Application of zineb in the preparation of ERK inhibitors

As an ERK inhibitor, zineb specifically inhibits the MAPK/ERK pathway, solving the problems of high cost and insufficient specificity of existing ERK inhibitors. It achieves low-cost and efficient induction and reversal of notochord malformations in zebrafish embryos, thus broadening the application fields of zineb.

CN120860058BActive Publication Date: 2026-06-30JINGGANGSHAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JINGGANGSHAN UNIVERSITY
Filing Date
2025-09-15
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing ERK inhibitors, such as U0126, are costly and lack specificity, making them difficult to effectively inhibit the MAPK/ERK pathway.

Method used

Zineb was used as an ERK inhibitor to induce notochord malformation in zebrafish embryos by specifically inhibiting the MAPK/ERK pathway at concentrations of 2 μM to 8 μM, which could be reversed by the p-ERK1/2 agonist Ro 67-7476.

Benefits of technology

At low concentrations, zineb achieved a three-dimensional spiral notochord malformation in zebrafish embryos similar to that of U0126, demonstrating its high specificity and low cost advantages as an ERK inhibitor, and its ability to replace existing ERK inhibitors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120860058B_ABST
    Figure CN120860058B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedical technology, specifically disclosing the application of mancozeb in the preparation of ERK inhibitors. Through zebrafish embryo models and HEK293T cell experiments, this invention demonstrates that mancozeb can specifically inhibit the MAPK / ERK pathway as an ERK inhibitor, and that at concentrations of 2μM to 8μM, it can induce a three-dimensional spiral notochord malformation in zebrafish embryos similar to that caused by 100μM U0126 treatment, providing a new approach for the preparation of MAPK / ERK pathway inhibitors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of zineb in the preparation of ERK inhibitors. Background Technology

[0002] Zineb is a widely used organosulfur protective fungicide, primarily used to control fungal diseases in various crops. The mitogen-activated protein kinase (MAPK / ERK) pathway is a core signaling axis regulating cell proliferation, differentiation, and morphogenesis; its abnormal activation is closely related to congenital spinal deformities, cancer, and neurodegenerative diseases. Existing ERK inhibitors (such as U0126) suffer from high cost and insufficient specificity. Therefore, it is necessary to explore a new approach for preparing MAPK / ERK pathway inhibitors. Summary of the Invention

[0003] To explore a new approach for preparing MAPK / ERK pathway inhibitors, this invention provides the application of mancozeb in the preparation of ERK inhibitors. In this invention, mancozeb can specifically inhibit the MAPK / ERK pathway as an ERK inhibitor, and at concentrations of 2 μM to 8 μM, it can induce a three-dimensional spiral notochord malformation in zebrafish embryos similar to that caused by 100 μM U0126 treatment, providing a new approach for preparing MAPK / ERK pathway inhibitors.

[0004] This invention provides the application of zineb in the preparation of ERK inhibitors, wherein the molecular formula of zineb is C4H7N2S4Zn, and the chemical structural formula of zineb is as follows:

[0005] .

[0006] In this invention, zineb can be used as an ERK inhibitor to specifically inhibit the MAPK / ERK pathway, and at concentrations of 2 μM to 8 μM, it can induce three-dimensional spiral malformations of the notochord in zebrafish embryos similar to those caused by 100 μM U0126 treatment, providing a new approach for the preparation of MAPK / ERK pathway inhibitors.

[0007] Furthermore, the inhibitor is used to suppress the MAPK / ERK signaling pathway.

[0008] Furthermore, the inhibitor uses zineb as its sole active ingredient.

[0009] Furthermore, the working concentration of the zineb is 2 μM to 8 μM.

[0010] Furthermore, the inhibitor also includes pharmaceutically acceptable excipients.

[0011] Furthermore, the excipient is DMSO or PBS.

[0012] Furthermore, the inhibitor targets zebrafish embryo models or mammalian cell models.

[0013] Furthermore, the inhibitor is used to induce a phenotype of abnormal notochord development in a zebrafish embryo model or a phenotype of inhibited cell proliferation in a mammalian cell model.

[0014] Furthermore, the notochord developmental abnormalities or cell proliferation inhibition induced by the inhibitor can be reversed by the p-ERK1 / 2 specific agonist Ro 67-7476.

[0015] Furthermore, the inhibitor can be used to induce a notochordial malformation model in zebrafish.

[0016] Furthermore, including the aforementioned zineb and pharmaceutically acceptable excipients, the concentration of zineb in the ERK inhibitor is 2 μM to 8 μM.

[0017] Furthermore, the ERK inhibitor formulation consists of Zineb and DMSO.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] In this invention, Zineb can downregulate key genes in the MAPK / ERK pathway ( MAPK-2 , MAPK-3 , MYC , ELK1 , JUN , RSK Zineb achieves pathway inhibition, specifically suppressing p-ERK protein expression, and the inhibitory effect can be reversed by the p-ERK1 / 2 agonist Ro67-7476, demonstrating the precision of Zineb as an inhibitor in suppressing the target.

[0020] Experimental results using a zebrafish embryo model show that, compared to the existing ERK inhibitor U0126 (100 μM), Zineb, at lower concentrations (2 μM–8 μM), can induce similar three-dimensional spiral notochord malformations in zebrafish embryos. Furthermore, Zineb, as a widely used fungicide, has the advantages of lower cost and greater availability. In summary, this invention demonstrates that Zineb can transcend traditional pesticide application and serve as a low-cost, highly efficient, and highly specific ERK inhibitor, possessing application value as a replacement for the existing ERK inhibitor U0126. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 Phenotypic comparison of zebrafish embryos treated with 8 μM Zineb, 100 μM U0126, and 8 μM U0126 up to 72 hpf.

[0023] Figure 2 Phenotypic images of zebrafish embryos treated to 24 hpf in different treatment groups, namely 8 μM Zineb and 8 μM Zineb + ​​Ro 67-7476. The white box in the figure shows that notochord malformation in zebrafish embryos caused by Zineb was reversed by Ro67-7476.

[0024] Figure 3 The relative expression levels of genes related to the MAPK signaling pathway.

[0025] Figure 4 Immunofluorescence imaging of zebrafish embryos after treatment to 24 hpf in different treatment groups, including 8 μM Zineb and 8 μM Zineb+Ro 67-7476.

[0026] Figure 5 Protein expression analysis of HEK293T cells after exposure to Zineb for 36 h was performed. Group 1 was the control group, group 2 was the 4 μM Zineb treatment group, group 3 was the 8 μM Zineb treatment group, group 4 was the 4 μM U0126 treatment group, group 5 was the 8 μM U0126 treatment group, and group 6 was the co-treatment group of 4 μM Zineb and 4 μM Ro 67-7476. Detailed Implementation

[0027] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0028] Example 1: Application of zineb in the preparation of ERK inhibitors.

[0029] I. Experimental Materials

[0030] Zineb was purchased from Shanghai McLean Biochemical Technology Co., Ltd., CAS number 12122-67-7.

[0031] HEK293T cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) as a mammalian cell model.

[0032] II. Test Methods

[0033] 1. Phenotypic observation experiment

[0034] Zineb powder was dissolved in DMSO to prepare a 10 mM stock solution, which was stored at -20°C for later use. One healthy, sexually mature female and one male zebrafish were selected from each aquarium and placed in a mating pool. The next morning, fertilized eggs were transferred to petri dishes containing embryo culture medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4). Four hours post-fertilization (4 hpf), normally developing zebrafish embryos were randomly selected and distributed in 6-well plates (20 embryos per well). 5 mL of embryo culture medium containing 0.003% PTU was added to each well to inhibit pigmentation. Based on the residual concentration of zineb in the environment and the previous pre-experimental exposure treatments, zineb exposure concentration gradients were set at 2 μM, 4 μM, and 8 μM. The control group was exposed to 0.05% DMSO solvent, and all zineb treatment groups maintained the same DMSO concentration. The experimental fluid was changed every 24 hours until the zebrafish reached 72 hpf, and the developmental morphology of the notochord was observed.

[0035] Normally developing zebrafish embryos at 4 hpf were randomly selected and treated with 8 μM Zineb, 100 μM U0126, and 8 μM U0126 to 72 hpf, respectively. The notochord development phenotypes of zebrafish treated with Zineb and U0126 were compared. The control group was treated with 0.05% DMSO solvent.

[0036] Normally developing zebrafish embryos at 4 hpf were randomly selected and treated with 8 μM Zineb or 8 μM Zineb + ​​Ro67-7476 up to 24 hpf, respectively, to observe the effect of Ro67-7476 on notochord developmental abnormalities induced by Zineb. The control group was treated with 0.05% DMSO solvent.

[0037] 2. qRT-PCR

[0038] Sixty zebrafish juveniles at 4 hpf were divided into three groups and treated with 2 μM, 4 μM, and 8 μM Zineb, respectively, until 72 hpf. After treatment, they were washed three times with PBS. Total RNA was then extracted using the Monzol Reagent Pro kit (Mona Biotechnology Co., Ltd.), and 1 μg of total RNA was reverse transcribed using a cDNA transcription kit (Mona Biotechnology Co., Ltd.) to obtain the cDNA template. [The text abruptly ends here, likely due to an incomplete sentence or missing information.] MAPK-2 , MAPK-3 , MYC , ELK1 , JUN , RSK Specific primers were designed, and a qPCR kit (purchased from Mona Biotechnology Co., Ltd.) and cDNA template were used to detect the virus on an ABI Step One Plus RT-PCR system (Applied Biosystems, California, USA). MAPK-2 , MAPK-3 , MYC , ELK1 , JUN , RSK The expression level was measured using an endogenous control gene in the experiment. β-actin Transcription level was used as an internal reference, and 2 -ΔΔCt Results were expressed using the method. Each treatment contained 3 biological replicates.

[0039] The primer information for the above genes is as follows:

[0040] MYC-FP, TATGCTGCAAGTGACCGGAG, SEQ ID NO.1;

[0041] MYC-RP,TCACCGGCATTTTGACACTTG,SEQ ID NO.2;

[0042] RSK-FP, GTCAAATCACTTCACGGGGGC, SEQ ID NO.3;

[0043] RSK-RP, CCGAGCCCTCATCGTGAAC, SEQ ID NO.4;

[0044] JUN-FP, TATGCTGCAAGTGACCGGAG, SEQ ID NO.5;

[0045] JUN-RP, TCACCGGCATTTTGACACTTG, SEQ ID NO.6;

[0046] ELK1-FP, GTCTACACTGTTGCCCCTG, SEQ ID NO.7;

[0047] ELK1-RP, CAGCACTGGAGTCAGGGAAT, SEQ ID NO.8;

[0048] MAPK2-FP, TAGAGGGGACCAGGCATTCA, SEQ ID NO.9;

[0049] MAPK2-RP, ACGTCTCTGTGTGCGATGTT, SEQ ID NO.10;

[0050] MAPK3-FP, TGCTGGGTTTGGGTGTCAAT, SEQ ID NO.11;

[0051] MAPK3-RP, ATGCGGACTATATGCTGCCC, SEQ ID NO. 12.

[0052] 3. Immunofluorescence staining

[0053] Zebrafish embryos at 4 hpf were exposed to 8 μM Zineb and 8 μM Zineb + ​​Ro 67-7476 for up to 24 hpf, respectively, while the control group was exposed to 0.05% DMSO solvent. After treatment, the chorionic membrane of the zebrafish embryos was removed, and the embryos were washed three times with PBS and fixed overnight in 4% PFA at 4°C. The next day, the fish were treated with acetone overnight at -20°C. The skin of the juvenile fish was then removed, and the embryos were washed with 3% PT (3% Triton X-100, PBS, pH 7.0). The samples were then blocked with PBTN (3% PT, 4% BSA, 0.02% NaN3) for 2 h. After that, the samples were incubated overnight at 4°C with mouse anti-PCNA (1:500, ab29, Abcam, UK) and rabbit anti-p-ERK (1:500, 4370, CST, USA), and then incubated overnight at 4°C with the corresponding fluorescent secondary antibodies (YF® 647 Goat Anti-Mouse IgG, Y6108S, YF® 647 Goat Anti-Rabbit IgG, Y6109S, Uelandy, Suzhou, China). The incubated samples were washed three times with PT for 45 min each time, then treated with DAPI (10236276001, Roche, Germany) for 1 h, followed by washing three times with PT for 45 min each time. Finally, fluorescence imaging was performed using a laser scanning confocal microscope (TCS SP8, Leica, Germany).

[0054] 4. HEK293T cell culture and Zineb treatment

[0055] Human embryonic kidney cells (HEK293T) purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) were revived in a 37°C water bath for 2 min and then transferred to 6 cm cell culture dishes containing complete culture medium. These dishes were then cultured at 37°C in a 5% CO2 incubator. During culture, the adhesion and growth of HEK293T cells were observed, and culture medium was replenished or changed as needed. When the cell density in the 6 cm culture dishes reached 80% to 90%, the cells were uniformly passaged into 6-well plates. Once the cells in the 6-well plates adhered and the cell density in each well reached 70%, the culture medium was discarded. The cells were then exposed to complete culture medium supplemented with 4 μM Zineb, 8 μM Zineb, 4 μM U0126, 8 μM U0126, and 4 μM Zineb + ​​4 μM R0 67-7476, respectively, for 36 h. The control group was cultured in normal complete culture medium for 36 h.

[0056] 4. Western blot

[0057] HEK293T cells obtained from the above culture were resuspended in 1.5 mL centrifuge tubes and treated with 100 μL of RIPA lysis mixture (RIPA: phosphatase inhibitor: protease inhibitor = 100:1:1). The treated product was centrifuged at 12000 rpm at 4°C, and the supernatant was collected. Protein concentration was determined using a BCA protein assay kit (purchased from Beyotime Biotechnology). Subsequently, the supernatant was diluted with SDS-PAGE loading buffer, denatured at high temperature, and then subjected to SDS-PAGE electrophoresis. Proteins were blocked with 5% skim milk, and β-actin was used as an internal control protein to determine the protein levels of ERK and p-ERK. Western blot images were analyzed using ImageJ analysis software, and the expression levels of the target proteins were normalized relative to the internal control protein.

[0058] 6. Data Statistics

[0059] All statistical analyses were performed using GraphPad Prism version 7.0. t-tests were used to determine statistical significance. All data are expressed as mean ± standard deviation. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.

[0060] III. Test Results

[0061] 1. Phenotypic observation

[0062] The experimental results showed that Zineb treatment caused abnormalities in the notochord development and somitosis differentiation of zebrafish, resulting in a significant spiral curling of the notochord, similar to the phenotype of 100 μM U0126 treatment. Furthermore, at the same concentration, the Zineb treatment group was more effective than the U0126 treatment group. Figure 1 This indicates that Zineb can induce notochord malformations in zebrafish more efficiently. Furthermore, co-treatment with Zineb and the p-ERK1 / 2 agonist Ro 67-7476 revealed the disappearance of spiral notochord malformations in zebrafish, suggesting that Ro 67-7476 can partially restore the phenotypic abnormalities induced by Zineb treatment. Figure 2 ).

[0063] 2. qRT-PCR

[0064] The experimental results showed that Zineb treatment reduced the number of genes related to the MAPK signaling pathway in zebras. MAPK-2 , MAPK-3 , MYC , ELK1 , JUN , RSK The expression levels of all three were significantly downregulated. Figure 3 This indicates that Zineb can act as an inhibitor to suppress the expression of genes related to the MAPK signaling pathway.

[0065] 3. Immunofluorescence staining and Western blot

[0066] Immunofluorescence staining results showed that Zineb treatment reduced the expression level of p-ERK in zebrafish, and the expression level rebounded after co-treatment with Ro67-7476. Figure 4 Western blot results showed that Zineb treatment downregulated p-ERK protein expression in HEK293T cells, and that p-ERK protein expression significantly increased after the addition of Ro 67-7476. This suggests that Zineb has an inhibitory effect on p-ERK in HEK293T cells, and that Ro 67-7476 can reverse the inhibitory effect of Zineb on p-ERK. Figure 5 The above results further demonstrate that Zineb can serve as a highly efficient and specific ERK inhibitor.

[0067] In summary, this invention, by utilizing a zebrafish model, has discovered a new application of Zineb as an inhibitor in the mitogen-activated protein kinase (MAPK / ERK) signaling pathway, aiming to broaden the application field of Zineb and provide a new approach for the preparation of MAPK / ERK inhibitors.

[0068] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0069] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Use of zineb for the preparation of an ERK inhibitor, characterized in that, The molecular formula of the zineb is C4H7N2S4Zn, and the chemical structural formula of the zineb is as follows: ; The inhibitor is used to induce a phenotype of abnormal notochord development in zebrafish embryos and / or to downregulate p-ERK expression levels in mammalian cell models.

2. The use of zineb according to claim 1 for the preparation of an ERK inhibitor, characterized in that, The inhibitor is used to suppress the MAPK / ERK signaling pathway.

3. The use of zineb according to claim 1 for the preparation of an ERK inhibitor, characterized in that, The inhibitor uses zineb as its sole active ingredient.

4. The application of zineb according to claim 1 in the preparation of ERK inhibitors, characterized in that, The working concentration of the zineb is 2 μM to 8 μM.

5. The application of zineb according to claim 1 in the preparation of ERK inhibitors, characterized in that, The inhibitors also include pharmaceutically acceptable excipients.

6. The application of zineb according to claim 5 in the preparation of ERK inhibitors, characterized in that, The excipients are DMSO or PBS.

7. The application of zineb according to claim 1 in the preparation of ERK inhibitors, characterized in that, The notochord developmental abnormalities or downregulation of cellular p-ERK expression levels induced by the aforementioned inhibitors can be reversed by the p-ERK1 / 2 specific agonist Ro 67-7476.