A recombinant plasmid of porcine circovirus type 3 and its application

Abstract

The invention discloses a recombinant plasmid of porcine circovirus type 3 and its application. The recombinant plasmid is a recombinant plasmid obtained by cloning a gene sequence of SEQ ID No. 1 into a pBluescript SK vector through EcoRI and SpeI restriction sites. The recombinant plasmid of the invention can be successfully rescued in PK-15 cells and can be continuously passaged. At the same time, the recombinant PCV3 virus and the PCV3 wild virus in positive PCV3 disease materials have the same biological characteristics, and cannot proliferate in PK-15 cells after inoculation. The successful construction of the recombinant virus provides an indispensable biological material for conducting pig infection experiments and subsequent vaccine development, breaking through the bottleneck of pig infection experiments and the development of immune preparations such as vaccines.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a recombinant plasmid of porcine circovirus type 3 and an application thereof. Background Art

[0002] Porcine circovirus (PCV) is a circular, single-stranded negative-sense DNA virus belonging to the genus Circovirus of the family Circoviridae. The genome of PCV3 is 2000 bp long and contains three major open reading frames (ORFs), namely ORF1, ORF2 and ORF3. In 2016, Palinski et al. in the United States first discovered PCV3 from dead sows and aborted fetuses with PNDS through metagenomic analysis. Subsequently, many countries such as the United States, China, Brazil, Italy, South Korea, Thailand, Spain, Denmark, Germany, Sweden and Poland have published a large number of reports on the detection of PCV3, indicating that the virus has spread rapidly around the world. In March 2017, Guangdong Province reported the first case of PCV3 infection in my country. In addition to the detection of PCV3 in pigs, the presence of PCV3 has also been identified in canines and other mammals. Cui et al. proposed that PCV3 originated from bats and that birds are important intermediate hosts for the transmission of bat circovirus to pigs. This mode of transmission increases the risk of cross-species transmission and affects public health safety. Further analysis of the amino acid sequence of the Cap protein shows that the PCV3 strains prevalent worldwide are mainly divided into three subtypes: PCV3a, PCV3b, and PCV3c, among which the prevalence of PCV3a is increasing.

[0003] When pigs are infected with PCV3, the respiratory and digestive systems are damaged, which causes dynamic changes in the intestinal microbiota, disrupting the balance of the microbiota, and is followed by symptoms such as exudative dermatitis. PCV3 can be transmitted vertically, passing through the placental barrier and replicating in the tissues of the fetus, producing a high viral load, and even causing stillbirths and mummies in pregnant sows. The emergence of persistent viremia of PCV3 increases the possibility of reinfection. Although the virus may exist in the pig's body for a long time, it will not show obvious clinical symptoms.

[0004] Jiang et al. successfully replicated dermatitis and nephrotic syndrome in piglets by infecting 4- and 8-week-old SPF pigs with PCV3 virus rescued by cDNA cloning technology. Wang et al. inoculated PK-15 cells with PCV3-positive clinical disease materials, and collected virus fluid after three consecutive passages. The virus fluid was used to infect 3-week-old piglets. The results showed that the experimental pigs had a high level of specific antibodies on the 7th day of infection; the distribution of pathogenic tissues showed that PCV3 had a wide range of tissue tropism, and the virus load was highest in the lungs and lymph nodes, but there were no clinical symptoms visible to the naked eye. Deng et al. also inoculated PK-15 cells with PCV3-positive clinical disease materials, collected virus fluid after five consecutive passages, and infected experimental pigs with this virus fluid. Viremia was detected on the 17th day of infection, and pro-inflammatory cytokines in the serum were significantly upregulated, and pathological damage occurred in multiple organs. Since it is impossible to successfully isolate PCV3 virus from cells, the above two methods of infecting pigs with wild PCV3 virus can only use low-generation and unpurified wild PCV3 virus to carry out experiments. Therefore, neither can effectively rule out the possibility of contamination of the virus liquid with other pathogens and the possibility of the virus titer being too low. The above research results need to be further verified by purified or reconstructed PCV3 virus. Summary of the invention

[0005] In view of this, one of the objects of the present invention is to provide a recombinant plasmid of porcine circovirus type 3, which can infect PK-15 cells and be serially passaged, thereby achieving virus rescue.

[0006] The first aspect of the present invention provides a recombinant plasmid of porcine circovirus type 3, which is obtained by cloning a gene sequence of SEQ ID No. 1 into a pBluescript SK vector through EcoRI and SpeI restriction sites.

[0007] The second aspect of the present invention provides an application of the above-mentioned recombinant plasmid in virus rescue of porcine circovirus type 3.

[0008] The third aspect of the present invention provides an application of the above-mentioned recombinant plasmid, wherein the recombinant plasmid is transfected into PK-15 cells, and the cells are passaged with the virus to obtain the recombinant virus of porcine circovirus type 3.

[0009] Preferably, the method of transfecting the recombinant plasmid into PK-15 cells comprises the following steps:

[0010] PK-15 cells were plated on a six-well cell culture plate. When the cell confluence reached about 80%, the supernatant was discarded, the cells were washed three times with PBS, 1 mL of DMEM nutrient solution without double antibody and serum was added, and the cells were placed in a 37°C, 5% CO2 incubator for later use; 3.5 μL of transfection reagent and 4 μL of plasmid were added to 50 μL of DMEM respectively, incubated for 5 min, the two were mixed, and incubated again for 20 min, the mixture was added to the PK-15 cells prepared in advance, 1 mL of complete nutrient solution was added after 4 h, and the cells were cultured for 24 h before continuous passage with virus.

[0011] The fourth aspect of the present invention provides a use of the above-mentioned recombinant plasmid in the preparation of immune preparations.

[0012] Beneficial effects of the present invention:

[0013] After the recombinant plasmid of the present invention is transfected into PK-15 cells, the PCV3 recombinant virus that is successfully rescued can be obtained and can be continuously propagated. At the same time, the recombinant PCV3 virus and the PCV3 wild virus of the positive PCV3 disease material have the same biological characteristics, and cannot proliferate in the PK-15 cells after inoculation of the cells. The successful construction of the recombinant PCV3 virus provides an indispensable biological material for conducting pig infection experiments and subsequent vaccine development, breaking through the bottleneck of pig infection experiments and the development of immune preparations such as vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0015] Figures 1A to 1C Schematic diagram of IFA, IPMA and Western blot identification according to an embodiment of the present invention, wherein: Figure 1A for IFA detection (400×); Figure 1B for IPMA detection (400×); Figure 1C Western blot identification: 1. Negative control; 2. pCAGGS-PCV3-Cap positive control; 3. PCV3 recombinant virus.

[0016] Figure 2 is a schematic diagram of a transmission electron microscope observation (100000×) of an embodiment of the present invention;

[0017] FIG. 3A to FIG. 3B This is a schematic diagram of PCR detection of PCV3 in an embodiment of the present invention, wherein: Figure 3AM.DL2000DNAMarker; 1. Negative control; 2. Positive control; 3-15. PK-15 cells with virus were cultured for 3-15 generations; Figure 3B M.DL2000DNA Marker; 1. Negative control; 2. Positive control; 3-12. PK-15 cells with virus were cultured for 16-25 generations;

[0018] Figure 4 A schematic diagram of IFA detection of PK-15 cells infected with porcine circovirus type 3 obtained in the present invention;

[0019] Figure 5 Schematic diagram of IFA detection of PK-15 cells infected with wild-type PCV3 virus. DETAILED DESCRIPTION

[0020] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] The present invention relates to the successful rescue of porcine circovirus type 3 recombinant virus by infectious cloning technology and the systematic biological identification. The full-length sequence of PCV3 virus genome is cloned into pBluescript SK vector, and the successfully constructed recombinant plasmid is transfected into PK-15 cells, and the transfected cells are continuously passaged with the virus. IFA, IPMA and Western blot identification are performed by using the PCV3 specific monoclonal antibody prepared in the early stage of this embodiment. Specific fluorescence in the cells continuously passaged after transfection can be observed in IFA, brown-red particles are observed by IPMA color development, and specific Cap protein target bands can be detected by Western blot, proving that the PCV3 virus has been successfully recombined in this study. After the recombinant virus is purified by sucrose density gradient centrifugation, transmission electron microscopy observation is performed, and round PCV3 virus particles of about 17nm can be observed. PCR detection results show that the recombinant virus can be continuously passed in cells to 25 generations. The SYBRGreen absolute fluorescence quantitative PCR detection method of ORF2 gene (encoding Cap protein) established in the early stage of this embodiment is used to determine the copy number of the recombinant virus. As the cell passage continues, the copy number of the virus gradually decreases. After the PCV3 recombinant virus and PCV3 wild virus were infected with PK-15 cells, cytoplasmic fluorescence was observed by IFA. With the increase of infection time, the number of virus copies showed a downward trend, indicating that the two viruses have the same infection characteristics. In summary, the recombinant virus can be successfully rescued in PK-15 cells and can be continuously passaged, but the recombinant PCV3 virus cannot proliferate in PK-15 cells after inoculation.

[0022] Embodiment 1 Materials and methods used in the embodiment

[0023] 1 Materials and methods

[0024] 1.1 Materials

[0025] The pCAGGS-PCV3-Cap eukaryotic plasmid was used as the sample of the positive control group. The hybridoma cell line (2E6) of the PCV3-specific monoclonal antibody was deposited as CCTCC NO: C2022379. The above samples or experimental materials with the same function can also be obtained by technicians in this field through other public channels. Sheep anti-mouse IgG-HRP was purchased from Cell Signaling Technology. Transfection reagents Invitrogen lipo2000 and SYBR Green Mix were purchased from Thermo Scientific, FITC fluorescent mouse secondary antibody was purchased from Proteintech, DAPI cell nuclear staining solution was purchased from Jiangsu Keygen Biotechnology Co., Ltd., AEC color development solution was purchased from Beijing Solebow Technology Co., Ltd., and viral DNA extraction kit was purchased from Omega Bio-Tek.

[0026] 1.2 Construction of infectious clone plasmid

[0027] The PCV3 full-length gene sequence was synthesized by adding a molecular marker (i.e., the sequence from positions 1343 to 1346 in SEQ ID: No. 1, which is different from the wild-type PCV3 virus sequence) and cloned into the pBluescript SK vector through the EcoRI and SpeI restriction sites. After sequencing of the target gene, it was confirmed that the synthesized plasmid gene sequence was completely matched.

[0028] 1.3 Virus rescue

[0029] The constructed infectious clone plasmid was transfected into PK-15 cells for cell passage with virus. The transfection process was as follows: PK-15 cells were plated on a six-well cell culture plate. When the cell confluence reached about 80%, the supernatant was discarded, washed three times with PBS, 1 mL of DMEM nutrient solution without double antibody and serum was added, and placed in a 37°C, 5% CO2 incubator for standby use; 3.5 μL of transfection reagent and 4 μL of plasmid were added to 50 μL of DMEM respectively, incubated for 5 minutes, the two were mixed, and incubated again for 20 minutes, and the mixture was added to the PK-15 cells prepared in advance. After 4 hours, 1 mL of complete nutrient solution was added, and the culture was continued for 24 hours before continuous passage with virus.

[0030] 1.4 Indirect immunofluorescence (IFA) assay

[0031] The cells were subcultured to the third generation with the virus, and 96-well plates were laid and cultured for 24 hours. The supernatant was discarded, and the cells were fixed with 4% paraformaldehyde for 20 minutes, and washed 3 times with PBST, each time for 5 minutes. 0.5% TritonX-100 was treated at room temperature for 20 minutes, and washed 3 times with PBST, each time for 5 minutes. 2E6 monoclonal antibody was used as the primary antibody, incubated at 4°C overnight, and washed 3 times with PBST, each time for 5 minutes. FITC mouse secondary antibody was used as the secondary antibody, incubated at 37°C for 1 hour, and the secondary antibody was discarded. 50L DAPI was added to each well, and the cells were acted at room temperature for 5 minutes. The cells were washed 3 times with PBST, each time for 5 minutes, and observed with a fluorescence microscope.

[0032] 1.5 Immunoperoxidase monolayer assay (IPMA) detection

[0033] The third generation of PK-15 cells with virus were plated in a 96-well plate. When the cell confluence was above 80%, the medium was discarded and methanol containing 1% H2O2 was added to each well for fixation. After 15 min, the fixative was discarded and the cells were washed 3 times with PBST and 200 μL / well of 5% skim milk was added. -1, blocked overnight at 4°C. Discard the blocking solution, wash 3 times with PBST, add 0.5% TritonX-100 to permeabilize the membrane, wash 3 times with PBST, dilute 2E6 monoclonal antibody 1:1000, 100 μL / well -1 Add to the cell plate and incubate at 37°C for 1 hour. Wash 3 times with PBST and dilute HRP-labeled goat anti-mouse enzyme-labeled secondary antibody at 1:10000, 100 μL / well -1 Add to the cell plate and incubate at 37°C for 45 min. Wash 3 times with PBST, 100 μL / well -1 Add AEC color developing solution, incubate at 37°C in the dark for 15 min, wash with ultrapure water three times, and observe the results with an inverted microscope.

[0034] 1.6 Western blot identification

[0035] The eukaryotic plasmid pCAGGS-PCV3-Cap was transfected into PK-15 cells, and the transfected cell protein was collected as a positive control. 2E6 monoclonal antibody was used as the primary antibody and HRP-labeled goat anti-mouse was used as the secondary antibody to identify the expression of PCV3-Cap protein in the third-generation PK-15 cells carrying the virus.

[0036] 1.7 Transmission electron microscopy observation

[0037] The cells with the virus were repeatedly frozen and thawed, centrifuged at 10000rpm for 30min at 4℃, and the supernatant was collected to remove the cell debris. The collected supernatant was ultracentrifuged at 200000g for 3h at 4℃, and the supernatant was discarded and the precipitate was resuspended in PBS. 30%, 40%, 50% and 60% sucrose solutions were prepared, and the resuspended precipitate was centrifuged at 200000g for 3h at 4℃ sucrose density gradient. Samples with different sucrose concentrations were collected, 10 times the volume of PBS was added, and ultracentrifuged at 200000g for 3h at 4℃, and the precipitate was resuspended in PBS. The samples required for identification were in the 30% to 40% sucrose layer. The identified samples were negatively stained and observed by transmission electron microscopy.

[0038] 1.8 Viral DNA extraction and PCR detection

[0039] After the cells were passaged with the virus, they were repeatedly frozen and thawed, centrifuged at 6000 rpm and 4°C for 10 min, and the supernatant was used to extract viral DNA according to the kit instructions. Specific primers F: CACTTCATTACCCGCCTAAACGA, R: CGGGACATAAATGCTCCAAAG were designed for PCR detection.

[0040] 1.9 Viral copy number determination

[0041] The recombinant plasmid was constructed with the ORF2 gene encoding the PCV3-Cap protein, and the SYBRGreen absolute fluorescence quantitative PCR detection method for the PCV3 gene was successfully established. The full-length PCV3-Cap protein gene ORF2 was connected to the T vector, and the sequencing alignment was correct to construct the standard plasmid. The plasmid concentration was determined using a K5500 ultra-micro spectrophotometer, and the plasmid copy number was calculated according to the formula to be 4.8×10 11 copies / μL, using 4.8×10 9 ~4.8×10 1 The standard plasmid with 100 copies / μL was used as a template for real-time fluorescence quantitative PCR amplification to establish a standard curve. The logarithm of the initial concentration of the standard plasmid was used as the horizontal axis and the fluorescence Ct value was used as the vertical axis to draw a curve. The linear relationship of the standard curve was: y = -3.3342x + 41.851, and the correlation coefficient R 2 =0.9989.

[0042] 1.10 Comparison of infection characteristics between recombinant viruses and wild-type viruses

[0043] PCV3-positive samples were identified. After testing, only samples that were PCV3-positive and other pathogen-negative samples were infected with PK-15 cells. PCV3 recombinant virus was also used to infect PK-15 cells synchronously. The number of infected virus copies was 1×10 8 IFA observation and virus copy number calculation were performed at different time points after infection.

[0044] Example 2 Experimental results

[0045] 2.1 Identification of PCV3 by IFA, IPMA and Western blot

[0046] After the virus was rescued, it was cultured to the third generation and identified with PCV3-specific monoclonal antibodies. The IFA results showed that specific fluorescence ( Figure 1A ), after IPMA color development, the cells that were cultured with the virus were stained brown-red ( Figure 1B ), Western blot can detect specific target bands ( Figure 1C ), the above results show that the PCV3 recombinant virus was successfully rescued.

[0047] 2.2 Observation of PCV3 virus particles by transmission electron microscopy

[0048] After repeated freezing and thawing of the virus-carrying cells, the virus particles were released into the supernatant. The supernatant was centrifuged by sucrose density gradient and then observed by transmission electron microscopy. Purified PCV3 virus particles ( Figure 2 ).

[0049] 2.3 PCR detection

[0050] DNA was extracted from the recombinant PCV3 virus obtained and PCR detection was performed using specific primers. The results showed that the recombinant virus could be continuously propagated in cells for up to 25 generations ( Figure 3A and Figure 3B ).

[0051] 2.4 Viral copy number determination

[0052] The SYBR Green absolute fluorescence quantitative PCR detection method for the PCV3 gene established in the early stage of this example was used to determine the copy number of the recombinant virus from the third generation (Table 1). As the cells were continuously passaged, the virus copy number gradually decreased, indicating that the recombinant virus could be successfully rescued in PK-15 cells, but could not effectively proliferate in PK-15 cells.

[0053] Table 1 Virus copy number determination

[0054] Table 1 Determination of viral copies

[0055]

[0056]

[0057] 2.5 Infectious characteristics of recombinant viruses and wild-type viruses

[0058] After PCV3 recombinant virus and PCV3 wild virus in positive samples infected PK-15 cells, IFA observed cytoplasmic fluorescence ( Figure 4 and Figure 5 ), the virus copy number at different time points after infection was calculated and it was found that with the increase of infection time, the virus copy number showed a downward trend (Table 2). In summary, the two viruses have the same infection characteristics and neither can replicate in PK-15 cells.

[0059] Table 2 Determination of viral copies after infection

[0060]

[0061] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0062] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A recombinant plasmid of porcine circovirus type 3, characterized in that: The gene sequence of SEQ ID No. 1 was cloned into the pBluescript SK vector through the EcoRI and SpeI restriction sites to obtain a recombinant plasmid.

2. Use of the recombinant plasmid as claimed in claim 1 in rescuing porcine circovirus type 3 virus.

3. The use of the recombinant plasmid according to claim 1, characterized in that: The recombinant plasmid is transfected into PK-15 cells, and the cells are passaged with virus, thereby obtaining porcine circovirus type 3 recombinant virus with infectious activity.

4. The use according to claim 3, characterized in that: The method for transfecting the recombinant plasmid into PK-15 cells comprises the following steps: PK-15 cells were plated in a six-well cell culture plate. When the cell confluence reached about 80%, the supernatant was discarded, the cells were washed three times with PBS, 1 mL of DMEM nutrient solution without double antibody and serum was added, and the cells were placed in a 37°C, 5% CO2 incubator for later use. 3.5 mL of transfection reagent and 4 mL of plasmid were added to 50 mL of DMEM respectively, and incubated for 5 min. After mixing the two, they were incubated again for 20 min, and the mixture was added to the PK-15 cells prepared in advance. After 4 h, 1 mL of complete nutrient solution was added, and the cells were cultured for another 24 h before continuous passage with virus.

Images