and each experiment was repeated at least three times (ns P>0.05, *P<0.05, **P<0.01, ***P<0.001);

[0017] Figure 4The results of the scratch experiment are shown in Figure 1, where A is a comparison of the migration ability between the experimental cells carrying the logic "AND" gate gene circuit and the control cells not carrying the logic "AND" gate gene circuit in the SV-HUC1 cell line; B is a bar graph of the migration ability between the experimental cells carrying the logic "AND" gate gene circuit and the control cells not carrying the logic "AND" gate gene circuit in the SV-HUC1 cell line; C is a comparison of the migration ability between the experimental cells carrying the logic "AND" gate gene circuit and the control cells not carrying the logic "AND" gate gene circuit in the 5637 cell line; D is a comparison of the migration ability between the experimental cells carrying the logic "AND" gate gene circuit and the control cells not carrying the logic "AND" gate gene circuit in the 5637 cell line. A is a bar graph showing the migration ability between experimental cells carrying the logic "AND" gate gene circuit and control cells not carrying the logic "AND" gate gene circuit; E is a microscopic graph showing the invasion ability between experimental cells carrying the logic "AND" gate gene circuit and control cells not carrying the logic "AND" gate gene circuit in SV-HUC1 cell line and 5637 cell line; F is a bar graph showing the invasion ability between experimental cells carrying the logic "AND" gate gene circuit and control cells not carrying the logic "AND" gate gene circuit in SV-HUC1 cell line and 5637 cell line, error bars represent mean ± standard deviation, each experiment was repeated at least three times (ns P>0.05, *P<0.05, **P<0.01, ***P<0.001);

[0018] Figure 5 Figure 1 is an experimental diagram of mice in the control group and the gene circuit group injected with transfected cells, where A and B are images of mice in the control group and the gene circuit group injected with transfected cells; C is a comparison of tumor images dissected from mice in the control group and the gene circuit group injected with transfected cells; D is a line graph of tumor growth changes over time in the control group and the gene circuit group; EH are bar graphs of ELISA results of IL-1, IL-6, IL-8, and TNF-α in the control group and the gene circuit group, respectively. The error bars represent the mean ± standard deviation. Each experiment was repeated at least three times (ns P>0.05, *P<0.05, **P<0.01, ***P<0.001). DETAILED DESCRIPTION

[0019] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0020] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0021] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0022] The present application will be described in detail below with reference to embodiments and experimental data.

[0023] Example 1

[0024] The cell lines used in this example include human bladder cancer cell lines 5637, UMUC-3, T24, BIU-87, human bladder normal epithelial cell line SV-HUC1, and human kidney epithelial cell line 293T. All cell lines were purchased from the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The cells were cultured at 37°C in a humidified incubator containing 5% CO2. 5637, UMUC-3, T24, and BIU-87 cell lines were cultured based on RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin / streptomycin (Gibco). SV-HUC1 cells were cultured in F-12K medium (Gibco) supplemented with 10% FBS and 1% penicillin / streptomycin. 293T cells were cultured in Dulbecco's modified cell culture medium (DMEM, Gibco) supplemented with 10% FBS and 1% penicillin / streptomycin.

[0025] The two bladder cancer targets we selected, CNTN1 and COL14A1, are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively.

[0026]

[0027]

[0028] The above cells, targets and constructed genes were used to perform the following operations:

[0029] 1. Luciferase Assay

[0030] To confirm the function of the artificial promoter, a luciferase reporter gene was constructed. First, the artificial promoter was cloned into the GV238 vector, upstream of the luciferase reporter gene. The CNTN1 overexpression plasmid and the plasmid used to monitor the activity of the TGF-β / Smad pathway were transfected into 293T cells at the same time, while the COL14A1 overexpression plasmid and the plasmid used to monitor the activity of the MAPK / ERK pathway were transfected into 293T cells at the same time. After 48 hours, the cells were lysed and the luciferase activity was measured using a dual-luciferase reporter kit.

[0031] 2. Construction of a stable transgenic strain carrying LAG-DTGC

[0032] Artificial promoter-dCas9-VPR (gene circuit A) for monitoring the activity of the TGF-β / Smad pathway and artificial promoter-ribozyme-sgRNA (BAX)-ribozyme (gene circuit B) for monitoring the activity of the MAPK / ERK pathway were constructed respectively. The plasmids carrying the tools (gene circuit A and gene circuit B) and the vector virus packaging auxiliary plasmid were co-transfected into the 293T cell line, and the lentivirus was collected, concentrated and purified. The two lentiviruses (the lentivirus obtained by co-transfection of the 293T cell line and the vector virus packaging auxiliary plasmid) were successively infected with bladder cancer cell lines 5637, T24 and bladder epithelial cell line SV-HUC1. Stable transfectants were obtained after drug screening, and the infection effect was verified by immunoblot (western blot, WB).

[0033] 3. Western Blot Analysis

[0034] Cells were collected and lysed using RIPA buffer. Protein concentration was determined using the BCA method. Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes. Then, they were blocked with 5% skim milk powder and incubated with primary antibodies specific for CNTN1, COL14A1, BAX, and β-actin. After washing, they were incubated with HRP-conjugated secondary antibodies, and protein bands were visualized using ECL reagents. Experimental band images were generated by ChemiCapture software, and the grayscale values ​​of the measured bands were analyzed by ImageJ software.

[0035] IV. Cell apoptosis experiment

[0036] Cell apoptosis was detected by flow cytometry using the Annexin V-FITC / PI double staining method. Stable cell lines (5637 and SV-HUC1) carrying LAG-DTGC and control cells were seeded in 6-well plates. After 48 hours, the cells were collected and washed with cold PBS. Then, the cells were suspended in binding buffer and incubated with Annexin V-FITC and PI. After incubation, cell analysis was performed using flow cytometry.

[0037] 5. Cell Viability Experiment

[0038] Cell viability was determined using the CCK-8 assay. After transfection, cells were seeded in a 96-well plate and incubated for 0, 12, 24, and 48 hours. Then, 10 μL of CCK-8 reagent was added to each well and incubated for an additional 2 hours. The absorbance was measured at 450 nm using a microplate reader.

[0039] VI. 5-Ethynyl-2'-deoxyuracil (EdU) incorporation experiment

[0040] Cell proliferation was determined using the EdU assay. After transfection of LAG-DTGC, cells were seeded in 6-well plates and incubated for 24 hours. Then, 1 ml of EdU was added to each well and incubated for an additional 2 hours. The cells were then fixed and stained with Apollo fluorescent dye, and EdU-positive cells were counted using a fluorescent microscope.

[0041] VII. Cell scratch assay

[0042] In order to study the effect of LAG-DTGC on the migration ability of bladder cancer cells and normal bladder cells, a cell scratch experiment was performed. Cells were seeded in 6-well plates at a density of 1×10^6 cells / well and cultured in DMEM medium at 37°C and 5% CO2. After reaching a density of 80-90%, the cell monolayer was scratched using a 10μL sterile pipette tip. The cells were washed with PBS to remove debris and cultured in serum-free medium for 24 hours. Images were captured using a microscope (Leica, Germany) at 0 hours, 24 hours, and 48 hours after the scratch area. Each experiment was repeated three times, and the results are expressed as mean ± standard deviation (SD).

[0043] 8. Transwell chamber experiment

[0044] The cells were planted in the upper chamber of a Transwell plate (Corning, USA) covered with Matrigel, and the lower chamber was filled with DMEM culture medium containing 20% ​​FBS as a chemoattractant. After incubation for 24 hours, the cells invading the lower chamber were fixed with 4% glutaraldehyde, stained with 0.1% crystal violet, and observed and counted under a microscope (Leica, Germany). Each experiment was repeated three times, and the results were expressed as mean ± standard deviation (SD).

[0045] IX. Tumor Xenograft Model and Quantification of IL-2, IL-6, IL-8, and TNF-α Levels

[0046] The tumor xenograft experimental procedures were approved by the Shenzhen Top Bioethics Committee (TOP-IACUC-2023-0038). Mice were housed under standard laboratory conditions. BALB / c nude mice were randomly assigned to experimental and control groups (six mice per group). Bladder cancer T24 cells (5×10^6) carrying the LAG-DTGC tool were subcutaneously injected in the experimental group, and bladder cancer T24 cells (5×10^6) carrying empty loads were subcutaneously injected in the control group. Tumor volume was measured three times a week for three weeks. The tumor volume calculation formula is: V=L×W^2 / 2, where L is the tumor length and W is the tumor width. At the end of the experiment, the mice were killed, the tumors were removed and the peripheral blood was retained. Serum was used for ELISA experiments, which included IL-1, IL-6, IL-8, and TNF-α. According to the manufacturer's guidelines, commercially available ELISA kits were used for experiments, and enzyme labels and standard curves were drawn according to the results. The concentrations of IL-1, IL-6, IL-8, and TNF-α were calculated.

[0047] 10. Statistical Analysis

[0048] Differences between groups were analyzed using chi-square test, Fisher's exact test, Student's t test or analysis of variance (ANOVA). All data were from at least three independent replicates. Two-tailed P values ​​less than 0.05 were considered statistically significant. All statistical analyses were performed using GraphPad Prism 7.0.

[0049] Results and Analysis

[0050] Based on the bladder cancer targets CNTN1 and COL14A1, we designed and constructed a LAG-DTGC. This LAG-DTGC can reprogram the oncogenic signaling pathways of cells, control the expression of the apoptosis gene BAX, achieve specific intervention in bladder cancer cells, and kill cells without affecting normal cells. The designed LAG-DTGC utilized the CRISPR-dCas9 system, functional units (transcription activators), an artificial promoter that monitors the activity of the TGF-β / Smad pathway, an artificial promoter that monitors the activity of the MAPK / ERK pathway, ribozymes, and sgRNA (BAX) to construct two parts, line A and line B, as Figure 1As shown. In bladder cancer cells, due to the low expression of CNTN1 and COL14A1, downstream regulatory pathways (TGF-β / Smad and MAPK / ERK) are activated. Line A starts with an artificial promoter that monitors the activity of the TGF-β / Smad pathway, driving the transcription of dCas9 protein and functional unit (transcription activator) mRNA. Line B starts with an artificial promoter that monitors the activity of the MAPK / ERK pathway, controlling the transcription of the sgRNA-targeted BAX gene. In order to achieve efficient expression of sgRNA in the nucleus, we attached ribozymes to both sides of the sgRNA. Ultimately, the output signal of this line leads to cell apoptosis. In theory, in normal cell lines, the transcriptional expression of lines A and B is low, and the expression of the apoptotic gene BAX is not affected or only slightly affected, which is not enough to change the fate of cells. Compared with normal cells, bladder cancer cells have low expression of CNTN1 and COL14A1, which negatively activates downstream regulatory pathways (TGF-β / Smad and MAPK / ERK). Therefore, this designed LAG-DTGC only receives effective output signals in bladder cancer cells, achieving specific intervention and killing bladder cancer cells without affecting normal cells. Next, we verified whether this tool can function normally in cells by constructing stable cell lines of bladder cancer and normal cell lines carrying LAG-DTGC. Western blot results showed that the output signal BAX in the bladder cancer cell line was higher in translation efficiency ( Figure 2 AB), while the expression of apoptosis gene BAX in normal cell lines was not affected ( Figure 2 CD), thus confirming our hypothesis.

[0051] LAG-DTGC promotes apoptosis in bladder cancer cells

[0052] To investigate the effect of LAG-DTGC on apoptosis in normal bladder epithelial cells and bladder cancer cells, we performed apoptosis double staining experiments using flow cytometry and detected the activity of apoptotic protein Caspase-3. Figure 2 As shown in EF, the proportion of apoptotic cells in 5637 bladder cancer cells in the experimental group increased significantly compared with the control group (P<0.05), while there was no significant difference in the apoptosis rate between the control group and the experimental group of the SV-HUC1 cell line (P>0.05). This indicates that LAG-DTGC can significantly promote the apoptosis of bladder cancer cells without affecting normal bladder cells.

[0053] LAG-DTGC inhibits the proliferation of bladder cancer cells

[0054] We used CCK-8 and EdU assays to investigate the effects of LAG-DTGC on the proliferation of normal bladder cells (SV-HUC1) and bladder cancer epithelial cells (5637). CCK8 data ( Figure 3 AB) showed that the number of 5637 cells in the experimental group was significantly reduced compared with the control group (P<0.05), while the number of cells between the control group and the experimental group of normal cells did not change significantly (P>0.05). Figure 3 CD) also showed that the proliferation of 5637 cells in the experimental group was inhibited (P<0.05), while the proliferation of normal cells did not change significantly (P>0.05). This indicates that LAG-DTGC can significantly inhibit the proliferation of bladder cancer cells without affecting normal bladder cells.

[0055] LAG-DTGC specifically inhibits bladder cancer cell migration and invasion

[0056] We further studied the effect of LAG-DTGC on the migration and invasion of bladder cancer cells and bladder epithelial cells. The scratch test was used to verify the cell migration ability, and the experimental results showed that ( Figure 4 AD), compared with the control group, the migration ability of 5637 cells in the experimental group was significantly inhibited (P<0.05), while the migration ability of normal bladder cells (SV-HUC1) was not significantly different between the control group and the experimental group (P>0.05). Transwell assay was used to verify the cell invasion ability, and the results showed that ( Figure 4 EF), compared with the control group, the invasion ability of 5637 cells in the experimental group was significantly inhibited (P<0.05), while there was no significant difference in the invasion ability between the control group and the experimental group in the SV-HUC1 cell line (P>0.05).

[0057] LAG-DTGC tool effectively reduces tumor growth in vivo

[0058] We constructed a stable transgenic line of T24 bladder cancer cells carrying the LAG-DTGC tool and further studied it using a subcutaneous tumor model in vivo. No obvious side effects of the mouse in vivo system were observed during at least three weeks of observation. After activating the BAX protein, there was a statistically significant reduction in the volume of xenograft tumors compared with the negative control group ( Figure 5 AD). At the end of the experiment, the expression of these four inflammatory markers (IL-1, IL-6, IL-8, TNF-α) in the LAG-DTGC group was significantly increased compared with the negative control group ( Figure 5 EH). Taken together, these results suggest that the LAG-DTGC tool can effectively reduce tumor growth in vivo.

[0059] In this example study, we successfully used the CRISPR-dCas9 system to construct a gene circuit with a dual-target recognition "AND" gate based on the concepts of synthetic biology engineering and bioinformatics methods. LAG-DTGC is designed to accurately identify and kill bladder cancer cells without affecting normal cells. In order to test the specificity of these potential bladder cancer targets, we selected two targets (CNTN1 and COL14A1) for verification. CNTN1 is a cell surface neural adhesion protein that plays a key role in the development of neural morphology and synapse formation. Studies have shown that the expression of CNTN1 in tumor cells is closely related to the malignancy and prognosis of various tumors such as breast cancer, prostate cancer, colon cancer, ovarian cancer and lung cancer. COL14A1 is a collagen that plays a supporting structural and cell adhesion role in the extracellular matrix. Studies have shown that the expression level of COL14A1 is significantly increased in various tumors such as breast cancer, colon cancer, lung cancer and liver cancer, and is closely related to the invasiveness and prognosis of the tumor. In addition, COL14A1 is also involved in regulating multiple signaling pathways, such as TGF-β, Wnt, and NF-κB pathways. Through dual luciferase reporter gene experiments, we found that CNTN1 had a negative regulatory relationship with the potential downstream pathway TGF-β / Smad, while COL14A1 had a negative regulatory relationship with the potential downstream pathway MAPK / ERK. This laid the foundation for the construction of LAG-DTGC that can recognize tumor-specific molecules as recognition signals, and achieve specific intervention in bladder cancer cells by reprogramming the oncogenic signaling pathways of cells without affecting normal cells. Our study constructed a dual-pathway targeted gene circuit, using tumor-specific molecules as recognition signals to establish a logical AND gate gene circuit in target cells. By reprogramming the oncogenic signaling pathways of cells, specific intervention in bladder cancer cells was achieved without affecting normal cells. This new paradigm for cancer treatment demonstrates the potential of a unified approach to cancer treatment. By first using bioinformatics to identify specific tumor cell targets and pathways, and then using synthetic biology engineering to construct gene circuits that can identify and reprogram cell signaling pathways associated with cancer development. LAG-DTGC offers increased specificity and efficacy in cancer treatment because it targets specific molecular mechanisms involved in cancer progression while protecting normal cells. The successful construction of LAG-DTGC highlights the potential of synthetic biology in cancer treatment. With further optimization and testing, this approach may lead to a new generation of cancer treatments that are more precise, more effective, and less toxic than traditional therapies. This new paradigm not only provides a promising approach for cancer treatment, but also sheds light on the potential for interdisciplinary collaboration in biomedical research.

[0060] Finally, it should be noted that the terms "comprises," "includes," or any other variations are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0061] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0062] The above-mentioned embodiments only express the specific implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the protection scope of the present application. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the technical solution concept of the present application, and these all belong to the protection scope of the present application.

Claims

1. A dual-targeted gene for precision treatment of bladder cancer, characterized in that: It includes gene A and gene B, the A gene is as shown in SEQ ID NO:1, and its structure is: artificial promoter-dCas9-VPR for monitoring TGF-β / Smad pathway activity, and the artificial promoter for monitoring TGF-β / Smad pathway activity is as shown in SEQ ID NO:2; the B gene is as shown in SEQ ID NO:3, and its structure is artificial promoter-ribozyme-BAX-ribozyme for monitoring MAPK / ERK pathway activity, and the artificial promoter for monitoring MAPK / ERK pathway activity is as shown in SEQ ID NO:4.

Images