Preparation and application of a lasso peptide quorum sensing inhibitor

Abstract

The present invention discloses the preparation and application of a lasso peptide quorum sensing inhibitor, wherein the lasso peptide is the following A1 or A2: A1) a lasso peptide novosphingonodinI having an amino acid sequence as shown in the 23rd-43rd positions of sequence 4, wherein a lactam cyclic peptide ring is formed between the α-amino group of glycine at the N-terminal end of the lasso peptide and the carboxylic acid side chain of glutamic acid at the 8th position; A2) a lasso peptide novosphingonodinII having an amino acid sequence as shown in the 23rd-45th positions of sequence 10, wherein a lactam cyclic peptide ring is formed between the α-amino group of glycine at the N-terminal end of the lasso peptide and the carboxylic acid side chain of aspartic acid at the 8th position. The lasso peptide obtained by the present invention can inhibit the formation of a film, but does not inhibit the growth of bacteria, so it will not generate environmental pressure and will not induce drug resistance, and is a safe and environmentally friendly film inhibition method.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and relates to the expression, preparation and purification of a lasso peptide, and the application of the product in inhibiting microbial capsules. Background Art

[0002] Biofouling is characterized by rapid formation, serious pollution, and difficulty in removal, which has caused huge economic losses to the marine industry and is a common problem worldwide. The occurrence of biofouling is closely related to the formation of microbial film (Biofilm), and the formation of Biofilm is regulated by quorum sensing signals (Quorum sensing, QS). This invention focuses on QS, screens quorum sensing inhibitors (Quorum sensing Inhibit, QSI) that have an inhibitory effect on microbial film, develops natural products with anti-fouling potential, and combines indoor verification tests to evaluate the potential capabilities of active substances.

[0003] Marine biofouling refers to the biological aggregates formed by a series of marine organisms such as water microorganisms, algae and small eukaryotic organisms attached to a certain substrate surface. The process of its occurrence includes the attachment, colonization, growth and corrosion of marine organisms. Due to its rapid reproduction, extensive accumulation and difficulty in removal, it has caused huge economic losses to aquaculture, ship navigation, instrument maintenance, etc. Studies have shown that the direct economic losses caused by marine biofouling are as high as 440 billion US dollars each year. The severity of biofouling incidents hinders the development of marine economy and has attracted widespread attention worldwide. Early means of dealing with biofouling include physical methods and chemical methods. Physical methods are more direct mechanical stripping, which is easy to repeat and time-consuming and labor-intensive. Chemical methods mainly rely on the use of antibacterial compounds such as tributyltin (TBT) and cuprous oxide. Compared with physical methods, chemical methods are more convenient and quicker. However, this type of biological toxins are prone to secondary hazards, posing potential dangers to marine life and the ecological environment, and destroying the health of the marine ecosystem. Therefore, seeking a safe, non-toxic and eco-friendly treatment method has become the focus of today's attention.

[0004] Among many methods, biological methods have unique advantages. Microorganisms are particularly preferred in biological pollution control because they have the characteristics of wide sources, fast reproduction and strong adaptability. Targeted screening of strains and finding active metabolites for use in marine pollution control is one of the most promising research directions. Marine biofouling has dynamic succession, and its formation process is closely related to microbial film (Biofilm), and the formation of Biofilm is regulated by a variety of signal factors, the most typical of which is quorum sensing (QS). Quorum sensing is a signal transmission mechanism widely present among microorganisms, which can be used as a communication language to regulate various physiological functions of the flora. Quorum sensing inhibitors (QSI) are specific signal interferers of the QS system, and QSI competitively inhibits and suppresses the normal signal exchange of the system. By interfering with the communication system within the community, the structure and function of the flora can be effectively regulated without killing or interfering with the normal life activities of bacteria. Therefore, taking QSI as the entry point, blocking the action of signal molecules and then inhibiting the formation of microbial film has a theoretical basis for anti-fouling. In addition, the development of the QSI method for film inhibition and damage control not only has the general advantages of biological treatment, but is also ecologically safe and environmentally friendly, and is a green and pollution-free method.

[0005] Lasso peptides are a class of natural peptide products found in bacteria. They are a class of bioactive peptides with a lasso configuration that are synthesized by ribosomes and post-translationally modified. They are named for their interlocked lasso topological structure. Compared with linear peptides, lasso peptides have excellent thermal stability and protease stability. Lasso peptides are considered to be a hot spot in the research and development of biopharmaceuticals because of their antibacterial, antiviral or other biological activities. Since the discovery of the first lasso peptide anantin in 1991, research on "lasso peptides" has gradually attracted attention. However, the number of lasso peptides isolated and identified is still very small. Therefore, one of the focuses of future work is still the identification of new lasso peptides and the development of new functions. Heterologous expression is the most commonly used method in lasso peptide research. This is because the expression of lasso peptides in their natural host bacteria is difficult to achieve under standard culture conditions, and heterologous expression is conducive to in-depth research on the biosynthesis process and post-translational modification of lasso peptides.

[0006] Lasso peptides have a variety of biological activities, such as antibacterial, anti-tumor, enzyme inhibition and receptor antagonism. It is currently believed that the antibacterial effect of lasso peptides is mainly through two mechanisms: one is to act on the bacterial cell membrane, form ion channels on the membrane, cause the leakage of intracellular substances and kill bacteria; the other is that lasso peptides enter the cell without destroying the cell membrane, bind to the intracellular target and inhibit its metabolism, thereby killing bacteria. For example, MccJ25 binds to the bacterial outer membrane receptor protein FhuA, and after entering the bacteria, it inhibits the activity of RNA polymerase and has a bactericidal effect. Summary of the invention

[0007] The purpose of the present invention is to seek a safe, non-toxic and eco-friendly anti-fouling method, aiming at the role of lasso peptide and the scarcity of its application in the field of ecological environment, hoping to explore its new efficacy and new application.

[0008] The present invention provides a lasso peptide, wherein the lasso peptide is the following A1 or A2,

[0009] A1) a lasso peptide novosphingonodin I having an amino acid sequence as shown in positions 23 to 43 of SEQ ID NO. 4, wherein a lactam cyclic peptide ring is formed between the α-amino group of glycine at the N-terminus of the lasso peptide (corresponding to position 23 of SEQ ID NO. 4) and the carboxylic acid side chain of glutamic acid at position 8 (corresponding to position 30 of SEQ ID NO. 4);

[0010] A2) a lasso peptide novosphingonodin II having an amino acid sequence as shown in positions 23 to 45 of SEQ ID NO: 10, wherein a lactam cyclic peptide ring is formed between the α-amino group of the N-terminal glycine (corresponding to position 23 of SEQ ID NO: 10) and the carboxylic acid side chain of the aspartic acid at position 8 (corresponding to position 30 of SEQ ID NO: 10).

[0011] Among them, the gene cluster encoding the lasso peptide novosphingonodin I includes the nucleotide sequences shown in sequence 1, sequence 2 and sequence 3; the gene cluster encoding the lasso peptide novosphingonodin II includes the nucleotide sequences shown in sequence 7, sequence 8 and sequence 9. Further, the gene cluster of the lasso peptide novosphingonodin I is composed of the nucleotide sequences shown in sequence 1, RBS sequence, sequence 2 and sequence 3 in sequence. The gene cluster of the lasso peptide novosphingonodin II is composed of the nucleotide sequences shown in sequence 7, RBS sequence, sequence 8 and sequence 9 in sequence.

[0012] The use of the lasso peptide in blocking microbial signal transmission and / or inhibiting microbial quorum sensing should also be within the protection scope of the present invention.

[0013] The use of the lasso peptide in inhibiting the formation of microbial capsules and / or preventing environmental pollution should also be within the scope of protection of the present invention.

[0014] A method for preparing a lasso peptide comprises the steps of introducing a recombinant vector capable of expressing the lasso peptide novosphingonodin I or the lasso peptide novosphingonodin II into a microorganism for expression to obtain the lasso peptide novosphingonodin I or the lasso peptide novosphingonodin II.

[0015] The recombinant vector capable of expressing the lasso peptide novosphingonodin I is pET41a-novA1-RBS-B1C1, and the recombinant vector capable of expressing the lasso peptide novosphingonodin II is pET41a-novA2-RBS-B2C2.

[0016] The recombinant vector pET41a-novA1-RBS-B1C1 is obtained by replacing the sequences between novA1 and novB1 of the recombinant plasmid pET41a-novA1B1C1 with optimized Escherichia coli ribosome binding sites through point mutation technology; the recombinant vector pET41a-novA2-RBS-B2C2 is obtained by replacing the sequences between novA2 and novB2 of the recombinant plasmid pET41a-novA2B2C2 with optimized Escherichia coli ribosome binding sites through point mutation technology.

[0017] The use of the lasso peptide prepared by the method in blocking microbial signal transmission should also be within the protection scope of the present invention.

[0018] The use of the lasso peptide prepared by the method in inhibiting the formation of microbial capsules and / or the occurrence of fouling should also be within the protection scope of the present invention.

[0019] The present invention also provides a microbial quorum sensing inhibitor, wherein the active ingredient of the inhibitor comprises the lasso peptide or the lasso peptide prepared by the above method.

[0020] The beneficial effects of the present invention are: 1) environmental friendliness: the lasso peptide obtained by the present invention can inhibit the formation of membranes, but does not inhibit the growth of bacteria, so it will not generate environmental pressure and will not induce drug resistance. It is a safe and environmentally friendly membrane inhibition method; 2) low acquisition cost: the expression of the lasso peptide in the present invention utilizes a mature Escherichia coli expression system, thereby saving the cost required for chemical synthesis and reducing the workload of screening, greatly saving manpower, material and financial costs; 3) good screening effect: specific implementation results show that the membrane inhibition ability of the method provided by the present invention has statistically significant differences, indicating that the method has a good ability to inhibit the formation of membranes and the occurrence of fouling. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Analysis of gene clusters for the synthesis of lasso peptide I (A) and lasso peptide II (B).

[0022] Figure 2 The liquid phase detection results of lasso peptide. Empty vector represents the expression product of empty vector (negative control); novosphingonodin I represents the expression product of BL21(DE3) / pET41a-novA1-RBS-B1C1; novosphingonodin II represents the expression product of BL21(DE3) / pET41a-novA2-RBS-B2C2; ERW19 represents the expression product of strain ERW19 itself.

[0023] Figure 3 Figure A in the middle shows the mass spectrum of lasso peptide I; Figure B shows the mass spectrum of lasso peptide II.

[0024] Figure 4 The fermentation broth of the strain and the extracted lasso peptide have inhibitory effects on quorum sensing signals.

[0025] Figure 5 A shows the inhibitory effect of lasso peptide on Pseudomonas aeruginosa biofilm; B shows the effect of lasso peptide on the growth of Pseudomonas aeruginosa.

[0026] Figure 6 Regulation of quorum sensing genes by lasso peptides. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0028] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0029] All experimental treatments in the following examples included three biological replicates, and the experimental data were expressed in the form of mean ± standard deviation. Statistical analysis was performed using SPSS 18.0 software, and bar graphs and line graphs were drawn using OriginPro 2017 software.

[0030] The novel sphingobacterium ERW19 (Water Research, 2020, 183: 116092. Two hierarchical LuxR-LuxI type quorum sensing systems in Novosphingobium activate microcystin degradation through transcriptional regulation of the mlr pathway) in the following embodiments of the present invention was isolated from Taihu Lake (the sequence number of its genome in Genbank is JABAIC000000000). Chromobacterium violaceum is ATCC 12472; Pseudomonas aeruginosa PAO1 (Toyofuku, M., Nomura, N., Fujii, T., Takaya, N., Maseda, H., Sawada, I., Nakajima, T., Uchiyama, H., 2007. Quorum sensing regulates denitrification in Pseudomonas aeruginosa PAO1. J. Bacteriol. 189(13), 4969e4972.).

[0031] The formula of R2A medium is: tryptone 0.25g / L, acid hydrolyzed casein 0.5g / L, yeast extract powder 0.5g / L, soluble starch 0.5g / L, dipotassium hydrogen phosphate 0.3g / L, magnesium sulfate heptahydrate 0.1g / L, sodium pyruvate 0.3g / L, peptone 0.25g / L, glucose 0.5g / L; pH = 7.2). The sequencing data of the strain was deposited in the Sequence Read Archive (SRA) database of the National Center for Biotechnology Information (NCBI) of the United States, and the project accession number is PRJNA680686. Bioinformatics analysis used sequence alignment and online methods.

[0032] M9 basic medium (pH=7.0), which is composed of: 17.1g / L disodium hydrogen phosphate dodecahydrate, 3g / L potassium dihydrogen phosphate, 0.5g / L sodium chloride, 1g / L ammonium chloride, 1mL / L 2mol / L magnesium sulfate, 0.2mL / L 0.5mol / L calcium chloride; after high temperature and high pressure sterilization, add 10mL / L sterile (40% w / v) glucose solution and 0.2mL / L vitamin mixture. The vitamin mixture (per 300mL) contains 1.0g choline chloride, 1.0g folic acid, 1.0g pantothenic acid, 1.0g nicotinamide, 2.0g inositol, 1.0g pyridoxal hydrochloride, 1.0g thiamine, 0.1g riboflavin, 0.3g disodium 5'-adenosine triphosphate, and 0.2g biotin.

[0033] MBM medium (pH = 7.0), composed of: 2 g / L potassium sulfate, 3 g / L dipotassium hydrogen phosphate, 1 g / L sodium chloride, 5 g / L ammonium chloride, 0.08 g / L magnesium sulfate heptahydrate, 0.05 g / L yeast extract, 2.5 mg / L manganese sulfate monohydrate, 5 mg / L ferric chloride hexahydrate, 5 mg / L copper chloride, 5 mg / L calcium chloride dihydrate; after high temperature and high pressure sterilization, 10 mL / L of sterile (25% w / v) glucose solution was added thereto.

[0034] Example 1 Analysis of the Lasso Peptide Gene Cluster

[0035] Neosphingobacterium ERW19 was isolated from Taihu Lake (its genome sequence number in Genbank is JABAIC000000000). Neosphingobacterium ERW19 was cultured in R2A medium at 30°C. The sequencing data of the strain was deposited in the Sequence Read Archive (SRA) database of the National Center for Biotechnology Information (NCBI) of the United States, with the project accession number PRJNA680686. Bioinformatics analysis used sequence alignment and online methods.

[0036] By comparing the genes in a colinear manner, we found that the strain Novosphingobium sp. ERW19 contains a lasso peptide synthesis gene cluster, indicating that the bacterium has the ability to express lasso peptides. Through genome mining, a lasso peptide synthesis gene cluster was found in the ERW19 sequence (such as Figure 1 The synthetic gene cluster of lasso peptide I contains three genes, namely novA1 (whose sequence is shown in sequence 1), novB1 (whose sequence is shown in sequence 2) and novC1 (whose sequence is shown in sequence 3), which encode precursor peptide A1 (whose sequence is shown in sequence 4), cysteine ​​enzyme B1 (whose sequence is shown in sequence 5) and lactamase C1 (whose sequence is shown in sequence 6) respectively (as shown in sequence 7). Figure 1Similarly, the three genes included in the synthetic gene cluster of lasso peptide II are novA2 (whose sequence is shown in sequence 7), novB2 (whose sequence is shown in sequence 8) and novC2 (whose sequence is shown in sequence 9) (as shown in Figure 1 B), encoding the precursor peptide sequence A2 (whose sequence is shown in sequence 10), the cysteine ​​enzyme sequence B2 (whose sequence is shown in sequence 11), and the lactamase sequence C2 (whose sequence is shown in sequence 12). The downstream of these two lasso peptide synthesis gene clusters is adjacent to the isopeptidase gene encoding the isopeptidase, of which the isopeptidase sequence encoded by the isopeptidase gene adjacent to the downstream of lasso peptide I is shown in sequence 13, and the isopeptidase sequence encoded by the isopeptidase gene adjacent to the downstream of lasso peptide II is shown in sequence 14, rather than the gene encoding the ABC transporter, indicating that these two lasso peptides may not have antibacterial activity (Hegemann et al. 2015).

[0037] ORF prediction revealed that the precursor peptides of lasso peptides I and II contain 43 and 45 amino acids, respectively. Through gene analysis, the biosynthetic pathways of the two lasso peptides were deduced ( Figure 1 ). In the synthesis pathway of nosovirus peptide I, under the modification of cysteinease encoded by novB1 gene and lactam synthetase encoded by novC1 gene, the leading peptide sequence of precursor peptide A1 is cleaved and the core peptide (whose amino acid sequence is the 23rd to 43rd position of sequence 4) is released, and a lactam cyclic peptide ring is formed between the α-amino group of N-terminal glycine (Gly, corresponding to the 23rd amino acid of sequence 4) and the carboxylic acid side chain of glutamic acid (Glu) at the 8th position (corresponding to the 30th amino acid of sequence 4), thereby obtaining nosovirus peptide I with a precursor ring, and nosovirus peptide I is named novosphingonodin I.

[0038] In the synthesis pathway of lasso peptide II, under the modification action of cysteinease encoded by novB2 gene and lactam synthetase encoded by novC2 gene, the leading peptide sequence of the precursor peptide is cleaved and the core peptide (whose amino acid sequence is the 23rd to 45th positions of sequence 4) is released, and a lactam cyclic peptide ring is formed between the α-amino group of N-terminal glycine (Gly, corresponding to the 23rd amino acid of sequence 10) and the carboxylic acid side chain of aspartic acid (Asp, corresponding to the 30th amino acid of sequence 10) at position 8, thereby obtaining lasso peptide II with a precursor ring, and lasso peptide II is named novosphingonodin II.

[0039] Example 2 In vitro expression and liquid chromatography-mass spectrometry identification of lasso peptide

[0040] 8.31. Heterologous Expression and Extraction of Lasso Peptides

[0041] The heterologous expression of lasso peptide uses plasmid pET41a (+) as the expression vector and strain E. coli BL21 (DE3) as the expression host. The steps of constructing the expression strain are as follows: first, the lasso peptide synthetic gene cluster fragment (novA1B1C1 and novA2B2C2) is amplified using high-fidelity PCR enzyme Tks Gflex DNA Polymerase (TaKaRa); the target gene fragment after agarose gel recovery and purification is connected with the vector pEASY-T1 simple cloning vector (Beijing Quanshijin), and transformed into E. coli DH5α competent cells; selecting recombinant clones by blue-white spot screening, and performing colony PCR and plasmid double enzyme digestion verification on the white spot transformants; performing double enzyme digestion reaction on the correct recombinant plasmid, and connecting the double enzyme digestion recovery product with pET41a(+) digested with the same endonuclease, and transforming DH5α competent cells; selecting recombinant clones for colony PCR and plasmid double enzyme digestion verification to obtain recombinant plasmids pET41a-novA1B1C1 and pET41a-novA1B1C1; using point mutation technology to change the sequence TCCACT between nov1 and novB1 of the above two recombinant plasmids GGCAGGTGCGCAAGGCCTTGCTGGCCCGGCGCACCTGCCTTGTGCTTGTGCGAGGCGGAC was replaced with the optimized E. coli ribosomal binding site AGAGGAGAAATTAACC, and the sequence between novA2 and novB2 (CCGGCTCGGGCGCATGTCCCAGTTTCAGGGCATGCGCCCTTCGGCGCAGTTTCCC) was replaced with the optimized E. coli ribosomal binding site AGAGGAGAAATTAACC (E. coli optimizedribosomal binding site sequence), finally obtaining the recombinant plasmids pET41a-novA1-RBS-B1C1 and pET41a-novA2-RBS-B2C2. The recombinant plasmid pET41a-novA1-RBS-B1C1 is a recombinant vector in which plasmid pET41a(+)NdeI and EcoRI are replaced with the gene cluster sequence of lasso peptide I and other sequences are kept unchanged, wherein the gene cluster sequence of lasso peptide I is a sequence composed of the gene sequences of novA1, RBS, novB1 and novC1 in sequence.The recombinant plasmid pET41a-novA2-RBS-B2C2 is a recombinant vector in which plasmid pET41a(+)NdeI and EcoRI are replaced with the gene cluster sequence of lasso peptide II and other sequences are kept unchanged, wherein the gene cluster sequence of lasso peptide II is a sequence composed of the gene sequences of novA2, RBS, novB2 and novC2 in sequence, and the sequence of RBS is AGAGGAGAAATTAACC.

[0042] The in vitro induction expression steps of lasso peptide are as follows: E. coli BL21 (DE3) carrying recombinant plasmids pET41a-novA1-RBS-B1C1 and pET41a-novA2-RBS-B2C2 are inoculated into LB liquid medium containing kanamycin (50 μg / mL) and cultured at 200 rpm and 37°C under shaking conditions; the above seed solution is inoculated into 2L M9 liquid medium at a ratio of 1:100, and cultured at 200 rpm and 37°C under shaking conditions until the strain OD reaches 0. 600 The value reached 0.4-0.5; at this time, the shaking temperature was adjusted to 20°C, and the shaking culture was continued at 200 rpm for 1 hour; then sterile IPTG (isopropyl-β-D-thiogalactoside, 100 mM) solution was added to the culture medium to 0.1 mM, and the shaking culture was continued at 200 rpm and 20°C for 3 days. E. coli BL21 (DE3) carrying empty pET41a (+) was used as a negative control.

[0043] The extraction steps of lasso peptide are as follows: take all the bacterial liquids after 3 days of induction culture of the above two methods, centrifuge them at 4000rpm and 4℃ for 30min, and pour out the supernatant culture medium; add 200mL of methanol to the cell pellet, fully resuspend the cells, and place them in a shaker at 200rpm and 4℃ for overnight shaking; take the extract and centrifuge it at 4000rpm and 4℃ for 30min, collect all the supernatant, evaporate all the extract to dryness using a rotary evaporator, and then redissolve the extract at the bottom of the distillation flask with 5mL of 50% methanol solution; take all the extract and centrifuge it at 12000rpm and 4℃ for 10min to remove insoluble precipitates, and finally collect all the supernatant, that is, the crude extracts of lasso peptides I and II, and store them at -20℃ for later use.

[0044] 2. Liquid phase detection, purification and mass spectrometry identification of lasso peptides

[0045] A small amount of crude extract samples of lasso peptide I and II were taken for HPLC detection, the instrument used was Shimadzu LC-2030 liquid chromatograph, the chromatographic column was C18 column (Shim-pack GIST C18, 4.6mm×250mm, 5μm; Shimadzu Company, Japan), the mobile phase A was ultrapure water, the mobile phase B was chromatographic grade methanol, the flow rate was 1mL / min, the injection volume was 100μL, the detection wavelength was 215nm, and the gradient elution program was: 0-0.01min, 2% B; 0.01-6min, 2% B-30% B; 6-33min, 30% B-95% B; 33-35min, 95% B; 35-36min, 95% B-2% B. After determining the peak time of lasso peptide, the sample was recovered and identified by mass spectrometry. The mass spectrometer used was a SHIMADZU LCMS-2020 liquid chromatography-mass spectrometer, with mobile phase A being ultrapure water and phase B being acetonitrile, a flow rate of 0.4 mL / min, an injection volume of 1 μL, and a MS detection molecular weight range of 150-2000 Da. Figure 2 As shown in the figure, the blank control without any sample is used. Since the blank control only has noise peaks and no other peaks, it is not included here. Figure 2 Displayed in.

[0046] The results are as follows Figure 2 As shown, compared with the expression product of the negative control, two significant peaks were detected in the intracellular extract after BL21(DE3) / pET41a-novA1-RBS-B1C1 induction expression, with retention times of 26.013min and 28.424min, respectively. In the intracellular extract after BL21(DE3) / pET41a-novA2-RBS-B2C2 induction expression, a significant peak was detected, with a retention time of 28.232min.

[0047] Referring to the culture methods in the above literature (Kuroha et al., 2017; Kodani et al., 2018; Fuwa et al., 2021), strain ERW19 was inoculated in MBM medium, and the expression product was extracted after shaking culture for 9 days, and its expression product was detected by HPLC (the method is the same as above). Figure 2As shown, two significant chromatographic peaks were detected in the expression product of strain ERW19, with retention times of 26.357 min and 28.207 min, respectively, corresponding to the chromatographic peak of lasso peptide I with a retention time of 26.013 min and the chromatographic peak of lasso peptide II with a retention time of 28.232 min. Therefore, the chromatographic peaks at retention times of 26.013 min and 26.357 min are most likely lasso peptide I, while the chromatographic peaks at retention times of 28.232 min and 28.207 min are most likely lasso peptide II.

[0048] The above high-abundance chromatographic peaks were further identified by mass spectrometry. Figure 3 As shown, the results show that the [M+2H] 2+ =853( Figure 3 A), which is basically the same as the predicted mass spectrometry mass of lasso peptide I (m / z=852.95); the [M+2H] 2+ =963( Figure 3 B), which is basically the same as the mass spectrometry mass of the predicted lasso peptide II (m / z=962.58). The above results indicate that the two lasso peptides were successfully expressed in E. coli.

[0049] Example 3 QSI effect of lasso peptide and its inhibitory effect on microbial membrane

[0050] Chrommobacterium violaceum ATCC 12472 was used to detect the QSI activity of lasso peptide. The specific operation was as follows: a 0.25 cm filter paper was placed on a semi-solid agar medium evenly mixed with Chrommobacterium violaceum (OD600 close to 0.1), and 0.2 uL of the expression product of strain ERW19 and the exogenously expressed lasso peptide were spotted on the filter paper. In the determination of QSI active bacteria, 4-hydroxy-2,5-dimethyl-3(2H)furanone (4-Hydroxy-2,5-dimethyl-3(2H)furanone; Sigma-Aldrich, St. Louis, MO, USA, CAS No. 3658-77-3) and sterilized LB medium were used as positive and negative controls, respectively. After culturing at 30°C for 24 hours, the production of purple pigment of the reporter strain on the filter paper was observed. When purple was produced, it was judged as a negative result, and when no color was produced, it was judged as a positive result.

[0051] The expression product of strain ERW19 and the exogenously expressed lasso peptide can inhibit the production of purple pigment of Bacillus violaceus. The detection plate can observe obvious pigment inhibition phenomenon; the negative control (LB medium) does not show such purple pigment inhibition phenomenon (such as Figure 4 The exogenously expressed lasso peptide had a more significant inhibitory effect, and the purple pigment of Bacillus violaceus was completely inhibited.

[0052] 2. Biofilm biomass analysis

[0053] The biofilm biomass was analyzed by crystal violet staining (CV) and the activated PAO1 bacterial solution (OD 585 =0.8) was inoculated into M63 liquid culture medium (ammonium sulfate 2g / L, potassium dihydrogen phosphate 13.6g / L, ferrous sulfate heptahydrate 5mg / L, glycerol 2g / L, casein hydrolyzate CAA 5g / L, magnesium sulfate heptahydrate 0.2g / L, glucose 2g / L, pH adjusted to 7.0 with potassium hydroxide, sterilized at 121°C for 20min). Experimental groups were set up according to the experimental design, including lasso peptide I (1μg / mL) (experimental group), lasso peptide II (1μg / mL) (experimental group), furanone (positive control), LB culture medium (negative control) water (blank control). 100μL of the above mixed substances were added to a 96-well plate and cultured at a constant temperature of 30°C for 48h. After 48h, the cell suspension and culture medium were discarded, and the impurities on the surface of the biofilm attached to the wall were washed with deionized water, and repeated 3 times. After drying, 100 μL of CV dye solution (1%, w / v) was added, and the plate was stained for 30 min at room temperature. The dye was discarded and the plate was rinsed several times to remove the floating color. After drying again, 200 μL of DMSO solution was added, and the plate was repeatedly blown to ensure that the biofilm attached to the plate wall and the bottom was completely dissolved. The OD was measured using a microplate reader (Infinite 200PRO; Tecan). 585 The absorbance at , 12 parallel wells were scanned as replicates for each experiment, and each replicate was read three times. Figure 5 As shown in A.

[0054] 3. Effect of Purified Lasso Peptide on PAO1 Growth

[0055] The experiment was carried out in 250 mL Erlenmeyer flasks, with 100 mL of PAO1 bacterial solution cultured in each flask. 500 μL of filtered and sterilized 50% methanol, BL21(DE3) / pET41a crude extract (empty control), BL21(DE3) / pET41a-novA1-RBS-B1C1 expression product (lasso peptide I) and BL21(DE3) / pET41a-novA2-RBS-B2C2 expression product (lasso peptide II) were added to each flask, and the flasks were cultured indoors (temperature 25°C). Three parallels were set for each treatment, and the cell density was measured at intervals.

[0056] FACSCalibur flow cytometer (BD, USA) was used to measure the algal cell density. AccuCheck Counting Beads (Invitrogen, USA) consisted of two kinds of microspheres, A and B, of equal density, with microsphere A having a diameter of 6.40 μm and microsphere B having a diameter of 6.36 μm. The microsphere density was 10 6 / mL. Add 20μL counting microspheres to 480μL of the bacterial solution that has been filtered and appropriately diluted, and mix thoroughly with a vortexer before sampling for detection. The FL2 channel can separate bacterial cells and microspheres A and B very well. Set the FL2 channel to stop collecting after collecting 700 microspheres A. When the difference between the microsphere B count and the microsphere A count is greater than 100, re-testing is required. Record the cell count and the microsphere A and B counts in the FL2-SSC graph, and substitute them into the following formula to calculate the total cell density.

[0057]

[0058] Figure 5 As can be seen in A, the inhibition rates of lasso peptide I and lasso peptide II on PAO1 biofilm at a concentration of 1.0 μg / mL reached 55.1% and 44.2%, respectively, with significant inhibition effects (P<0.01). Although the biomass of the biofilm was inhibited, bacterial growth was not affected (e.g. Figure 5 B), the solid and dotted lines represent the bacterial growth curves of the experimental group with lasso peptides I and II, and the dotted curve represents the bacterial growth curve of the negative control group. The possible reason why lasso peptides inhibit biofilm formation without affecting strain growth is that lasso peptides only act on signal molecules and inhibit the occurrence of biofilm by blocking density-sensing communication between strains. The inhibitor has no physiological toxicity to a single strain, so no bacterial growth inhibition phenomenon was observed.

[0059] Example 4 Molecular Mechanism of Lasso Peptide Inhibiting Biofilm

[0060] Take 10 mL (OD 600=0.1), added lasso peptide I and II (1.0 μg / mL) as the experimental group, and the other group added solvent methanol as the negative control group, the final concentration of methanol was 1.0 μg / mL. After culturing at room temperature for 36 hours, the bacterial liquid was collected to extract total RNA. The experiment adopted the TRIzol extraction method: take an appropriate amount of bacterial liquid, centrifuge at 8000g / min at 4℃ for 5min, remove the supernatant, add 1mL TRIzol reagent (Takara, Dalian, China), blow repeatedly to fully lyse the bacteria; let it stand at room temperature at 15℃-30℃ for 5min, add 0.2mL chloroform, shake vigorously for 30s, and let it stand at room temperature at 15℃-30℃ for 2-3min; centrifuge at 12000g / min at 4℃ for 15min, transfer the upper aqueous phase to a centrifuge tube, add 0.5mL isoamyl alcohol, and let it stand at room temperature at 15℃-30℃ for 10min; centrifuge at 12000g / min at 4℃ for 10min, pour out the liquid in the tube, at this time RNA has attached to the wall of the EP tube, add 1mL pre-cooled anhydrous ethanol, mix well, and dissolve the RNA on the wall of the tube; centrifuge at 7000g / min at 4℃ for 5min, pour out all the liquid again, and let it stand at room temperature for 5-10min until the ethanol evaporates. The RNA samples were re-dissolved in RNase-free water and the A of the samples was detected using NanoDrop 2000 ultra-micro-volume spectrophotometer. 260 / A 280 and A 260 / A 230 Parameters were used to characterize RNA purity and concentration. Qualified RNA samples were reverse transcribed using the PrimeScript RT kit (Takara, Dalian, China) to convert RNA into cDNA, and gel electrophoresis was used to evaluate DNA quality. The dye used for qRT-PCR was Premix ExTaq TM Kit (TaKaRa, Dalian, China), set up a 20 μL reaction system according to the operating instructions, and detect 8 quorum sensing-related regulatory genes (lasI, lasR, lasA, lasB, rhlIR, rhlI, pqsA, pqsR) of strain PAO1. The specific PCR conditions are: 95℃ denaturation for 15s, 55℃ annealing for 30s, 60℃ extension for 45s, and repeat 35 cycles. Three parallels were made for each group of genes, and the melting curve was analyzed to verify the specificity of the qRT-PCR reaction. The internal reference was set to eliminate errors. The primer sequences are shown in Table 1. Graphpad software was used for differential analysis, and the universal log2 transformation method was used for data analysis. The results are shown in Table 1. Figure 6 shown.

[0061] Table 1 QS gene primers and sequences

[0062]

[0063] from Figure 6 As can be seen, the results of qRT-PCR analysis of Pseudomonas aeruginosa PAO1 quorum sensing regulatory genes showed that under the action of lasso peptide, the biofilm-related regulatory genes (lasB, lasI, lasR, pqsA and pqsR) in the Las system and PQS system were downregulated by 1.81-6.25 times (P<0.05 or P<0.01). The expression of two virulence-related genes rhlI and rhlR in the Rhl system was also significantly reduced, with a decrease of 75.4% and 68.2%, respectively (P<0.01). Although the expression of the lasA gene was not statistically different from that of the control group (P>0.05), its expression level still showed a downward trend.

[0064] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A lasso peptide, wherein the lasso peptide is novosphingonodin II, the amino acid sequence of which is the amino acid sequence shown at positions 23 to 45 of SEQ ID NO: 10, wherein: A lactam cyclic peptide ring is formed between the α-amino group of the glycine at the N-terminal end of the lasso peptide and the carboxylic acid side chain of the aspartic acid at the 8th position.

2. The lasso peptide according to claim 1, characterized in that The gene cluster encoding the lasso peptide novosphingonodin II includes the nucleotide sequences shown in sequence 7, sequence 8 and sequence 9.

3. Use of the lasso peptide according to claim 2 in blocking microbial signal transmission and / or inhibiting quorum sensing of microorganisms, wherein the microorganism is Pseudomonas aeruginosa.

4. Use of the lasso peptide according to claim 2 in inhibiting microbial capsule formation, wherein the microorganism is Pseudomonas aeruginosa.

5. The method for preparing the lasso peptide according to claim 2, characterized in that: The method comprises the steps of introducing a recombinant vector capable of expressing the lasso peptide novosphingonodin II into a microorganism for expression to obtain the lasso peptide novosphingonodin II.

6. The method according to claim 5, characterized in that The recombinant vector capable of expressing the lasso peptide novosphingonodin II is a vector containing a gene cluster encoding the lasso peptide novosphingonodin II.

7. The method according to claim 5, characterized in that The recombinant vector capable of expressing the lasso peptide novosphingonodinII is the recombinant vector pET41a- novA2-RBS-B2C2, described Recombinant vector pET41a- novA2-RBS-B2C2 To transform the plasmid pET41a(+) NdeI and EcoRI The sequence between the two vectors was replaced with the gene cluster encoding the lasso peptide novosphingonodin II, and the other sequences were kept unchanged.

8. A microbial quorum sensing inhibitor, characterized in that The active ingredient of the inhibitor comprises the lasso peptide according to claim 2 or the lasso peptide prepared by the method according to any one of claims 5-7.

Images