A SNP molecular marker tightly linked to the oil content gene BnA05.OC of Brassica napus and its application

Abstract

The present invention belongs to the field of biotechnology, and discloses a SNP molecular marker tightly linked to the oil content gene BnA05.OC of Brassica napus and its application. The SNP site of the SNP molecular marker is located on the A05 chromosome of the oil content gene BnA05.OC, and is used for the accurate identification of the mutant type of the oil content gene BnA05.OC. This marker has high typing quality, single copy, high polymorphism, and a sample data detection rate of >98%. It can be used for marker-assisted breeding for breeding improvement of the oil content of Brassica napus, and has wide application universality. Also disclosed are KASP marker primers and kits for the above-mentioned SNP molecular markers and the application of identifying the oil content gene BnA05.OC of Brassica napus. The method is simple, the degree of automation is high, the detection throughput is high, the speed is fast, the detection results are accurate, and the repeatability and stability are good.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a SNP molecular marker tightly linked to a Brassica napus oil content gene BnA05.OC, a KASP marker primer, a kit and applications thereof. Background Art

[0002] Brassica napus is the world's third largest source of vegetable oil, accounting for about 13% of global edible oil production. According to statistics, a 1% increase in rapeseed oil content is equivalent to a 2.3-2.5 percentage point increase in rapeseed production. The rapeseed planting area in the main production areas of the Yangtze River Basin accounts for 90% of my country's total rapeseed production area, and the oil content of rapeseed in the main production areas of the Yangtze River Basin is 41%-42%.

[0003] Rapeseed oil content is one of the most important traits of rapeseed. The analysis of the genetic mechanism of seed oil content is of great significance for the selection and breeding of high-oil content varieties and meeting the growing demand for edible oil in my country. Improving oil content is one of the key measures to increase oil yield per unit area, and high-oil breeding is one of the main goals of rapeseed breeding in my country.

[0004] In order to reveal the molecular biological mechanism of rapeseed's control of oil content and disease resistance, and to explore, develop and utilize its important agricultural and ornamental value, the functional linkage SNP marker of the oil content gene BnA05.OC based on KASP technology was developed. It can be used as an efficient identification marker to support high-throughput, low-cost and high-precision identification of functional genes in the rapeseed breeding process, thereby accelerating the breeding selection of rapeseed, which is of great significance in this technical field. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology, and provide a SNP molecular marker, KASP marker primer, kit and application thereof that are tightly linked to the oil content gene BnA05.OC of Brassica napus, which can quickly, high-throughput and low-cost identify the genetic mutant type of the oil content gene BnA05.OC.

[0006] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0007] A SNP molecular marker tightly linked to the oil content gene BnA05.OC of Brassica napus. Taking the Darmor-bzh genome version of Brassica napus as a reference, the SNP molecular marker has a polymorphism at the 20253713th base on the A05 chromosome of Brassica napus, and the polymorphism is A or G.

[0008] The above-mentioned application is preferably used for identifying the oil content phenotype of Brassica napus; when the 20253713th base on the A05 chromosome of the Brassica napus is identified as homozygous A, the oil content phenotype of the Brassica napus is low oil content; when the 20253713th base on the A05 chromosome of the Brassica napus is identified as homozygous G or A / G, the oil content phenotype of the Brassica napus is high oil content.

[0009] Preferably, the nucleotide sequence of the KASP marker primer used to identify the oil content phenotype of Brassica napus is as follows from the 5' end to the 3' end:

[0010] Specific primer X: AAGTTCAACGAGTACCTCCCTTGT (as shown in SEQ ID NO: 1);

[0011] Specific primer Y: GTTCAACGAGTACCTCCCTTGC (as shown in SEQ ID NO: 2);

[0012] Universal primer C: GCTCAGCTGGTGCACGTAAC (as shown in SEQ ID NO: 3).

[0013] Preferably, the application method comprises the following steps:

[0014] (1) extracting total DNA of Brassica napus samples to be tested;

[0015] (2) using the DNA extracted in step (1) as a template, performing PCR amplification using the KASP labeled primers, and then performing fluorescence signal scanning and genotyping; if only the fluorescence of the specific primer X is detected in the sample, the genotype of the sample is homozygous allele X; if only the fluorescence of the specific primer Y is detected, the genotype of the sample is homozygous allele Y; if the fluorescence of both the specific primers X and Y is detected, the genotype of the sample is heterozygous;

[0016] (3) Data analysis was performed based on the genotyping results to obtain the oil content gene BnA05.OC typing of the Brassica napus sample to be tested.

[0017] Preferably, the method is performed using a Douglas Array Tape platform; the PCR amplification system includes: 100 μM universal primer C, 100 μM specific primer X, 100 μM specific primer Y, 2×KASP Master Mix, DNA of a Brassica napus sample to be tested, and ultrapure water.

[0018] Preferably, SOELLEX is used for PCR amplification, and the amplification conditions are as follows: 94°C for 15 minutes; 94°C for 20 seconds, 65°C-57°C for 60 seconds, 10 cycles; 94°C for 20 seconds, 57°C for 60 seconds, 33 cycles.

[0019] Based on a general inventive concept, the present invention also provides a KASP marker primer for identifying the oil content gene BnA05.OC of Brassica napus. The nucleotide sequence of the KASP marker primer from the 5' end to the 3' end is as follows:

[0020] Specific primer X: AAGTTCAACGAGTACCTCCCTTGT (as shown in SEQ ID NO: 1);

[0021] Specific primer Y: GTTCAACGAGTACCTCCCTTGC (as shown in SEQ ID NO: 2);

[0022] Universal primer C: GCTCAGCTGGTGCACGTAAC (as shown in SEQ ID NO: 3).

[0023] Based on a general inventive concept, the present invention also provides a kit for identifying the oil content gene BnA05.OC of Brassica napus, comprising the above-mentioned KASP marker primers.

[0024] In the above-mentioned kit, preferably, the concentration ratio of the specific primer X, the specific primer Y and the universal primer C in the PCR reaction system is 10-12:10-12:25-30.

[0025] Preferably, the kit further comprises 2×KASP Master Mix and ultrapure water.

[0026] Based on a general inventive concept, the present invention also provides an application of the KASP marker primer or the kit in identifying the oil content gene BnA05.OC of Brassica napus.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] (1) The present invention screens out a SNP molecular marker tightly linked to the oil content gene BnA05.OC of Brassica napus and its KASP marker primer set and kit for accurate identification of the mutant type of the oil content gene BnA05.OC. This marker has high typing quality, single copy, and high polymorphism (the PIC value in the existing Brassica napus resources is higher than> 0.3), and the sample data detection rate is> 98%. It can be used for marker-assisted breeding for oil content breeding improvement of Brassica napus, and has wide application universality.

[0029] (2) The present invention also provides an application method of the above-mentioned KASP marker primers and kit for identifying the oil content gene BnA05.OC of Brassica napus. The detection method is simple and has a degree of automation of up to 90%; the detection throughput is high and the speed is fast (122,880 data points can be obtained in 8 hours, which is 10 times that of the traditional 96-well plate SNP genotyping method); the amount of detection counter-reagent used is small (only 0.8uL / reaction), and the cost of reagents and consumables is low (compared with the traditional 96-well plate SNP genotyping method, the cost of reagents and consumables is reduced by 70%-90%); the detection results are accurate, reproducible and stable, and the data results of different testing laboratories can be compared and verified with each other, and the data have universal comparability; the present invention provides a rapid, efficient, low-cost, and accurate universal detection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 It is a schematic diagram of genotyping of the SNP molecular markers in the embodiment of the present invention in rapeseed diversity materials. DETAILED DESCRIPTION

[0032] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0033] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0034] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0035] Example:

[0036] The present invention develops a SNP molecular marker that is tightly linked to the oil content gene BnA05.OC of Brassica napus. This molecular marker is developed and verified by extracting gene sequences and comparing alleles of the gene interval of the Brassica napus oil content gene BnA05.OC to obtain high-quality sites, and is tightly linked to the oil content gene BnA05.OC, and can quickly select whether the breeding material contains the oil content gene BnA05.OC according to the genotype.

[0037] Compared with the existing technology of breeding, the selection of plant height phenotype of Brassica napus requires height measurement after field planting and oil content to obtain phenotypic data. The SNP markers developed in the present invention can be directly detected and typed, which greatly improves the selection efficiency of breeding. The SNP marker detection used in the present invention is based on the KASP (Kompetitive Allele Specific PCR, competitive allele-specific PCR) detection technology of the Douglas Array Tape platform. The detection method is simple, highly automated, high-throughput, fast, low-reagent consumption, and low-detection cost. It can be widely promoted and used in breeding selection. The specific research and development process is as follows:

[0038] 1. Construction of the core germplasm resource database of Brassica napus

[0039] The Brassica napus germplasm resource database was constructed by selecting 90 core rapeseed germplasm resources resequencing data based on the classification of spring rapeseed, semi-winter rapeseed and winter rapeseed.

[0040] 2. Information mining of cloned oil content gene BnA05.OC

[0041] Through a large number of literature searches, it was determined that the oil content gene BnA05.OC was located on the A05 chromosome of Brassica napus, with the gene symbol BnaA05g28570, and the reference genome version of Brassica napus was Darmor-bzh.

[0042] 3. Extraction of SNP loci and sequence acquisition in Brassica napus

[0043] The data of 90 core germplasm resources were used to extract the sequence of gene BnaA05g28570, and the gene sequence was subjected to SNP polymorphism analysis. Finally, three SNP sites were obtained (bases 20253713, 20253749, and 20252022 on chromosome A05 of Brassica napus). The SNP sites were extracted and about 100bp of their flanking sequences were obtained.

[0044] 4. Label design and synthesis

[0045] For the SNP sites obtained above, based on the reference genome Darmor-bzh of Brassica napus, the online primer design website BatchPrimer3 (http: / / probes.pw.usda.gov / batchprimer3 / ) was used to design KASP primer markers. There are three primers, two of which are connected to the FAM and HEX fluorescent sequences at the 5' end. After the design is completed, the primer sequence is further analyzed for the whole genome copy number, and finally a high-quality single copy KASP marker site is obtained, and the information is as follows Table 1:

[0046] Table 1: Site information and primer sequences of KASP markers of oil content gene BnA05.OC (sequences from left to right are shown in SEQ ID NO: 1-3)

[0047]

[0048]

[0049] 5. Detection and verification of labels

[0050] In order to verify the quality of marker typing and the consistency of the genotype of the marker and sample phenotype, the varieties that have been promoted in the market in the past three years from 2021 to 2023 were collected and verified with samples of the varieties, including the following steps:

[0051] (1) Extract the total DNA of the Brassica napus sample to be tested.

[0052] (2) Using the DNA extracted in step (1) as a template, PCR amplification was performed using the KASP marker primers, and after the PCR reaction was completed, the reaction system fluorescence signal was scanned using ARAYA; then genotyping and data analysis were performed using INTELLICS; in the KASP marker genotyping test, the genotype of the sample was divided into three clusters, namely, cluster X, cluster Y, and heterozygous genotype cluster; wherein cluster X indicated that the sample contained a homozygous X allele at this KASP marker site (marked in red in the genotyping diagram, located in the upper left corner of the diagram), cluster Y indicated that the sample contained a homozygous Y allele at this KASP marker site (marked in blue in the genotyping diagram, located in the lower right corner of the diagram), and heterozygous genotype cluster indicated that the sample contained a heterozygous X and Y allele at this KASP marker site (marked in purple in the genotyping diagram);

[0053] The validation and detection of KASP markers were performed using the Douglas Scientific Array Tape system. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for fluorescence signal scanning, and INTELLICS for data analysis.

[0054] PCR amplification system: NEXAR was used to automatically assemble the PCR amplification system, which is shown in Table 2 below.

[0055] Table 2: PCR amplification system for KASP marker genotyping

[0056]

[0057]

[0058] PCR amplification: PCR was performed using SOELLEX, and the amplification conditions were as follows: 94°C for 15 min; 94°C for 20 sec, 65°C-57°C (annealing temperature decreased by 0.8°C each cycle) for 60 sec, 10 cycles; 94°C for 20 sec, 57°C for 60 sec, 33 cycles.

[0059] Advantages of KASP marker detection based on Douglas Array Tape platform: The automation degree of KASP marker based on Douglas Array Tape platform is 90%, which greatly reduces the manpower and human errors in the laboratory. The detection throughput is high, and 122,880 data points can be obtained in 8 hours, which is 10 times that of the traditional 96-well plate SNP genotyping method. The detection reaction volume is low (only 0.8uL / reaction), and the cost of reagents and consumables is reduced by 70%-90% compared with the traditional 96-well plate SNP genotyping method.

[0060] (3) Data analysis was performed based on the KASP marker typing results and phenotypic results to select the optimal loci for subsequent applications.

[0061] According to the results of the marker test (see Figure 1 ), the typing of the three KASP markers was good and compact, and the detection rate was higher than 98%, but the detection typing diagrams of KASP markers BN900107 and BN900108 had no polymorphism, and the gene mutation type could not be distinguished, and they could not be used for genotype detection; marker BN900106 had good typing and accurately detected the plant height gene of Brassica napus.

[0062] From the corresponding results of the phenotypic data and genotypic data of the material (see Table 3), when the genotype of the BN900106 marker is A, the phenotype of the material is low oil content, and when the genotype is G or A / G, the phenotype of the material is high oil content. The corresponding relationship between the phenotype and the genotype is highly consistent, and the genotype can be accurately used to identify whether the material contains the BnA05.OC gene.

[0063] Table 3 Statistics of phenotypic and genotypic data of varieties

[0064]

[0065]

Claims

1. A KASP marker primer for identifying the oil content phenotype of Brassica napus, characterized in that: The nucleotide sequence of the KASP labeled primer from 5' to 3' is as follows: Specific primer X: AAGTTCAACGAGTACCTCCCTTGT; Specific primer Y: GTTCAACGAGTACCTCCCTTGC; Universal primer C: GCTCAGCTGGTGCACGTAAC.

2. A kit for identifying the oil content phenotype of Brassica napus, characterized in that: Comprising the KASP labeling primer as claimed in claim 1.

3. The kit according to claim 2, characterized in that The concentration ratio of the specific primer X, the specific primer Y and the universal primer C in the PCR reaction system is 10-12: 10-12: 25-30.

4. The kit according to claim 2, characterized in that The kit also contains 2×KASP MasterMix and ultrapure water.

5. Use of the KASP marker primer according to claim 1 or the kit according to any one of claims 2 to 4 in identifying the oil content phenotype of Brassica napus, characterized in that: When the genotype is identified as homozygous A, the oil content phenotype of the Brassica napus is low oil content; when the genotype is identified as homozygous G or A / G, the oil content phenotype of the Brassica napus is high oil content.

6. The use according to claim 5, characterized in that: The method of application comprises the following steps: (1) Extracting total DNA from Brassica napus samples; (2) Using the DNA extracted in step (1) as a template, PCR amplification is performed using the KASP labeled primers, and then fluorescence signal scanning and genotyping are performed; if only the fluorescence of specific primer X is detected in the sample, the genotype of the sample is homozygous allele X; if only the fluorescence of specific primer Y is detected, the genotype of the sample is homozygous allele Y; if the fluorescence of specific primers X and Y is detected at the same time, the genotype of the sample is heterozygous; (3) Perform data analysis based on the genotyping results to obtain the oil content phenotype of the Brassica napus sample to be tested.

7. The use according to claim 6, characterized in that The steps are performed using the Douglas Array Tape platform; The PCR amplification system includes: 100 μM universal primer C, 100 μM specific primer X, 100 μM specific primer Y, 2×KASP Master Mix, DNA of the Brassica napus sample to be tested, and ultrapure water.

Images