A DNA standard for detecting human ALK-E6;A20 fusion gene and its preparation method and application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a DNA standard for detecting human ALK-E6; A20 fusion gene, and a preparation method and application thereof. The DNA standard is specifically: ALK (E6; A20) ‑1%, ALK (E6; A20) ‑2%, ALK (E6; A20) ‑5%. The DNA standard product for detecting human ALK fusion gene mutation prepared by the present invention has high accuracy and good uniformity. The present invention establishes a DNA standard product for detecting human ALK fusion gene mutation for the first time; the quantitative standard for detecting ALK (E6; A20) fusion gene mutation in the present invention has accurate value and good applicability. It can be used for verification and performance evaluation of digital PCR or other methods.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a DNA standard for detecting human ALK-E6; A20 fusion gene, and a preparation method and application thereof. Background Art

[0002] Anaplastic lymphoma kinase (ALK) fusion genotype lung cancer has become another molecular subtype of lung cancer after epidermal growth factor (EGFR) mutation lung cancer, with clear molecular targets, target detection technology and marketed targeted drugs.

[0003] Anaplastic lymphoma kinase (ALK) is a 1,620 amino acid transmembrane protein consisting of an extracellular ligand binding region, a transmembrane region, and an intracellular tyrosine kinase region, and belongs to the insulin receptor family. Echinoderm microtubule-associated protein like 4 (EML4) belongs to the echinoderm microtubule-associated protein family and consists of three parts: the N-terminal base region (hydrophobic echinoderm microtubule-associated protein region) and the WD-repeat region. Studies have shown that in the EML4-ALK fusion gene, the above three parts are all related to the formation of tumors, among which the N-terminal base region plays the most important role.

[0004] Detection of ALK fusion gene mutations has important guiding significance for the occurrence and development of tumors and for personalized tumor treatment and prognosis. In recent years, in the field of molecular targeted therapy for lung cancer, research hotspots have been focused on targets such as EGFR, K-ras and VEGF, and many molecular targeted drugs targeting these targets have emerged. The non-coexistence of ALK fusion gene with EGFR mutation and K-ras mutation and the distinct clinical characteristics of patients with this gene suggest that this target is a molecular marker with high specificity for lung adenocarcinoma. The small molecule tyrosine kinase inhibitor crizotinib has a significant effect on lung cancer patients with ALK fusion gene mutations. Crizotinib is an ATP-competitive tyrosine kinase inhibitor that can specifically target and inhibit ALK as well as signaling pathways such as c-MET and ROS1. Crizotinib was approved for marketing by the US Food and Drug Administration (FDA) and the China Food and Drug Administration (CFDA) in 2011 and 2013, respectively, for the treatment of patients with locally advanced or metastatic NSCLC expressing EML4-ALK.

[0005] Clinical practice has shown that there are differences in the efficacy of molecular targeted drugs among various tissue types of NSCLC. For patients with EGFR-negative or unknown gene status, or EGFR gene mutations and primary or secondary resistance after EGFR-TKI treatment, ALK fusion gene testing is recommended. In 2012, according to the National Comprehensive Cancer Network (NCCN) NSCLC clinical guidelines, patients with advanced NSCLC should undergo EML4-ALK testing before starting treatment, and positive patients are recommended to receive crizotinib treatment first. About 40% of ALK-positive NSCLC patients are primary resistant to crizotinib. The results of a phase I clinical study of the new generation ALK inhibitor ceritinib showed that it has a good effect on patients with crizotinib resistance and central nervous system metastatic lesions.

[0006] It is found in about 5% of NSCLC patients. The positive rate of ALK rearrangement is about 3-5%, and the probability of EML4-ALK fusion is higher in adenocarcinoma patients and patients who have never smoked or smoked lightly.

[0007] The EML4-ALK fusion gene is located on the short arm of chromosome 2 (2p21 and 2p23), about 12Mb apart, with a fragment of EML4 at its 5' end and a fragment of ALK at its 3' end. The inverted EML4 gene fragment is connected to the residual ALK fragment, forming an inverted fusion. The EML4 gene can be broken at multiple sites, and the broken amino-terminal fragment replaces the extracellular domain and transmembrane domain of ALK, directly connecting to the intracellular catalytic domain located in the 20th exon of ALK, forming a variety of EML4-ALK fusion gene mutants. The fused EML4 promoter is located upstream of the ALK tyrosine kinase, thereby activating the fusion gene and expressing the EML4-ALK fusion protein. The signal transduction pathways of EML4-ALK are PI3-K / Akt, STAT3 / 5, Ras-MEK and PLC-γ / PIP2, etc. These pathways are closely related to cell survival, proliferation and migration. The dimer formed by the EML4 extracellular structure causes the ALK receptor to be continuously phosphorylated, thereby activating the above cell signaling pathways.

[0008] In NSCLC, the fusion points of EML4 and ALK genes are different, with more than 15 variant types, the most common variants being V1 (E13; A20) and V3 (E6; A20). EML4 breaks at exon 13 to form a 3.6kb fragment, which fuses with the 297bp fragment formed by the break of ALK at exon 20 to form E13; A20. Similarly, exon 6 of EML4 connects with exon 20 of ALK to form E6; A20. This fusion can form two transcripts, EML4 exon 6ins33; ALK exon 20 and EML4 exon 6; ALK exon 20. EML4-ALK gene fusion can promote the expression of oncogenic fusion proteins caused by the ALK gene, leading to the activation and dysregulation of gene expression and signals, thereby promoting the proliferation and survival of tumor cells expressing these proteins.

[0009] As an important tool for prevention, diagnosis, treatment monitoring, prognosis observation, health status evaluation and prediction of genetic diseases, the quality control of in vitro diagnostic reagents is very important. The survey shows that even though the Ministry of Health has standardized the management of clinical gene amplification testing laboratories since 2002 and put forward quality assurance requirements, there are still problems such as some testing departments operating independently, lacking unified standards, indoor quality control and formalization of analysis. In vitro diagnostic reagent standard substances play a very critical role in controlling the quality of in vitro diagnostic reagent products and ensuring the accuracy of clinical test results. Due to many constraints, the current supply of national standard substances for diagnostic reagents cannot fully meet the needs of registration, production and quality control. Summary of the invention

[0010] In order to solve the above problems, the purpose of the present invention is to provide a DNA standard product for detecting human ALK fusion gene mutations, which has high accuracy and good uniformity. The present invention is the first to establish a DNA standard product for detecting human ALK fusion gene mutations.

[0011] The present invention also provides a method for preparing a DNA standard product for detecting human ALK fusion gene mutation.

[0012] The technical solution adopted by the present invention to achieve the above-mentioned purpose is:

[0013] The present invention provides a DNA standard for detecting a human ALK (E6; A20) fusion gene mutation. The sequence of the ALK (E6; A20) fusion gene is (as shown in SEQ IN NO. 1):

[0014] GCCTTATGACCTAGGCTGAATGACAATGTCTCTGAGTGGTTTTCTACTCTAAATATAGTAACTAGTATCCTCCTGGCTGATCAGGGGGTGGGGAGCTCCTTCAGTGTCCATCACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCT.

[0015] The DNA standard for detecting human ALK (E6; A20) fusion gene mutation provided by the present invention is specifically:

[0016]

[0017] In the above standard product prepared by the present invention, wherein:

[0018] The gene sequence of the NCIH2228 gDNA (as shown in SEQ IN NO.2) is:

[0019] CTGGTCCGAAAACTTTTTTTTTTTTTTTAAATAGAGTCGGCGGTATGTGATAGGAAGAGCAGTGAATGGGGAATAACTGTGTTTAGTGGTTGGTCCTG GCTCTTATGCATAATAGCCTTATGACCTAGGCTGAATGACAATGTCTCTGAGTGGTTTTCTACTCTAAATATAGTAACTAGTATCCTCCTGGCTGATCAGGGGGTGGGGAGCTCCTTCAGTGTCCAT CACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCTTCCACCGGCGCAGCTCCTGTTTGGCTCCCACCCTATGTAATGCACTAGCCCACTCTTCCCCAAACCAGCCC

[0020] The sequence of the HEK293 gDNA (as shown in SEQ IN NO. 3) is: CTGGTCCGAAAACTTTTTTTTTTTTTTTTAAATAGAGTCGGCGGTATGTGATAGGAAGCAGTGAATGGGGAATAACTGTGTTTAGTGGTTGGTCCTGGCTCTTATGCATAATAGCCTTATGACCTAGGCTGAATGACAATGTCTCTGAGTGGTTTTCTACTCTAAATATAGTAACTAAAAGCTTATTTCACATGACTACTGAAGGATGAAATAATATATATGAAATATAAATTGAAATATAGTGGCATCTAC Further, the primer probe set for standard determination is:

[0021] Detection site upstream primer (as shown in SEQ IN NO.4):

[0022] 5'CAGTGAATGGGGAATAACTGTGTT 3'

[0023] Detection site downstream primer (as shown in SEQ IN NO.5):

[0024] 5'GCCAGGAGGATACTAGTTACTATATTTAGA 3'

[0025] Detection site probe-FAM (as shown in SEQ IN NO.6):

[0026] 5'TAGTGGTTGGTCCTGGCTTCTATGC 3'-BHQ1

[0027] Internal reference upstream primer (as shown in SEQ IN NO.7):

[0028] 5'AACCACCAGAACATTGTTCGC 3'

[0029] Internal reference downstream primer (as shown in SEQ IN NO.8):

[0030] 5'GTCTCTCGGAGGAAGGACTTGA 3'

[0031] Internal reference probe-VIC (as shown in SEQ IN NO.9):

[0032] 5'GCATTGGGGTGAGCCTGCAAT 3'-BHQ1.

[0033] The present invention also provides a method for preparing a DNA standard for detecting a human ALK (E6; A20) fusion gene mutation, comprising the following steps:

[0034] (1) Genomic DNA of NCIH2228 cell line containing ALK (E6; A20) fusion gene and genomic DNA of wild-type HEK293 cell line were extracted as templates, and the ALK (E6; A20) gene fusion site and wild-type cell line genomic DNA were sequenced and verified by Sanger sequencing;

[0035] (2) Analyze the base sequence of the EML4-AKL fusion site and design primers and probes;

[0036] (3) The mutation frequency of the ALK (E6; A20) fusion gene in the DNA of the NCIH2228 cell line and the HEK293 wild-type cell line was measured by digital PCR, and the results were repeated three times. The average of the three measurements was taken as the mutation frequency of the NCIH2228 cell line.

[0037] (4) NCIH2228 cell line DNA and HEK293 wild-type cell line DNA were mixed in different proportions to obtain ALK (E6; A20) fusion gene DNA standards with mutation frequencies of 1%, 2%, and 5%, respectively. Digital PCR was used to verify the gene mutation frequency and the uniformity of the standards.

[0038] Furthermore, the amplification system of the digital PCR is:

[0039] Reagents Specification Dosage 2XDroplet PCR Supermix for Probes(No dUTP) 2X 10μL Primer upstream of detection site 20μM 0.8μL Detection site downstream primer 20μM 0.8μL Detection site probe-FAM 10μM 0.5μL Internal reference upstream primer 20μM 0.8μL Internal reference downstream primer 20μM 0.8μL Internal reference probe-VIC 10μM 0.5μL DNA template - 25ng <![CDATA[ddH 2 The]]> - Up to 20μL

[0040] The beneficial effects of the present invention are:

[0041] (1) The DNA standard product for detecting human ALK fusion gene mutation prepared by the present invention has high accuracy and good uniformity. The present invention is the first to establish a DNA standard product for detecting human ALK fusion gene mutation;

[0042] (2) The quantitative standard for detecting ALK (E6; A20) fusion gene mutation in the present invention has accurate measurement value and good applicability, and can be used for verification and performance evaluation of digital PCR or other methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 A two-dimensional scatter plot showing the frequency of ALK (E6; A20) fusion gene mutation in HEK293 wild-type cell line determined by digital PCR;

[0044] Figure 2A two-dimensional scatter plot showing the frequency of ALK (E6; A20) fusion gene mutation in NCIH2228 cells determined by digital PCR;

[0045] Figure 3 To show the two-dimensional scatter plot of the mutation frequency of the prepared standard ALK (E6; A20)-1% fusion gene determined by the digital PCR method;

[0046] Figure 4 To show the two-dimensional scatter plot of the mutation frequency of the prepared standard ALK (E6; A20)-2% fusion gene determined by the digital PCR method;

[0047] Figure 5 A two-dimensional scatter plot showing the mutation frequency of the prepared standard ALK (E6; A20)-5% fusion gene determined by the digital PCR method. DETAILED DESCRIPTION

[0048] The technical solution of the present invention is further explained and illustrated by means of specific embodiments below.

[0049] Example 1

[0050] 1. Cell lines and culture media

[0051] The NCIH2228 cell line was purchased from Beijing Beina Chuanglian Biotechnology Research Institute. The required culture medium was 1640+10% FBS, 5% CO 2 , cultured at 37°C. HEK293 wild-type cell line was purchased from Hunan Fenghui Biotechnology Co., Ltd., and the culture medium was MEM+10% FBS, 5% CO 2 , cultured at 37°C. After two weeks of cell culture, the cells were collected and gDNA was extracted from the cells as raw materials for preparing standards.

[0052] 2. DNA extraction and Sanger sequencing

[0053] The genomic DNA of the cell line was extracted using the genome purification kit of Kangwei Century Company, and the absorbance of the genome at 260nm and 280nm was measured by NanoDrop micro-ultraviolet spectrophotometer. The OD260 / OD280 was between 1.7 and 1.9, and the DNA purity met the requirements. The concentration of cell genomic DNA was determined by Qubit fluorometer, and the results were repeated three times, and the average was taken as the final concentration of cell genomic DNA. The results of genome quantification are shown in Table 1, and the verification of genome purity is shown in Table 2. The genomic DNA was verified by Sanger sequencing, and the sequence derived by sequencing is as follows:

[0054] The ALK (E6; A20) fusion gene sequencing sequence of the NCIH2228 cell line DNA is as follows (the unlined part is the EML4 gene fragment, and the underlined part is the ALK gene fragment):

[0055] CTGGTCCGAAAACTTTTTTTTTTTTTTTAAATAGAGTCGGCGGTATGTGATAGGAAGAGCAGTGAATGGGGAATAACTGTGTTTAGTGGTTGGTCCTGGCTCTTATGCATAATAGCCTTATGACCTAGGCTGAATGACAATGTCTCTGAGTGGTTTTCTACTCTAAATATAGTAACTA GTATCCTCCTGGCTGATCAGGGGGTGGGGAGCTCCTTCAGTGTC CATCACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCTTCCACCGGCGCAGCTCCT GTTTGGCTCCCACCCTATGTAATGCACTAGCCCACTCTTCCCCCAAACCAGCCC

[0056] The EML4 gene sequencing sequence of HEK293 wild-type cell line DNA is as follows: (The underlined part is the EML4 gene fusion fragment)

[0057] CTGGTCCGAAAACTTTTTTTTTTTTTTTAAATAGAGTCGGCGGTATGTGATAGGAAGAGCAGTGAATG GGGAATAACTGTGTTTAGTGGTTGGTCCTGGCTCTTATGCATAATAGCCTTATGACCTAGGCTGAATGACAATGTCT CTGAGTGGTTTTCTACTCTAAATATAGTAACTA AAAGCTTATTTCACATGACTACTGAAGGATGAAAATAATATATATGAAATATAAATTGAAATATAGTGGCATCTAC

[0058] Sequence comparison showed that the NCIH2228 cell line contained the ALK (E6; A20) fusion gene, while the HEK293 wild-type cell line did not have the ALK (E6; A20) fusion gene.

[0059] Table 1 Genome quantification results

[0060]

[0061] Table 2 Genome purity verification

[0062]

[0063] According to the measurement results, the OD260 / OD280 of the NCIH2228 cell line DNA and the HEK293 cell line DNA were between 1.7 and 1.9, so the DNA purity met the requirements.

[0064] 3. Analyze the base sequence of the EML4-AK fusion position and design primer probes using PrimerPremier5 software. You can design on the forward or reverse chain and select according to the SNP near the mutation site to ensure that the primer probe does not contain high-frequency SNP sites.

[0065] ALK (E6; A20) fusion gene sequence (the unlined part is the EML4 gene fragment, and the underlined part is the ALK gene fragment)

[0066] CTGGTCCGAAAACTTTTTTTTTTTTTTTAAATAGAGTCGGCGGTATGTGATAGGAAGAGCAGTGAATGGGGAATAACTGTGTTTAGTGGTTGGTCCTGGCTCTTATGCATAATAGCCTTATGACCTAGGCTGAATGACAATGTCTCTGAGTGGTTTTCTACTCTAAATATAGTAACTA GTATCCTCCTGGCTGATCAGGGGGTGGGGAGCTCCTTCAGTGTC CATCACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCTTCCACCGGCGCAGCTCCT GTTTGGCTCCCACCCTATGTAATGCACTAGCCCACTCTTCCCCCAAACCAGCCC

[0067] Detection site upstream primer: 5'CAGTGAATGGGGAATAACTGTGTT 3'

[0068] Detection site downstream primer: 5'GCCAGGAGGATACTAGTTACTATATTTAGA 3'

[0069] Detection site probe-FAM: 5'TAGTGGTTGGTCCTGGCTCTTATGC 3'-BHQ1

[0070] Internal reference upstream primer: 5'AACCACCAGAACATTGTTCGC 3'

[0071] Internal reference downstream primer: 5'GTCTCTCGGAGGAAGGACTTGA 3'

[0072] Internal reference probe-VIC: 5'GCATTGGGGTGAGCCTGCAAT 3'-BHQ1

[0073] 4. The mutation frequency of the ALK (E6; A20) fusion gene in the DNA of the NCIH2228 cell line and the HEK293 wild-type cell line was determined by the digital PCR method. The amplification system is shown in Table 1. First, 20 μL of the prepared PCR reaction solution containing the DNA template was added to the well marked "Sample" on the droplet generation card, and then 70 μL of droplet generation oil was added to the well marked "Oil", and then placed in the droplet generator to generate droplets. After the droplets were generated, they were transferred to a 96-well plate, the sealing film of the 96-well plate was sealed with a heating device, and placed on an ordinary PCR instrument for amplification. The amplification conditions were: 95°C, 3min; 40 cycles including 95°C, 30s, 60°C, 90s; 98°C, 5min.

[0074] Table 3 ALK (E6-A20) fusion gene digital PCR amplification system

[0075] Reagents Specification Dosage 2XDroplet PCR Supermixfor Probes(No dUTP) 2X 10μL Primer upstream of detection site 20μM 0.8μL Detection site downstream primer 20μM 0.8μL Detection site probe-FAM 10μM 0.5μL Internal reference upstream primer 20μM 0.8μL Internal reference downstream primer 20μM 0.8μL Internal reference probe-VIC 10μM 0.5μL DNA template - 25ng <![CDATA[dd H 2 The]]> - Up to 20μL

[0076] After PCR amplification, the droplets were read and data was analyzed. QuantaSofi software was used for data analysis and processing.

[0077] 5. The mutation frequency of ALK (E6; A20) fusion gene in NCIH2228 cell line DNA and HEK293 wild-type cell line DNA was determined by digital PCR, and the results were repeated 3 times. The average of the 3 measurements was taken as the final mutation frequency. The two-dimensional scatter plot of the mutation frequency determined by digital PCR is shown in Figure 1-2 No FAM-labeled positive droplets were detected in the DNA of the HEK293 wild-type cell line, indicating that the DNA of the HEK293 wild-type cell line did not contain the ALK (E6; A20) fusion gene; the DNA of the NCIH2228 cell line was measured three times, and the measurement results are shown in Table 2. The calculation showed that the mutation frequency of the ALK (E6; A20) fusion gene was 24.20%.

[0078] Table 4 Digital PCR results

[0079]

[0080] 6. Preparation of quantitative standards for ALK (E6; A20) fusion gene mutation

[0081] Quantitative standards were prepared according to the mutation frequency of the ALK (E6; A20) fusion gene, as shown in Table 5.

[0082] Table 5 Preparation of quantitative DNA standards for ALK (E6; A20) fusion gene mutation

[0083]

[0084] 7. The digital PCR method was used to verify the mutation frequency of the quantitative DNA standards of different ALK (E6; A20) fusion genes. The two-dimensional scatter plot of the mutation frequency determined by digital PCR is shown in Figure 3-5 The acceptable fluctuation range of mutation frequency of three standards, ALK (E6; A20) -1%, ALK (E6; A20) -2%, and ALK (E6; A20) -5%, is shown in Table 6. The digital PCR method was repeated 3 times, and the average of the 3 measurement results was taken as the final mutation frequency of the DNA standard. The measurement results are shown in Table 7.

[0085] Table 6 Acceptable fluctuation range of mutation frequency of ALK (E6-A20) standard

[0086] Standards Gene mutation frequency Acceptable fluctuation range ALK (E6; A20) - 1% 1％ 0.8％～1.2％ ALK (E6; A20) - 2% 2％ 1.6％～2.4％ ALK (E6; A20) - 5% 5％ 4％～5％

[0087] Table 7 Mutation frequency determination of standard products

[0088]

[0089] The quantitative standard for detecting ALK (E6; A20) fusion gene mutation in the present invention has accurate value and good applicability, and can be used for verification and performance evaluation of digital PCR or other methods.

Claims

1. A method for preparing a DNA standard for detecting human ALK (E6; A20) fusion gene mutation, characterized in that: The following steps are involved: (1) The genomic DNA of NCIH2228 cell line containing ALK (E6; A20) fusion gene and the genomic DNA of wild-type HEK293 cell line were extracted as templates, and the ALK (E6; A20) gene fusion site and the genomic DNA of wild-type cell line were sequenced and verified by Sanger sequencing; (2) Analyze the base sequence of the EML4-AKL fusion site and design primers and probes; (3) The mutation frequency of the ALK (E6; A20) fusion gene in the DNA of the NCIH2228 cell line and the HEK293 wild-type cell line was measured by digital PCR, and the results were repeated three times. The average of the three measurements was taken as the mutation frequency of the NCIH2228 cell line. (4) NCIH2228 cell line DNA and HEK293 wild-type cell line DNA were mixed in different proportions to obtain ALK (E6; A20) fusion gene DNA standards with mutation frequencies of 1%, 2%, and 5%, respectively. Digital PCR was used to verify the gene mutation frequency and the homogeneity of the standards. The sequence of the ALK (E6; A20) fusion gene is: GCCTTATGACCTAGGCTGAATGACAATGTCTCTGAGTGGTTTTCTACTCTAAATATAGTAACTAGTATCCTCCTGGCTGATCAGGGGGTGGGGAGCTCCTTCAGTGTCCATCACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCT; The DNA standards are specifically: 。 The gene sequence of the NCIH2228 gDNA is: CTGGTCCGAAAACTTTTTTTTTTTTTTTAAATAGAGTCGGCGGTATGTGATAGGAAGAGCAGTGAATGGGGAATAACTGTGTTTAGTGGTTGGTCCTGGCTCTTATGCATAATAGCCTTATGACCTAGGCTGAATGACAATGTCTCTGAGTGGTTTTCTACTCTAAATATAGTAA CTAGTATCCTCCTGGCTGATCAGGGGGTGGGGAGCTCCTTCAGTGTCCATCACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCTTCCACCGGCGCAGCTCCTGTTTGGCTCCCACCCTATGTAATGCACTAGCCCACTCTTCCCCAAACCAGCCC The sequence of the HEK293 gDNA is: CTGGTCCGAAAACTTTTTTTTTTTTTTTTTAAATAGAGTCGGCGGTATGTGATAGGAAGCAGTGAATGGGGAATAACTGTGTTTAGTGGTTGGTCCTGGCTCTTATGCATAATAGCCTTATGACCTAGGCTGAATGACAATGTCTCTGAGTGGTTTTCTACTCTAAATATAGTAACTAAAAGCTTATTTCACATGACTACTGAAGGATGAAATAATATATATGAAATATAAATTGAAATATAGTGGCATCTAC; the primer probe set for standard determination is: Detection site upstream primer: 5' CAGTGAATGGGGAATAACTGTGTT 3' Detection site downstream primer: 5' GCCAGGAGGATACTAGTTACTATATTTAGA 3' Detection site probe-FAM: 5'TAGTGGTTGGTCCTGGCTCTTATGC 3'-BHQ1 Internal reference upstream primer: 5' AACCACCAGAACATTGTTCGC 3' Internal reference downstream primer: 5' GTCTCTCGGAGGAAGGACTTGA 3' Internal reference probe-VIC: 5′ GCATTGGGGTGAGCCTGCAAT 3′-BHQ1; The amplification system of the digital PCR is: 。

Images