Compositions comprising nucleic acid oligomers

Abstract

This invention provides a stable composition comprising a nucleic acid oligomer having a thiophosphate bond, a method for manufacturing the same, and an efficient method for manufacturing the aforementioned nucleic acid oligomer from the composition. The stable composition comprises a nucleic acid oligomer having a thiophosphate bond as shown in formula (1) (where the designations are the same as defined in the specification), an alkylammonium salt, a nitrile organic solvent, water, and an additive, wherein the additive comprises at least one compound selected from the group consisting of compounds represented by formulas (3a) to (3h).

Description

Technical Field

[0001] This invention relates to compositions comprising nucleic acid oligomers. More specifically, this invention relates to compositions comprising nucleic acid oligomers containing phosphate thioesters. Background Technology

[0002] In recent years, interest in the application of nucleic acid oligomers in the medical field has been growing. Examples include antisense nucleic acids, aptamers, ribozymes, and siRNAs, which induce RNA interference (RNAi) and are collectively known as nucleic acid drugs.

[0003] Nucleic acid oligomers are known to be synthesized using solid-phase synthesis, and nucleic acid oligomers with thiophosphate bonds are also known as useful compounds synthesized by solid-phase synthesis (Patent Document 1).

[0004] Existing technical documents

[0005] Patent documents

[0006] Patent Document 1: International Publication No. 2017 / 068377 Summary of the Invention

[0007] The problem that the invention aims to solve

[0008] The stability of nucleic acid oligomers containing thiophosphate bonds can sometimes be problematic during their manufacturing process. The object of this invention is to provide stable compositions comprising nucleic acid oligomers containing thiophosphate bonds, methods for manufacturing the same, and efficient methods for manufacturing the aforementioned nucleic acid oligomers from the compositions.

[0009] Methods for solving problems

[0010] The inventors of this application conducted repeated and careful research to achieve the above-mentioned objectives, and discovered that a composition obtained by mixing a nucleic acid oligomer with an alkylammonium salt, a nitrile organic solvent, water, and certain additives can be stabilized. The nucleic acid oligomer is obtained by reverse-phase chromatography treatment of a crude product of a nucleic acid oligomer containing thiophosphate bonds, generated using the phosphorous acid method in solid-phase synthesis. Therefore, this invention provides the composition, a method for manufacturing the composition, and an efficient method for manufacturing nucleic acid oligomers from the composition.

[0011] This invention includes, but is not limited to, the following methods.

[0012] 1. A composition, characterized in that it comprises a nucleic acid oligomer having a thiophosphate bond as shown in formula (1), an alkylammonium salt, a nitrile organic solvent, water, and additives.

[0013]

[0014] (in the formula,

[0015] B C Each independently represents the same or different nucleic acid bases.

[0016] R can be the same or different from each other, each independently representing a hydrogen atom, a fluorine atom, or an OQ group.

[0017] Q can be the same or different from each other, each independently representing a hydrogen atom, methyl, 2-methoxyethyl, methylene bonded to the carbon atom at the 4' position of ribose, ethylene bonded to the carbon atom at the 4' position of ribose, or ethimide bonded to the carbon atom at the 4' position of ribose.

[0018] X may be the same or different from each other, each independently representing an oxygen atom or a sulfur atom (where at least one X represents a sulfur atom).

[0019] Y represents a protecting group for a hydrogen atom or a hydroxyl group.

[0020] G represents ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion, or hydroxyalkylammonium ion, and,

[0021] n is an integer that satisfies equation (2).

[0022] 15≤n (2).

[0023] The additive is an additive comprising at least one compound selected from the group consisting of compounds represented by the following formulas (3a) to (3h).

[0024] Equation (3a): P(L 1 )3,

[0025] Equation (3b): P(OL) 1 )3,

[0026] Equation (3c): P(L) 1 )2(OL 1 ),

[0027] Equation (3d): PL(OL) 1 )2,

[0028] Formula (3e): PH(O)(OL) 1 )2,

[0029] Formula (3f): PH(O)L 1 (OL 1 ),

[0030] Formula (3g): (P(L) 1 )2)2-L 2 ,

[0031] Formula (3h):

[0032]

[0033] In the various equations (3a) to (3h), L 1 The same or different from each other, each independently representing a C6-10 aryl or C1-6 alkyl group that can be substituted with 1 to 3 substituents selected from the group consisting of C1-6 alkyl and C1-6 alkoxy groups.

[0034] L 2 The same or different from each other, each independently representing a C6-14 arylene or C1-6 alkylene group selected from the group consisting of C1-6 alkyl and C1-6 alkoxy groups, substituted with 1 to 3 substituents, and,

[0035] L 3 This refers to a C6-14 aryl group that can be substituted with 1 to 3 substituents selected from the group consisting of C1-6 alkyl and C1-6 alkoxy groups.

[0036] 2. The composition as described in paragraph 1 above, wherein the additive is at least one compound selected from the group consisting of triphenylphosphine, diethyl phosphite, triethyl phosphite, diethoxyphenylphosphine, ethoxydiphenylphosphine, and 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide.

[0037] 3. The composition as described in any one of paragraphs 1 to 2 above, wherein the aforementioned alkylammonium salt is at least one alkylammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts.

[0038] 4. The composition as described in any one of paragraphs 1 to 3 above, wherein the aforementioned nitrile organic solvent is acetonitrile.

[0039] 5. The composition as described in any one of the preceding items 1 to 4, wherein in the aforementioned formula (1), R is each independently a hydroxyl or methoxy group.

[0040] 6. A method for manufacturing nucleic acid oligomers, comprising mixing the composition described in any one of the preceding items 1 to 5 with at least one solvent selected from the group consisting of C1-4 alcohols, tetrahydrofuran and dioxane, and separating the precipitated nucleic acid oligomers.

[0041] 7. A method for manufacturing the composition of any one of the preceding items 1 to 5, comprising mixing an additive with a column eluent containing the nucleic acid oligomer of formula (1), an alkylammonium salt, a water-soluble organic solvent, and water, obtained by reverse-phase column chromatography of a crude product of a nucleic acid oligomer of formula (1) synthesized by solid-phase synthesis.

[0042] Invention Effects

[0043] This invention provides a stable composition comprising a nucleic acid oligomer having a thiophosphate bond, and an efficient method for manufacturing the aforementioned nucleic acid oligomer using the composition. Attached Figure Description

[0044] [ Figure 1 ] Figure 1 A diagram illustrating an example of synthesizing nucleic acid oligomers using the phosphoramide method. Detailed Implementation

[0045] The composition is described in that it comprises a nucleic acid oligomer having a thiophosphate bond as shown in formula (1), an alkylammonium salt, a nitrile organic solvent, water, and an additive, wherein the additive is at least one compound selected from the group consisting of compounds having a disulfide bond and compounds having a thioether bond.

[0046] In the aforementioned equation (1), B C The nucleic acid base represented (hereinafter also referred to as "base") can be a natural or non-natural nucleic acid base. Examples of modified analogs of natural or non-natural nucleic acid bases can be shown as non-natural nucleic acid bases. Typical examples of nucleic acid bases include purine and pyrimidine compounds, such as those disclosed in U.S. Patent No. 3,687,808, "Concise Encyclopedia Of Polymer Science and Engineering," pp. 858-859, edited by Kroschwitz JI, John Wiley & Sons, 1990, and Englisch et al., Angewandte Chemie, International Edition, 1991, Vol. 30, p. 613.

[0047] Specifically, examples include purine bases such as adenine, isoguanine, xanthine, hypoxanthine, and guanine; and pyrimidine bases such as cytosine, uracil, and thymine.

[0048] In addition, as B CThe nucleic acid bases represented may include, for example, amino derivatives such as 2-aminoadenine, 2-aminopurine, and 2,6-diaminopurine; alkyl derivatives such as 5-methyluracil, 5-methylcytosine, 7-methylguanine, 6-methylpurine, and 2-propylpurine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6-azauracil, 6-azacytosine, and 6- Azathymine; 5-uracil (pseudouracil), 4-thiouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil; 8-halogenated, amination-modified, thiolated, thioalkylated, hydroxylated and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 6-azapyrimidine; N-2, N-6 and O-6 substituted purines (including 2-aminopropyladenine); dihydrouracil Pyridine; 3-Deazo-5-azacytosine; 7-Deazoadenine; N6-methyladenine, N6,N6-dimethyladenine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazoles; 2-hydroxypyridine; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 2-thiouracil, 5-methyl 2-Thiouracil; 5-methoxycarbonylmethyl-2-thiouracil; 5-methylaminomethyl-2-thiouracil; 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; O-alkylated bases, etc.

[0049] When R represents an OQ group and Q represents a methylene group bonded to a carbon atom at the 4' position of the ribose, an ethyl group bonded to a carbon atom at the 4' position of the ribose, or an ethimide group bonded to a carbon atom at the 4' position of the ribose, the structure is represented by the structures LNA-1, LNA-2, and LNA-3 shown in formula (3) below.

[0050]

[0051] (where B is in the formula) c This represents the same nucleic acid bases as described above.

[0052] As a protecting group for the hydroxyl group represented by Y, it can be used without particular limitation as long as it can function as a protecting group in the amide process. For example, known protecting groups used for amide compounds can be widely used. The protecting group for the hydroxyl group represented by Y is preferably the following group.

[0053]

[0054] (where R is in the formula)1 R 2 and R 3 They may be the same or different from each other, each independently representing hydrogen or alkoxy groups.

[0055] As an example of the aforementioned alkoxy group, a methoxy group may be cited.

[0056] The chain length of the nucleic acid oligomer of formula (1) is n≥15. As an upper limit for the chain length, n≤200 can be exemplified, for example. In the aforementioned nucleic acid oligomer, at least one of the n X atoms is a sulfur atom, or all X atoms can be sulfur atoms. For example, in the case of n=103, the number of sulfur atoms can be exemplified as 6, 12 or 20.

[0057] The nucleic acid oligomers of formula (1) can be, for example, DNA or RNA oligomers, or oligomers containing non-natural nucleic acid bases. The aforementioned nucleic acid oligomers are typically single-stranded DNA or RNA oligomers. In the aforementioned nucleic acid oligomers of formula (1), the substituent R is preferably independently hydroxyl or methoxy. As the aforementioned nucleic acid oligomers, RNA as a nucleic acid oligomer of formula (1) (with each substituent R independently being hydroxyl or methoxy) is preferred. More specifically, nucleic acid oligomers comprising both nucleotides with hydroxyl substituent R and nucleotides with methoxy substituent R are preferred.

[0058] The concentration of the nucleic acid oligomer in the aforementioned composition is typically 0.05 mg / mL to 5 mg / mL, preferably 0.05 mg / mL to 1 mg / mL, and more preferably 0.1 mg / mL to 0.5 mg / mL.

[0059] As the aforementioned alkylammonium salts, monoalkylammonium salts, dialkylammonium salts, and trialkylammonium salts are commonly used, with monoalkylammonium salts and dialkylammonium salts being preferred, and dialkylammonium salts being more preferred. The monoalkylamine forming the monoalkylammonium salt preferably has 3 to 10 carbon atoms, more preferably 4 to 6, and even more preferably hexylamine. The dialkylamine forming the dialkylammonium salt preferably has 4 to 10 carbon atoms, more preferably 5 to 9. A preferred dialkylamine is di-n-butylamine. The trialkylamine forming the trialkylammonium salt preferably has 6 to 12 carbon atoms, more preferably 6 to 9, and triethylamine is a specific example.

[0060] Examples of acids that form the aforementioned monoalkylammonium salts, dialkylammonium salts, and trialkylammonium salts include carbonic acid, acetic acid, formic acid, trifluoroacetic acid, and propionic acid.

[0061] The concentration of the aforementioned ammonium salt is typically 1–200 mM, preferably 5–150 mM, and more preferably 20–100 mM.

[0062] Acetonitrile is an example of the aforementioned nitrile organic solvent. The amount of nitrile organic solvent in the aforementioned composition is typically 10-70% relative to the total mass of the composition, preferably 20-60%, and more preferably 30-50% (all percentages are by mass).

[0063] The aforementioned composition may further comprise an alcohol-based organic solvent. Examples of alcohol-based organic solvents include C1-4 alcohols, preferably C1-3 alcohols, more preferably C1-2 alcohols, and even more preferably methanol. The amount of alcohol-based organic solvent in the aforementioned composition is typically 0-20% relative to the total mass of the composition, preferably 0-15%, more preferably 0%-10% (all percentages represent mass %).

[0064] The amount of water is sufficient to achieve a balance by satisfying the concentration range of the aforementioned components, and is typically 90% to 30% of the total mass of the composition, preferably 80% to 40%, and more preferably 70% to 40% (all percentages represent mass %).

[0065] At least one compound selected from the group consisting of compounds represented by the aforementioned formulas (3a) to (3h) will be described.

[0066] As L 1 The C1-6 alkyl group, which may be substituted with 1 to 3 substituents selected from the group consisting of C1-6 alkyl and C1-6 alkoxy groups, can be exemplified by methyl, ethyl, propyl, butyl, pentyl, and hexyl, with C1-4 alkyl being more preferred, and C1-2 alkyl being even more preferred. Examples of C1-6 alkoxy groups include methoxy, ethoxy, propoxy, butoxy, pentyloxy, and hexyloxy. Examples of C6-10 aryl groups include phenyl, 1-naphthyl, and 2-naphthyl, with phenyl being preferred. Examples of C6-10 aryl groups substituted with 1 to 3 substituents selected from the group consisting of C1-6 alkyl and C1-6 alkoxy groups include, for example, tolyl and methoxyphenyl.

[0067] Triphenylphosphine can be exemplified as a specific compound represented by formula (3a).

[0068] As L 1 The C1-6 alkyl group represented may be exemplified by the same group as described above. A specific example of a compound represented by formula (3b) is, for example, triethyl phosphite.

[0069] As a specific example of a compound represented by formula (3c), ethoxydiphenylphosphine may be exemplified, for example.

[0070] As a specific example of a compound represented by formula (3d), diethoxyphenylphosphine can be exemplified, for example.

[0071] As a specific example of a compound represented by formula (3e), diethyl phosphite can be cited as an example.

[0072] As a specific example of a compound represented by formula (3f), ethyl phenylphosphonate can be cited as an example.

[0073] As L 2 The C6-14 arylene group represented by the group consisting of 1 to 3 substituents selected from C1-6 alkyl and C1-6 alkoxy groups can be exemplified by 1,2-phenylene, 1,8-naphthylene and 1,6-biphenylene.

[0074] As L 2 Examples of C1-6 alkylene groups include methylene, ethylene, propylene, butylene, pentylene, and hexylene.

[0075] As L 3 The C6-14 arylene group, which can be substituted with 1 to 3 substituents selected from the group consisting of C1-6 alkyl and C1-6 alkoxy groups, can be exemplified in relation to the aforementioned L. 2 The exemplified arylene is the same as the arylene.

[0076] Specific compounds represented by formula (3g) include, for example, 1,2-bis(diphenylphosphine), 1,8-bis((diphenylphosphine)naphthalene) and 2,2'-bis(diphenylphosphine)biphenyl.

[0077] As a specific example of a compound represented by formula (3h), 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide can be exemplified, for example.

[0078] The concentration of the aforementioned additive is typically 0.1 μM to 100 mM, preferably 1 mM to 10 mM.

[0079] The compositions of the present invention are generally obtained by adding the aforementioned additives to a column eluent obtained by reverse-phase column chromatography of a crude product of a nucleic acid oligomer of formula (1) synthesized by solid-phase synthesis (using a mobile phase containing an alkylammonium salt, a water-soluble organic solvent, and water). Alternatively, the compositions of the present invention can be prepared as elution fractions of reverse-phase column chromatography using a mobile phase pre-containing the aforementioned additives. Here, the aforementioned water-soluble organic solvent refers to an organic solvent containing the aforementioned nitrile-based water-soluble organic solvent and suitably containing hydrophilic organic solvents generally known in the organic field (e.g., the aforementioned alcohol-based organic solvents).

[0080] For the elution fractions obtained using reversed-phase column chromatography, the composition is analyzed by UV absorption at a wavelength of 260 nm under chromatographic conditions typically used for the separation and analysis of nucleic acids, and the fractions are selected and collected. The purified target analyte, i.e., a specified amount of nucleic acid oligomers with phosphate thioester bonds, is obtained from the collected fractions. As an example of the aforementioned analytical method, the method described in non-patent literature (Handbook of Analysis of Oligonucleotides and Related Products, CRCPress) can be used.

[0081] Regarding the packing material for the aforementioned reversed-phase column chromatography, examples of silica or polymers that serve as hydrophobic stationary phases include those immobilized with one or more of the following: phenyl, alkyl groups having 1 to 20 carbon atoms, and cyanopropyl groups. For example, silica or polymers with a particle size of 2 μm or more, or 5 μm or more, are used as the packing material.

[0082] As the mobile phase for reversed-phase column chromatography, for example, the following mobile phases are used: a mobile phase comprising an aqueous solution of an ammonium salt at the concentration and pH as described above, and a mobile phase comprising the aforementioned water-soluble organic solvent, used in a gradient of increasing concentrations. The temperature for reversed-phase column chromatography is typically 20–100°C, preferably 30–80°C, and more preferably 40–70°C. The compositions of the present invention are typically obtained in the form of eluent fractions for reversed-phase column chromatography as described above.

[0083] For the compositions of the present invention, one or more post-processing steps selected from those for separating nucleic acid oligomers, such as reprecipitation, separation, ultrafiltration, deprotection, and freeze-drying, may be applied after the preservation step. During the preservation step, the atmosphere within the preservation container may also be replaced by using an inert gas. Examples of inert gases include nitrogen, argon, and helium.

[0084] In the reprecipitation step, contacting the stabilized solution with a poor solvent allows nucleic acid oligomers to precipitate and separate. If necessary, the precipitated nucleic acid oligomers can be collected and separated by filtration or the like after removing the liquid portion in a solid-liquid separation state. Examples of poor solvents for the reprecipitation step include C1-C4 organic solvents having at least one oxygen atom (e.g., C1-C4 alcohols, tetrahydrofuran, dioxane). Ethanol or isopropanol are preferred as this solvent.

[0085] In the separation process, at least one of the following is mixed into the stabilized solution: an acidic aqueous solution such as acetic acid, water, and saline solution. Then, an organic solvent that is immiscible with water is added to separate the solution into an aqueous layer and an organic layer, thereby obtaining an aqueous layer containing the desired nucleic acid oligomer.

[0086] In the ultrafiltration process, an ultrafiltration membrane can be used to separate nucleic acid oligomers present in the solution after the preservation process from low molecular weight components below the desired molecular weight.

[0087] In cases where the 5' end of a nucleic acid oligomer has a protecting group, in order to deprotect it, an acidic aqueous solution such as acetic acid or a solution made by dissolving an acidic substance such as acetic acid in an organic solvent can be mixed into the solution after the preservation process, thereby deprotecting the protecting group of the nucleic acid oligomer.

[0088] In the freeze-drying process, the water sublimates by reducing the pressure of the aqueous solution of the frozen nucleic acid oligomer, thereby separating the nucleic acid oligomer from the water.

[0089] The synthesis of nucleic acid oligomers using the phosphoramidite method can be performed by carrying out nucleic acid extension reactions according to known methods (e.g., the methods described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Examples of nucleic acid oligomer production using the phosphoramidite method include… Figure 1 The synthesis of RNA via the route shown in the diagram is used as an example to illustrate the method for manufacturing nucleic acid oligomers, referring to the reaction pathways (e.g., condensation reaction, oxidation, deprotection) shown below.

[0090] In the aforementioned chemical formula representing the reaction pathway, B a These are the protected nucleic acid bases, Tr is the protecting base, X is defined as above, and SP represents the portion of the inorganic porous carrier other than the nucleoside structure.

[0091] The inorganic porous carrier with nucleoside structure (Sp-Nu) and the nucleosides constituting the amide monomer (Am-1) have the same nucleic acid bases as those mentioned above or nucleic acid bases protected by protecting groups.

[0092] As a preferred example of an amide monomer (Am-1), in compounds represented by the following chemical formula (Am-1'), where R represents a protected hydroxyl group, specific protecting groups include those protected by tert-butyldimethylsilyl (TBDMS), bis(2-acetoxy)methyl (ACE), (triisopropylsiloxy)methyl (TOM), (2-cyanoethoxy)ethyl (CEE), (2-cyanoethoxy)methyl (CEM), p-toluenesulfonylethoxymethyl (TEM), (2-cyanoethoxy)methoxymethyl (EMM), etc., such as TBDMS amides (TBDMS RNA Amidites, trade name, ChemGenesCorporation), ACE amides, TOM amides, CEE amides, CEM amides, and TEM amides (Chakhmakhcheva). Chemistry, 2013, Vol.39, No.1, pp.1-21.), EMM amide (described in International Publication No. 2013 / 027843), etc.

[0093]

[0094] (In the formula, R represents the same group as described above, B...) a This indicates the nucleic acid bases that can be protected.

[0095] [Solid-phase synthesis of RNA]

[0096] The Tr group of an inorganic porous support (Sp-Nu) is deprotected to obtain a solid support (Am-2). Then, an amide monomer (Am-1) and the solid support (Am-2) undergo a condensation reaction to obtain a reaction product (Am-3). The reaction product (Am-3) is then oxidized to obtain a product (Am-4). The product (Am-4) is then deprotected (-Tr) to obtain a product (Am-5). Next, the amide monomer (Am-1) and the product (Am-5) undergo a further condensation reaction to extend the phosphodiester bond. Thus, a necessary series of deprotection, condensation, and oxidation reactions are repeated at the 5' hydroxyl group at the end of the extended oligonucleotide chain to achieve the desired sequence. The resulting molecule is then cleaved from the solid support, thereby producing a nucleic acid molecule with the desired sequence. This synthesis can also be performed using an automated nucleic acid synthesis apparatus employing the phosphoramidite method. RNA is used as an example here, but it can also be applied to nucleic acid compounds containing nucleotides other than ribonucleotides.

[0097] In the deprotection process of the Tr group, the protecting group at the 5' position of the hydroxyl group at the end of the RNA strand supported on the solid-phase support is deprotected. Triphenylmethyl-based protecting groups are used as the protecting group (typically 4,4'-dimethoxytriphenylmethyl (DMTr)). Deprotection can be performed using an acid. Examples of acids used for deprotection include trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0098] In the condensation process, the 5' hydroxyl group at the end of the RNA strand, which has undergone the aforementioned deprotection process, is bonded to a nucleoside phosphoramide to generate a phosphite. The aforementioned nucleoside phosphoramide is a nucleoside phosphoramide whose 5' hydroxyl group is protected by a protecting group (e.g., a DMTr group).

[0099] Furthermore, the condensation process can be carried out using an activator that activates the aforementioned nucleoside phosphoramidide. Examples of activators include 5-benzylthio-1H-tetrazazole (BTT), 1H-tetrazazole, 4,5-dicyanimidazazole (DCI), 5-ethylthio-1H-tetrazazole (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PhIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazazole (Activator-42).

[0100] After the condensation step, the unreacted 5' hydroxyl group can also be capped. Known capping solutions such as acetic anhydride-tetrahydrofuran solution and phenoxyacetic anhydride / N-methylimidazole solution can be used for this purpose.

[0101] The oxidation process is a process of oxidizing the phosphite formed by the aforementioned condensation process. The oxidation process can be carried out using an oxidizing agent. Examples of oxidizing agents include iodine, m-chloroperoxybenzoic acid, tert-butyl hydroperoxide, 2-butanone peroxide, bis(trimethylsilyl)peroxide, 1,1-dihydroperoxycyclododecane, and hydrogen peroxide.

[0102] In the case of converting the phosphite triester group to the thiophosphate triester group, the "oxidizing agent" can be, for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazolin-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazolin-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazolin-3-thione (DDTT), and phenylacetyl disulfide (PADS). This oxidizing agent can be used by dilution with a suitable solvent to a concentration of 0.001 to 2 M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction; examples include dichloromethane, acetonitrile, pyridine, or mixtures of two or more of these in any proportion.

[0103] The oxidation process can be performed after the aforementioned capping operation, or conversely, the capping operation can be performed after the oxidation process; the order is not limited.

[0104] By returning to the deprotection step after the oxidation step and repeating the above series of steps of condensation reaction, oxidation, and deprotection according to the nucleotide sequence of the nucleic acid oligomer to be synthesized, RNA with the desired sequence can be synthesized.

[0105] After the synthesis of nucleic acid oligomers with the desired sequence is completed, the RNA strand is cleaved and recovered from the solid-phase support using an ammonia or amine compound.

[0106] Examples of amine compounds mentioned here include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and triethylamine.

[0107] The resulting nucleic acid oligomers can be exemplified by chain lengths of n ≥ 60, n ≥ 80, or n ≥ 100, and n ≤ 200. Preferably, n ≥ 60. Specifically, for example, n = 67, 100, or 120.

[0108] The deprotection process for the phosphate protecting group involves using an amine compound after the synthesis of the nucleic acid having the desired sequence to deprotect the phosphate moiety. Examples of amine compounds include, for instance, diethylamine, as described above.

[0109] In the case of a protecting group having a hydroxyl group at the 2' or 3' position of the ribose, it can be removed by the methods described in International Publication No. 2006 / 022323, International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571.

[0110] Example

[0111] The present invention will be further described in detail below with reference to embodiments, but the present invention is not limited thereto.

[0112] Determination methods

[0113] The measurement methods used in the following experiments are shown below.

[0114] (Method 1: Method for determining the purity of RNA)

[0115] The purity of RNA in the separated solution was determined by HPLC. The HPLC method (wavelength 260 nm, DNAPac column) was used. TM The RNA was separated into its constituent components using a PA200 (4.0 mm × 250 mm, 8.0 μm) microscope. The purity of the RNA was calculated from the peak area of ​​the main product in the total peak area of ​​the obtained chromatogram. The HPLC determination conditions are shown in Table 1 below.

[0116] [Table 1]

[0117]

[0118] Reference Example 1

[0119] 1. Solid-phase synthesis of RNA based on amide method

[0120] Synthesize RNA having the nucleic acid sequence of chain I shown below. This chain consists of 103 bases in length.

[0121] Chain I: A*U*A*ACUCAAUUUGUAAAAAAGUUUUAGAGCUAG AAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCUUUU*U*U*U(5'-3')(Serial Number 1)

[0122] In the aforementioned sequence annotations, the asterisk (*) between nucleotides indicates that the phosphate bond connecting the nucleotides is a thiophosphate ester.

[0123] The RNA was synthesized from the 3' to the 5' side using a nucleic acid synthesizer (AKTA oligopilot plus 100 GE Healthcare) based on the phosphoramide method. The synthesis was carried out at a scale of 63 μmol. In addition, the following reagents were used for this synthesis: uridine EMMamide (described in Example 2 of International Publication No. 2013 / 027843), cytidine EMMamide (described in Example 3 of International Publication No. 2013 / 027843), adenosine EMMamide (described in Example 4 of International Publication No. 2013 / 027843), and guanosine EMMamide (described in Example 5 of International Publication No. 2013 / 027843) were used as RNA amides, respectively. Porous glass was used as the solid-phase support, dichloroacetic acid toluene solution was used as the deprotection solution, 5-benzylthio-1H-tetrazole was used as the condensing agent, iodine solution was used as the oxidizing agent, 3-amino-1,2,4-dithiazol-5-thione was used as the sulfiding agent, and phenoxyacetic anhydride solution and N-methylimidazole solution were used as the capping solution. After nucleic acid extension, the cyanoethyl protecting group of the phosphate moiety was selectively deprotected by acting a diethylamine solution on the nucleic acid on the support. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl.

[0124]

[0125] The excision and deprotection of the solid-phase support after solid-phase synthesis were performed according to the method described in International Publication No. 2013 / 027843. Specifically, an aqueous ammonia solution and ethanol were added, and after standing for a period of time, the solid-phase support was filtered, and the solvent was removed by distillation. Then, the hydroxyl groups were deprotected using tetrabutylammonium fluoride. The obtained RNA was dissolved in distilled water for injection to achieve the desired concentration.

[0126] 2. RNA separation and purification

[0127] Column chromatography purification was performed under the conditions specified in Table 2 below. Before purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, followed by the addition of the sample. The solution was separated at a retention time of 94.2-95.8 minutes and analyzed by HPLC. It should be noted that the purity was calculated using the method described in Method 1 above. The result was a purity of 87.7%. The purified RNA solution was used to perform experiments in the following examples and comparative examples.

[0128] [Table 2]

[0129]

[0130] Example 1

[0131] 99 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 1 was placed in a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). 1 μL of a triphenylphosphine acetonitrile solution was mixed as an additive solution to prepare a sample of the specified concentration. The tubular bottle containing the mixed solution was placed in a temperature-controlled incubator (Kenis Scientific) at 60 °C and allowed to stand for 8 hours. After standing, the headspace vial was cooled to room temperature, and the purity was calculated using the method described in Method 1 above. The results are shown in Table 3.

[0132] Based on calculations, the composition prepared with triphenylphosphine at a concentration of 3 mM (0.09%) has the following composition: Water: 63.79%, Acetonitrile: 34.87%, Dibutylamine: 0.84%, Acetic acid: 0.39% (1.23% as dibutylammonium acetate), Nucleic acid concentration: 0.21 mg / mL (0.02%).

[0133] Comparative Example 1

[0134] 100 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 1 was placed into a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). The tubular bottle containing the solution was then placed in an incubator (Kenis Scientific) at 60 °C and allowed to stand for 8 hours. After standing, the headspace vial was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 3.

[0135] [Table 3]

[0136]

[0137] 1) indicates the purity of the nucleic acid (87.7% purity) prepared in Reference Example 1 after standing at 60°C for 8 hours.

[0138] 2) Nucleic acid retention rate (%) = Nucleic acid purity after standing / Nucleic acid purity before standing

[0139] [Reference Example 2]

[0140] Amide-based solid-phase synthesis of RNA

[0141] Synthesize RNA having the nucleic acid sequence of chain II shown below. This chain consists of 67 bases in length.

[0142] Chain II: Am*Gm*Cm*AmUmAmGmCAAGUUAmAAAUAAGGmC*U*AmG*U*C*CmGUUAUCAAmCmUmUmGmAmAmAmAmAmGm UmGGCACmCmGmAGUCGGmUmGmCm*Um*Um*U(5'-3')(Serial Number 2)

[0143] In the aforementioned sequence notation, the asterisk (*) between nucleotides indicates that the phosphate bond connecting the nucleotides is a phosphate thioester. The letters Am, Um, Cm, and Gm indicate nucleotides where the 2' hydroxyl group is replaced with a methoxy group. This RNA was synthesized from the 3' to the 5' side using a nucleic acid synthesizer (AKT A oligopilot plus 100 GE Healthcare) based on the phosphorusamide method. Synthesis was performed at a scale of 53 μmol. In addition, the following reagents were used for the synthesis: uridine EMM amide (described in Example 2 of International Publication No. 2013 / 027843), cytidine EMM amide (described in Example 3 of International Publication No. 2013 / 027843), adenosine EMM amide (described in Example 4 of International Publication No. 2013 / 027843), and guanosine EMM amide (described in Example 5 of International Publication No. 2013 / 027843) were used as RNA amides; and uridine 2'OMe amide, cytidine 2'OMe amide, adenosine 2'OMe amide, and guanosine 2'OMe amide of the following formulas were used, with porous glass as the solid phase support, dichloroacetic acid toluene solution as the deprotection solution, 5-benzylthio-1H-tetrazole as the condensing agent, iodine solution as the oxidizing agent, 3-amino-1,2,4-dithiazol-5-thione as the sulfiding agent, and phenoxyacetic anhydride solution and N-methylimidazole solution as the capping solution. After nucleic acid extension, the cyanoethyl protecting group of the phosphate moiety is selectively deprotected by applying a diethylamine solution to the nucleic acid on the support. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl.

[0144]

[0145] The excision and deprotection of the solid-phase support after solid-phase synthesis were performed according to the method described in International Publication No. 2013 / 027843. Specifically, an aqueous ammonia solution and ethanol were added, and after standing for a period of time, the solid-phase support was filtered, and the solvent was removed by distillation. Then, the hydroxyl groups were deprotected using tetrabutylammonium fluoride. The obtained RNA was dissolved in distilled water for injection to achieve the desired concentration.

[0146] RNA separation and purification

[0147] Column chromatography purification was performed under the conditions specified in Table 4 below. Before purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, followed by the addition of the sample. The solution was separated at a retention time of 66.7-70.9 minutes and analyzed by HPLC. It should be noted that the purity was calculated using the method described in Method 1 above. The result was a purity of 94.2%. The purified RNA solution was used to perform experiments in the following examples and comparative examples.

[0148] [Table 4]

[0149]

[0150] [Example 2]

[0151] 99 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 2 was placed in a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). 1 μL of a triphenylphosphine acetonitrile solution was mixed as an additive solution to prepare a 3 mM triphenylphosphine sample. The tubular bottle containing the mixed solution was placed in a 60°C incubator (Kenis Scientific) and allowed to stand for 8 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 5.

[0152] Based on calculations, the composition prepared with triphenylphosphine at a concentration of 3 mM (0.09%) has the following composition: Water: 62.02%, Acetonitrile: 33.06%, Methanol: 3.60%, Dibutylamine: 0.82%, Acetic acid: 0.38% (1.20% based on dibutylammonium acetate), Nucleic acid concentration: 0.31 mg / mL (0.03%).

[0153] [Example 3]

[0154] As an additive solution, an acetonitrile solution of diethyl phosphite was used to prepare a 3 mM (0.05%) solution of diethyl phosphite instead of the triphenylphosphine acetonitrile solution used in Example 2. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0155] [Example 4]

[0156] As an additive solution, an acetonitrile solution of triethyl phosphite was used to prepare a 3 mM (0.05%) solution of triethyl phosphite instead of the acetonitrile solution of triphenylphosphine in Example 2. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0157] [Example 5]

[0158] As an additive solution, an acetonitrile solution of diethoxyphenylphosphine was used to prepare a 3 mM (0.07%) diethoxyphenylphosphine solution instead of the triphenylphosphine acetonitrile solution in Example 2. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0159] [Example 6]

[0160] As an additive solution, an acetonitrile solution of ethoxydiphenylphosphine was used to prepare a 3 mM (0.08%) ethoxydiphenylphosphine solution instead of the triphenylphosphine acetonitrile solution used in Example 2. Otherwise, the experiment was conducted under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0161] [Example 7]

[0162] As an additive solution, an acetonitrile solution of 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide was prepared to a concentration of 3 mM (0.07%) to replace the triphenylphosphine acetonitrile solution in Example 2. Otherwise, the experiment was performed under the same conditions, and the purity of the RNA was determined. The results are shown in Table 5.

[0163] [Comparative Example 2]

[0164] 100 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 2 was placed into a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). The tubular bottle containing the solution was then placed in an incubator (Kenis Scientific) set to 60 °C and allowed to stand for 8 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 5.

[0165] [Table 5]

[0166]

[0167] 1) indicates the purity of the nucleic acid (purity of 94.2%) prepared in Reference Example 2 after standing at 60°C for 8 hours.

[0168] 2) Nucleic acid retention rate (%) = Nucleic acid purity after standing / Nucleic acid purity before standing

[0169] [Reference Example 3]

[0170] RNA separation and purification

[0171] The RNA obtained in Reference Example 2, which underwent hydroxyl deprotection using tetrabutylammonium fluoride, was purified by column chromatography under the conditions described in Table 6 below. Before purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. The solution was separated at a retention time of 91.7-94.2 minutes and analyzed by HPLC. It should be noted that the purity was calculated using the method described in Method 1 above. The result was a purity of 95.1%. The purified RNA solution was used to perform experiments in the following examples and comparative examples.

[0172] [Table 6]

[0173]

[0174] [Example 8]

[0175] 99 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 3 was placed in a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). 1 μL of a triphenylphosphine acetonitrile solution was mixed as an additive solution to prepare a 3 mM triphenylphosphine sample. The tubular bottle containing the mixed solution was placed in an incubator (Kenis Scientific) set to 60 °C and allowed to stand for 14 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 7.

[0176] Based on calculations, the composition prepared with triphenylphosphine at a concentration of 3.0 mM (0.09%) has the following composition: Water: 59.70%, Acetonitrile: 35.36%, Methanol: 3.84%, Hexylamine: 0.61%, Acetic acid: 0.36% (0.97% as hexylammonium acetate), Nucleic acid concentration: 0.35 mg / mL (0.04%).

[0177] [Comparative Example 3]

[0178] 100 μL of the purified RNA solution obtained by reverse-phase column chromatography in Reference Example 3 was placed into a 300 mL polypropylene tubular bottle (Thermo Fisher Scientific). The tubular bottle containing the solution was then placed in an incubator (Kenis Scientific) set to 60 °C and allowed to stand for 14 hours. After standing, the polypropylene tubular bottle was removed from the incubator and cooled to room temperature. The purity was calculated using the method described in Method 1 above. The results are shown in Table 7.

[0179] [Table 7]

[0180]

[0181] 1) indicates the purity of the nucleic acid (purity of 95.1%) prepared in Reference Example 2 after standing at 60°C for 14 hours.

[0182] 2) Nucleic acid retention rate (%) = Nucleic acid purity after standing / Nucleic acid purity before standing

[0183] [Example 9] (Recovery of RNA from a purified RNA solution)

[0184] The solution obtained in Example 8, prepared by mixing triphenylphosphine at a concentration of 3 mM and allowing it to stand at 60°C for 14 hours, was subjected to the following treatment. 60 μL of the solution was placed in a 15 mL polypropylene conical tube (Corning Corporation), and 30 μL of sodium acetate aqueous solution (3 M, pH = 5.2) and 180 μL of ethanol were added. The resulting slurry solution was centrifuged at 3000 g and 25°C for 10 minutes, and the supernatant was removed. Next, the process of adding 150 μL of 70% ethanol aqueous solution and centrifuging at 3000 g and 25°C for 10 minutes to remove the supernatant was repeated twice to obtain RNA. The obtained RNA was dissolved in 60 μL of water, and the purity of the RNA fraction was calculated using the method described in Method 1 above; the purity was 93.1%.

[0185] [Comparative Example 4]

[0186] The solution obtained by standing at 60°C for 14 hours in Comparative Example 3 was processed as follows: 60 μL of the solution was placed in a 15 mL polypropylene conical tube (Corning G), and 30 μL of sodium acetate aqueous solution (3M, pH = 5.2) and 180 μL of ethanol were added. The resulting slurry solution was centrifuged at 3000 g and 25°C for 10 minutes to remove the supernatant. Then, the process of adding 150 μL of 70% ethanol aqueous solution and centrifuging at 3000 g and 25°C for 10 minutes to remove the supernatant was repeated twice to obtain RNA. The obtained RNA was dissolved in 60 μL of water, and the purity of the RNA fraction was calculated using the method described in Method 1 above; the purity was 83.0%.

[0187] Industrial availability

[0188] According to the method of the present invention, nucleic acid oligomers having thiophosphate bonds can be stabilized and manufactured efficiently.

[0189] Sequence List Free Text

[0190] Sequence numbers 1 and 2 in the sequence listing represent the base sequences of oligonucleotides manufactured according to the manufacturing method of the present invention.

Claims

1. A composition, characterized in that, It comprises the nucleic acid oligomer shown in formula (1), an alkyl ammonium salt, a nitrile organic solvent, water, and additives. The nucleic acid oligomer is obtained by reverse-phase chromatography of a crude product of a nucleic acid oligomer with thiophosphate bonds generated by the phosphoramidite method in solid-phase synthesis. In equation (1), B C each independently represents the same or different nucleic acid base, R can be the same or different from each other, each independently representing a hydrogen atom, a fluorine atom, or an OQ group. Q can be the same or different from each other, each independently representing a hydrogen atom, methyl, 2-methoxyethyl, methylene bonded to the carbon atom at the 4' position of ribose, ethylene bonded to the carbon atom at the 4' position of ribose, or ethionyl group bonded to the carbon atom at the 4' position of ribose. X may be the same or different from each other, each independently representing an oxygen atom or a sulfur atom, wherein at least one X represents a sulfur atom. Y represents a protecting group for a hydrogen atom or a hydroxyl group. G represents ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion, or hydroxyalkylammonium ion, and, n is an integer that satisfies equation (2). 15≤n （2）； The alkylammonium salt is a dialkylammonium salt, and the dialkylamine forming the dialkylammonium salt has 4 to 10 carbon atoms. The additive is at least one compound selected from the group consisting of triphenylphosphine, diethyl phosphite, triethyl phosphite, diethoxyphenylphosphine, ethoxydiphenylphosphine, and 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide.

2. The composition of claim 1, wherein, The nitrile organic solvent is acetonitrile.

3. The composition according to claim 1 or 2, wherein, In the formula (1), R is independently either hydroxyl or methoxy.

4. A method for manufacturing nucleic acid oligomers, comprising mixing the composition of any one of claims 1 to 3 with at least one solvent selected from the group consisting of C1-C4 alcohols, tetrahydrofuran and dioxane, and separating the precipitated nucleic acid oligomers.

5. A method for manufacturing the composition according to any one of claims 1 to 3, comprising mixing an additive with a column eluent containing the nucleic acid oligomer of formula (1), an alkylammonium salt, a water-soluble organic solvent, and water, obtained by reverse-phase column chromatography of a crude product of a nucleic acid oligomer of formula (1) synthesized by solid-phase synthesis. The water-soluble organic solvent is an organic solvent that includes nitrile-based water-soluble organic solvents and suitably includes other hydrophilic organic solvents.

Images