Non-toxic aflatoxin, its biological preparations and their application in peanut disease prevention and control and peanut yield improvement

Abstract

The invention discloses a non-toxic aflatoxin, a biological preparation thereof and its application in peanut disease prevention and control and improving peanut yield, and belongs to the field of microbial technology. The non-toxic aflatoxin of the present invention is an Aspergillus flavus APqn-1 strain, and the deposit number is CGMCC NO.40535. The strain can not only inhibit the growth and toxin production of toxin-producing aflatoxin, but also has a preventive effect on diseases such as peanut fruit rot, root rot, and white rot. The strain is prepared into a biological preparation, which can improve the ability of the strain to resist the natural environment, can grow and reproduce rapidly in different types of soil such as dry slopes, depressions, rice fields, sandy loam, etc., and inhibit the growth and toxin production of toxin-producing aflatoxin; the germination rate and yield of peanuts after using the biological preparation are also significantly improved; the strain APqn-1 of the present invention has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a non-toxic aflatoxin fungus, a biological preparation thereof, and applications thereof in preventing and controlling peanut diseases and increasing peanut yield. Background Art

[0002] Aflatoxin (AFT) is mainly a secondary metabolite produced by Aspergillus flavus and Aspergillus parasiticus. There are more than 20 kinds of aflatoxins isolated from nature, of which the most common are group B (AFB1, AFB2, etc.) and group G (AFG1, AFG2, etc.), which have strong carcinogenicity, teratogenicity and mutagenicity. Among them, aflatoxin B1 is the most toxic and one of the strongest carcinogens in the world. Aspergillus flavus is widely present in soil, plants and fruits, and has strong vitality. Peanuts are one of the crops most susceptible to aflatoxin infection. Aflatoxin contamination will cause the quality of peanuts to decline, which has a great impact on food quality and safety. Therefore, the prevention and control of toxin-producing aflatoxin is the top priority to inhibit the contamination of agricultural products by aflatoxin.

[0003] There are many reasons why Aspergillus flavus cannot produce aflatoxin. One of the most important factors is the lack of one or some key genes in the aflatoxin synthesis gene cluster, such as the aflR gene in the aflatoxin synthesis gene cluster. This gene is generally considered to be the most critical regulatory gene in the aflatoxin synthesis pathway. It encodes a 47kDa zinc finger protein that can regulate the expression of most other genes in the cluster; secondary metabolite synthesis regulatory transcription factors such as veA and laeA outside the cluster also play a key regulatory role in the synthesis of aflatoxin; after the loss of these genes, the aflatoxin synthesis pathway is interrupted, so it cannot produce toxins, which is the premise for it to compete with the toxin-producing Aspergillus flavus and inhibit toxin production. Applying non-toxin-producing Aspergillus flavus or parasitic Aspergillus flavus in the field to regulate the microbial flora in the soil, gradually replace the original toxin-producing strains in the soil during the growth of crops, thereby reducing the possibility of agricultural products being infected by toxin-producing Aspergillus flavus, which is very effective for pre-production prevention and control of aflatoxin contamination of crops.

[0004] At present, there are reports at home and abroad about the use of non-toxic Aspergillus flavus for the prevention and control of toxin-producing Aspergillus flavus. As listed in Table 1, some literature reports on the effect of non-toxic Aspergillus flavus as a biocontrol agent to reduce aflatoxin contamination. These results show that non-toxic Aspergillus flavus can be used to control aflatoxin contamination in crops in different regions, but the inhibition efficiency varies greatly. This may be due to the different adaptability of strains to soil, climate and other factors in different regions. Cardwell et al. (2004) and other studies found that non-toxic Aspergillus flavus AF36 isolated from the United States can effectively inhibit the production of toxins by toxin-producing Aspergillus flavus AF13 in the United States, but it has no good biocontrol effect on the S-type toxin-producing strain BN40 in Africa. Therefore, before applying non-toxic fungi to the field, their adaptability to the local environment should be evaluated first.

[0005] Table 1 Efficacy of non-toxic Aspergillus flavus as biocontrol agent

[0006]

[0007] In addition, molds reproduce in complex and changeable natural environments, which often lead to a high rate of mutations. Some non-toxic Aspergillus flavus may undergo reversion mutations and produce toxins again. Therefore, providing a native Aspergillus flavus that does not secrete aflatoxin and preparing it into a biological agent that can adapt to a variety of complex soil environments is very important for the biological control of toxin-producing Aspergillus flavus and preventing agricultural products from being contaminated by aflatoxin.

[0008] References:

[0009] [1]Abbas HK,Zablotowicz RM,Horn BW,et al.Comparison of majorbiocontrol strains of non-aflatoxigenic Aspergillus flavus for the reduction of aflatoxins and cyclopiazonic acid in maize[J].Food Additives&Contaminants:Part A,2011,28:198-208.

[0010] [2]Donner M,Atehnkeng J,Cotty PJ,et al.Molecular characterization ofatoxigenic strains for biological control of aflatoxins in Nigeria[J].FoodAdditives&Contaminants:Part A,2010,27:576-590.

[0011] [3]Dorner JW,Cole RJ,Shasha BS,et al.Evaluation of biological controlformulations to reduce aflatoxin contamination in peanuts[J].BiologicalControl,2003,26:318-324.

[0012] [4]Alaniz Zanon MS,Chiotta ML,Chulze S,et al.Evaluation of potentialbiocontrol agent for aflatoxin in Argentinean peanuts[J].InternationalJournal of Food Microbiology,2013,162:220-225.

[0013] [5]Cotty PJ,et al.Influence of field application of an atoxigenicstrain of Aspergillus flavus on the populations of A.flavus infection cottonbolls and on aflatoxin content of cottonseed[J].Phytopathology,1994,84:1270-1277. Summary of the invention

[0014] In view of the problems existing in the prior art, the purpose of the present invention is to provide a non-toxic aflatoxin fungus, a biological preparation thereof and its application in preventing and controlling peanut diseases and increasing peanut yield.

[0015] In order to achieve the above object, the present invention adopts the following technical solution:

[0016] A non-toxic aflatoxin strain is provided, wherein the aflatoxin is the Aspergillus flavus APqn-1 strain, and its preservation number is CGMCC NO.40535.

[0017] The above-mentioned non-toxic aflatoxin fungus is used in biological control of aflatoxin, prevention and control of peanut diseases, improving peanut germination rate or increasing peanut yield.

[0018] The above-mentioned non-toxic aflatoxin fungus is used in the preparation of preparations for biological control of aflatoxin, prevention and control of peanut diseases, and increasing peanut germination rate or peanut yield.

[0019] A biological preparation, the active ingredient of which is the APqn-1 strain with the deposit number of CGMCC NO.40535.

[0020] Based on the above scheme, the number of Aspergillus flavus spores in the biological preparation is ≥10 8 Pieces / g.

[0021] Based on the above scheme, the method for preparing the biological agent is as follows:

[0022] (1) crushing the mushroom sticks after picking the edible mushrooms, mixing the mushroom sticks with distilled water in a mass ratio of 3:1-1:2, and sterilizing to obtain a microbial culture medium;

[0023] (2) Inoculate the non-toxic strain APqn-1 spore suspension onto the sterilized inoculum medium and culture until the number of Aspergillus flavus spores is ≥10 8 pcs / g medium;

[0024] (3) The culture medium for culturing the strain APqn-1 is crushed and dried to prepare a biological preparation.

[0025] The moisture content, nutrients and fluffy texture of the edible mushroom sticks after picking are conducive to the growth of non-toxic Aspergillus flavus. Different edible mushroom sticks have no effect on the growth of strain APqn-1. When the mushroom sticks and distilled water are mixed at a mass ratio of 1.5:1, the effect is best. The texture of the mushroom sticks is soft and can absorb water. During the field application process, the culture medium can absorb water for the strain, which is conducive to the growth of the strain.

[0026] The above biological agents are used in biological control of Aspergillus flavus, control of peanut diseases, improving peanut germination rate or increasing peanut yield.

[0027] Based on the above scheme, the peanut disease is at least one of fruit rot, root rot and white rot.

[0028] A method for biological control of Aspergillus flavus, control of peanut diseases, improving peanut germination rate or increasing peanut yield, wherein the biological agent is spread on the root zone of peanuts one month before peanut harvest.

[0029] Based on the above plan, the dosage of biological agents is 30kg / mu.

[0030] Advantages of the technical solution of the present invention:

[0031] The present invention isolates a non-toxic Aspergillus flavus APqn-1 strain, which can not only inhibit the growth and toxin production of toxin-producing Aspergillus flavus, but also has a preventive and therapeutic effect on peanut fruit rot, root rot, white rot and other diseases. The strain is prepared into a biological agent, which can improve the ability of the strain to resist the natural environment, can quickly grow and reproduce in different types of soil such as dry slopes, depressions, rice fields, sandy loam, etc., and inhibit the growth and toxin production of toxin-producing Aspergillus flavus; the germination rate and yield of peanuts after using the biological agent are also significantly improved; the strain APqn-1 of the present invention has a good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Growth graph of soil bacterial suspension on modified red Bengal medium;

[0033] Figure 2 The morphology of strain APqn-1 grown on modified red Bengal medium;

[0034] Figure 3 Morphology of strain APqn-1 in malt extract agar medium (MEA medium);

[0035] Figure 4 The morphology of strain APqn-1 on chloranil 18% glycerol medium (DG18 medium);

[0036] Figure 5 Morphology of strain APqn-1 in aspergillus agar basal medium (AFPA medium);

[0037] Figure 6 Determination of aflatoxin content in the fermentation broth of strain APqn-1. DETAILED DESCRIPTION

[0038] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art.

[0039] The present invention is further described in detail below in conjunction with specific examples and with reference to data. The following examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0040] Example 1 Isolation, purification and identification of strains

[0041] 1. Sample collection: Peanut planting soil was collected in Xiangzhou, Hubei Province in May 2018. For each sample (100 g), 5 sub-samples (2 cm wide and 5 cm deep soil) were taken by diagonal method within the range of 10×10 m and mixed as one sample. The collected samples were put into plastic bags, pierced with pinholes to facilitate gas exchange, transported to the laboratory, and stored at 4°C for aflatoxin screening.

[0042] 2. Isolation and purification of strains:

[0043] (1) Preparation of soil sample bacterial suspension

[0044] Take 10 g of soil sample, add 90 mL of 0.1% peptone sterile water (w / v), shake at room temperature for 30 min, and make 10 -1 Bacterial suspension; then take 0.5mL 10 -1 Add 4.5 mL of 0.1% peptone sterile water to the bacterial suspension to prepare 10 -2 Dilution of bacterial suspension; prepare 10 -3 Dilution of bacterial suspension.

[0045] (2) Isolation and purification of strains

[0046] Take 0.1mL of bacterial solution for each dilution, spread it on modified Bengal red medium, and culture it in the dark at 30℃ for 5 days. Repeat each dilution 3 times. Pick the Aspergillus flavus with yellow-green spores and perform secondary streaking on the modified Bengal red medium until a single colony is obtained. Pick a single colony of Aspergillus flavus on MEA slant test tube medium, culture it at 30℃ for 3 days, and then store it at 4℃.

[0047] The growth of soil bacteria suspension on modified Bengal red medium is shown in the figure Figure 1 shown.

[0048] The strain APqn-1 was isolated and obtained by the above method.

[0049] 3. Identification of strain APqn-1

[0050] (1) Morphological identification

[0051] Strain APqn-1 produced yellow-green spores on the modified Bengal red medium. The surface of the colony was loose and scattered. Figure 2 ), white hyphae, morphology in malt extract agar medium (MEA medium) Figure 3 As shown, yellow-green spores were produced on DG18 medium (chloranil 18% glycerol medium) Figure 4 ), producing a bright orange color reaction on AFPA medium ( Figure 5 );

[0052] (2) Physiological and biochemical identification

[0053] The strain APqn-1 was cultured in aflatoxin-producing culture medium, and the results showed that it did not produce aflatoxin.

[0054] (3) Molecular biological identification

[0055] Molecular biological identification was performed by cloning the ITS gene sequence of strain APqn-1. The primer sequences used are as follows:

[0056] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' (SEQ ID NO: 1);

[0057] ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 2).

[0058] PCR amplification conditions: PCR amplification reaction program: 94℃ pre-denaturation for 5min, 1 cycle; 94℃ denaturation for 30s, 54℃ annealing for 30s, 72℃ extension for 90s, 30 cycles; 72℃ final extension for 7min. After amplification, the product was stored at 4℃. The product was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared on BLAST researches (http: / / www.ncbi.nlm.nih.gov / ).

[0059] The sequencing revealed that the ITS sequence of the cloned strain APqn-1 was as follows:

[0060] SEQ ID NO:3(5'→3')

[0061] ACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCAC

[0062] CCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCT

[0063] CTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAG

[0064] TCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGG

[0065] CATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAA

[0066] TCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCG

[0067] AGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGG

[0068] GGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGC

[0069] TTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCC

[0070] AGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT

[0071] ITS sequence comparison showed that the ITS gene sequence of strain APqn-1 was 100% similar to the small subunit ribosomal RNA gene sequence of Aspergillus flavus strain MEBP0048.

[0072] Universal primers were used to detect the expression of toxin-producing genes in strain APqn-1. The results showed that 13 key toxin-producing genes, including norB-cypA, aflT, pksA, nor-1, fasA, fasB, aflR, aflJ, adhA, estA, norA, hypC, and hypB, were not expressed in the toxin-producing gene cluster of strain APqn-1. Therefore, this strain does not produce toxins.

[0073] Morphological identification combined with physiological and biochemical characteristics and molecular biological identification results identified strain APqn-1 as aflatoxin-free Aspergillus flavus; it was deposited on March 24, 2023 at the General Microbiology Center of China Culture Collection Administration, with the deposit number CGMCC NO.40535, and the address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the requested depository unit is Qingdao Agricultural University.

[0074] Example 2 Identification of toxin production by strain APqn-1

[0075] (1) Toxicity culture

[0076] The strain APqn-1 was inoculated on a MEA slant test tube medium and cultured at 28°C for 3 days to activate it; 4 mL of sterile water was added to the slant test tube medium and rinsed to prepare an Aspergillus APqn-1 suspension. The number of spores was recorded using a hemocytometer under a microscope.

[0077] Add 10 mL of toxin-producing culture fluid to a 50 mL centrifuge tube, and then add a certain amount of strain APqn-1 bacterial suspension to make the final spore concentration 10 5 / mL, 30℃, 200rpm, culture for 7 days.

[0078] The composition of the toxin-producing culture medium is: 150.0 g sucrose, 20.0 g yeast extract, 10.0 g soy peptone, 1000 mL distilled water, pH 5.9.

[0079] (2) Determination of aflatoxin in toxin-producing culture medium

[0080] The aflatoxin in the fermentation broth was detected by immunoaffinity chromatography purification, liquid chromatography separation, and fluorescence detector detection. The specific operation is as follows: 2 mL of fermentation broth is passed through the immunoaffinity chromatography column at a flow rate of 3 mL per minute, eluted twice with 20 mL of water, the eluent is discarded, air is allowed to enter the column, water is squeezed out of the column, and then eluted with 1.5 mL of methanol in batches, the eluent is collected, concentrated to 0.7 mL, and diluted to 1 mL with water, shaken, loaded, separated by high performance liquid chromatography, and detected by fluorescence detector.

[0081] Chromatographic conditions: the chromatographic column is Venusil MP C18 (5μm, 4.6mm×150mm); the column temperature is 40℃; the mobile phase is methanol:water (V:V=45:55); the flow rate is 1.3mL / min; post-column photochemical derivatization method is adopted: photochemical derivatizer 254nm; detection is carried out with a fluorescence detector, excitation wavelength is 360nm, emission wavelength is 450nm, and injection volume is 20μL.

[0082] The results are as follows Figure 6 As shown (the upper curve is the aflatoxin standard, and the lower curve is the strain APqn-1), no aflatoxin was detected in the toxin-producing fermentation broth of strain APqn-1, further confirming that strain APqn-1 is a non-toxigenic aflatoxin strain.

[0083] Example 3 Biological preparation containing strain APqn-1

[0084] A biological preparation, the active ingredient of which contains strain APqn-1.

[0085] The preparation method is as follows:

[0086] (1) Activation of strains and preparation of spore suspension: strain APqn-1 was inoculated on MEA medium and cultured at 30°C for 5 days until yellow-green spores were produced. 10 mL of physiological saline was added to the medium, and the spore suspension was prepared by vortexing and scraping. The spore count of the suspension was determined and the concentration of the spore suspension was adjusted to 10 6 / mL.

[0087] (2) Preparation of inoculant culture medium: The mushroom sticks were crushed into pieces of about 0.5 × 0.5 cm in size, mixed with distilled water at a mass ratio of 1.5:1, and sterilized at 121 °C for 20 min.

[0088] (3) The non-toxin-producing strain APqn-1 spore suspension prepared above was inoculated onto the sterilized inoculum culture medium, with 100 g of culture medium inoculated. 7 The non-toxin-producing strain APqn-1 spores were cultured at 30°C and shaken once a day to allow the Aspergillus flavus to grow evenly on the culture medium. The culture was continued until the number of Aspergillus flavus spores reached 10 8 / g culture medium or more, black granular sclerotia can be produced on the inoculum culture medium, which usually takes 9-10 days.

[0089] (4) The culture medium of the strain APqn-1 is crushed and dried at 45° C. to prepare a biological preparation, which can be stored at room temperature.

[0090] Comparative Example 1

[0091] Strain APqn-1 was inoculated on MEA medium and cultured at 30°C until the number of Aspergillus flavus spores reached 10 8 The culture medium is used to produce black granular sclerotia, which usually takes 10 days. The culture medium for culturing strain APqn-1 is crushed and dried at 45°C to prepare a biological preparation, which can be stored at room temperature.

[0092] Comparative Example 2

[0093] A biological preparation, the active ingredient of which contains strain APqn-1.

[0094] The preparation method is as follows:

[0095] 1) Activation of strains and preparation of spore suspension: strain APqn-1 was inoculated on MEA medium and cultured at 30°C for 5 days until yellow-green spores were produced. 10 mL of normal saline was added to the medium, and the spore suspension was prepared by vortexing and scraping. The spore count of the suspension was determined and the concentration of the spore suspension was adjusted to 10 6 / mL.

[0096] (2) Preparation of inoculant culture medium: The mushroom sticks were crushed into pieces of about 0.5 × 0.5 cm in size, mixed with distilled water in a mass ratio of 1:2, and sterilized at 121 °C for 20 min.

[0097] (3) The non-toxin-producing strain APqn-1 spore suspension prepared above was inoculated onto the sterilized inoculum culture medium, with 100 g of culture medium inoculated. 7 The non-toxin-producing strain APqn-1 spores were cultured at 30°C and shaken once a day to allow the Aspergillus flavus to grow evenly on the culture medium. The culture was continued until the number of Aspergillus flavus spores reached 10 8 / g culture medium or more, black granular sclerotia can be produced on the inoculum culture medium, which usually takes 9-10 days.

[0098] (4) The culture medium of the strain APqn-1 is crushed and dried at 45° C. to prepare a biological preparation, which can be stored at room temperature.

[0099] Comparative Example 3

[0100] A biological preparation, the active ingredient of which contains strain APqn-1.

[0101] The preparation method is as follows:

[0102] (1) Activation of strains and preparation of spore suspension: strain APqn-1 was inoculated on MEA medium and cultured at 30°C for 5 days until yellow-green spores were produced. 10 mL of physiological saline was added to the medium, and the spore suspension was prepared by vortexing and scraping. The spore count of the suspension was determined and the concentration of the spore suspension was adjusted to 10 6 / mL.

[0103] (2) Preparation of inoculant culture medium: The mushroom sticks were crushed into pieces of about 0.5 × 0.5 cm in size, mixed with distilled water in a mass ratio of 1:1, and sterilized at 121 °C for 20 min.

[0104] (3) The non-toxin-producing strain APqn-1 spore suspension prepared above was inoculated onto the sterilized inoculum culture medium, with 100 g of culture medium inoculated. 7 The non-toxin-producing strain APqn-1 spores were cultured at 30°C and shaken once a day to allow the Aspergillus flavus to grow evenly on the culture medium. The culture was continued until the number of Aspergillus flavus spores reached 10 8 / g culture medium or more, black granular sclerotia can be produced on the inoculum culture medium, which usually takes 9-10 days.

[0105] (4) The culture medium of the strain APqn-1 is crushed and dried at 45° C. to prepare a biological preparation, which can be stored at room temperature.

[0106] Comparative Example 4

[0107] A biological preparation, the active ingredient of which contains strain APqn-1.

[0108] The preparation method is as follows:

[0109] (1) Activation of strains and preparation of spore suspension: strain APqn-1 was inoculated on MEA medium and cultured at 30°C for 5 days until yellow-green spores were produced. 10 mL of physiological saline was added to the medium, and the spore suspension was prepared by vortexing and scraping. The spore count of the suspension was determined and the concentration of the spore suspension was adjusted to 10 6 / mL.

[0110] (2) Preparation of inoculant culture medium: The mushroom sticks were crushed into pieces of about 0.5 × 0.5 cm in size, mixed with distilled water in a mass ratio of 2:1, and sterilized at 121 °C for 20 min.

[0111] (3) The non-toxin-producing strain APqn-1 spore suspension prepared above was inoculated onto the sterilized inoculum culture medium, with 100 g of culture medium inoculated. 7 The non-toxin-producing strain APqn-1 spores were cultured at 30°C and shaken once a day to allow the Aspergillus flavus to grow evenly on the culture medium. The culture was continued until the number of Aspergillus flavus spores reached 10 8 / g culture medium or more, black granular sclerotia can be produced on the inoculum culture medium, which usually takes 9-10 days.

[0112] (4) The culture medium of the strain APqn-1 is crushed and dried at 45° C. to prepare a biological preparation, which can be stored at room temperature.

[0113] Comparative Example 5

[0114] A biological preparation, the active ingredient of which contains strain APqn-1.

[0115] The preparation method is as follows:

[0116] (1) Activation of strains and preparation of spore suspension: strain APqn-1 was inoculated on MEA medium and cultured at 30°C for 5 days until yellow-green spores were produced. 10 mL of physiological saline was added to the medium, and the spore suspension was prepared by vortexing and scraping. The spore count of the suspension was determined and the concentration of the spore suspension was adjusted to 10 6 / mL.

[0117] (2) Preparation of inoculum culture medium: The mushroom sticks were crushed into pieces of about 0.5 × 0.5 cm in size, mixed with distilled water in a mass ratio of 3:1, and sterilized at 121 °C for 20 min.

[0118] (3) The non-toxin-producing strain APqn-1 spore suspension prepared above was inoculated onto the sterilized inoculum culture medium, with 100 g of culture medium inoculated. 7 The non-toxin-producing strain APqn-1 spores were cultured at 30°C and shaken once a day to allow the Aspergillus flavus to grow evenly on the culture medium. The culture was continued until the number of Aspergillus flavus spores reached 10 8 / g culture medium or more, black granular sclerotia can be produced on the inoculum culture medium, which usually takes 9-10 days.

[0119] (4) The culture medium of the strain APqn-1 is crushed and dried at 45° C. to prepare a biological preparation, which can be stored at room temperature.

[0120] Comparative Example 6

[0121] A biological preparation, the active ingredient of which contains strain APqn-1.

[0122] The preparation method is as follows:

[0123] (1) Activation of strains and preparation of spore suspension: strain APqn-1 was inoculated on MEA medium and cultured at 30°C for 5 days until yellow-green spores were produced. 10 mL of physiological saline was added to the medium, and the spore suspension was prepared by vortexing and scraping. The spore count of the suspension was determined and the concentration of the spore suspension was adjusted to 10 6 / mL.

[0124] (2) Preparation of inoculant culture medium: The mushroom sticks were crushed into pieces of about 0.5 × 0.5 cm in size, mixed with distilled water at a mass ratio of 1.5:1, and sterilized at 121 °C for 20 min.

[0125] (3) The non-toxin-producing strain APqn-1 spore suspension prepared above was inoculated onto the sterilized inoculum culture medium, with 100 g of culture medium inoculated. 7 The non-toxin-producing strain APqn-1 spores were cultured at 30°C and shaken once a day to allow the Aspergillus flavus to grow evenly on the culture medium. The culture was continued until the number of Aspergillus flavus spores reached 10 8 No black granular sclerotia were produced on the inoculum culture medium, and the culture time was 5-6 days.

[0126] (4) The culture medium of the strain APqn-1 is crushed and dried at 45° C. to prepare a biological preparation, which can be stored at room temperature.

[0127] Example 4 Application of biological preparations containing strain APqn-1 in inhibiting aflatoxin production by Aspergillus flavus

[0128] (1) Preparation of matrix

[0129] Select intact corn and peanut kernels that are not damaged, then weigh 10g of peanuts and corn of uniform size respectively, put them into a conical flask, and sterilize them at 121℃ for 15 minutes.

[0130] (2) Preparation of bacterial suspension

[0131] The toxin-producing Aspergillus flavus NRRL3357 was inoculated on MEA slant test tube culture medium and cultured at 20°C for 5 days. Then, the spores on the culture medium were dipped into sterile water with a cotton swab and vortexed evenly. Then, the spore concentration was adjusted to 2×10 4 Spores / mL, set aside.

[0132] Weigh 0.1 g of the biological agent prepared in Example 3 into sterile water, vortex and shake evenly, and then adjust the spore concentration to 2×10 4 Spores / mL, set aside.

[0133] (3) Inhibitory effect test

[0134] Add 1 mL of the diluted biological preparation suspension and toxin-producing aflatoxin spore suspension (10 mL) into the above-mentioned conical flasks containing peanuts or corn. 4 :10 4 ) as the test group, and then add 1 mL of toxin-producing aflatoxin spore suspension and a spore suspension mixed with equal volumes of sterile water (10 4 ) As a positive control group, the bottle was gently shaken to cover the spores on the peanuts and corn. Three replicates were made for each, and cultured at 30°C in the dark for 14 days.

[0135] (4) Determination of aflatoxin B1 content

[0136] The cultured corn and peanut samples were sterilized in an autoclave at 121°C for 30 minutes (to inactivate Aspergillus flavus); the sterilized samples were crushed in a high-speed universal grinder, and then 50 mL of 80% methanol was added to a triangular flask, and the samples were shaken at high speed for 30 minutes using an oscillator, and then filtered using sterilized filter paper. The extract was tested for aflatoxin B1 using HPLC. The results are shown in Table 2.

[0137] Table 2 The inhibitory effect of biological agents on the production of toxins by Aspergillus flavus

[0138]

[0139] As can be seen from Table 2, the inhibition rate of the biological agent on the toxin-producing fungi in peanuts is 90.69±0.31%, and the inhibition rate of the toxin-producing fungi in corn is 87.80±0.56%. The biological agent can effectively inhibit the toxin production of toxin-producing Aspergillus flavus.

[0140] Example 5 Application of biological preparations containing strain APqn-1 in antagonizing toxin-producing Aspergillus flavus in different types of soil

[0141] Four different common types of peanut planting soil types, namely dry slope land, depression land, rice field and sandy loam land, were selected respectively. One month before the peanuts were harvested, the biological preparations prepared in Example 3 and Comparative Examples 1-6 were spread on the rhizosphere of peanuts at 30 kg / mu as the experimental group; the control group was blank; other daily management of the experimental group and the control group were the same.

[0142] Soil samples were collected before the application of biological agents and 10 and 20 days after the application until harvest. The number of bacteria in the soil samples was detected and the Aspergillus flavus was isolated and identified. The number of Aspergillus flavus in the soil samples and the changes in the proportion of toxin-producing Aspergillus flavus before and after the application of biological agents were compared. The results are shown in Table 3.

[0143] Table 3 Changes in the number and proportion of Aspergillus flavus in the soil after applying the biological agent of Example 3

[0144]

[0145]

[0146] As can be seen from Table 3, after the application of the biological preparation prepared in Example 3, the non-toxic bacteria grow and reproduce rapidly in the soil. After 20 days of application, the number of Aspergillus flavus colonies in the soil increases rapidly, and then the growth tends to slow down. The best effect is achieved by applying the bacterial agent 20 days before peanut harvest. At the same time, after the application of the biological preparation prepared in Example 3, the non-toxic bacteria can grow and reproduce rapidly in the peanut soil, and can competitively inhibit the growth and reproduction of toxin-producing Aspergillus flavus, reducing the proportion of toxin-producing bacteria. As can be seen from Table 3, after the application of non-toxic bacteria, the proportion of toxin-producing bacteria is reduced from 60.25±0.32% to 70.25±0.37% of the control group to 0.67±0.31% to 2.32±0.21 before harvest, and the proportion of toxin-producing bacteria is rapidly reduced, thereby reducing the proportion of toxin-producing bacteria infecting peanuts and reducing the risk of peanut aflatoxin contamination. In addition, the data in Table 3 can also show that the biological preparation prepared in Example 3 can not only reproduce rapidly in sandy loam plain soil, but also grow and reproduce in soil types such as dry slopes, rice fields and depressions with relatively harsh conditions. This shows that the biological agent prepared in Example 3 can grow and reproduce in different types of soil and be used to antagonize the growth of Aspergillus flavus, and has strong adaptability. The reason is that the biological agent contains a large number of spores, which can improve the adaptability of the biological agent to environmental changes.

[0147] Biological agents prepared by different methods were applied to obtain soil samples once during peanut harvest. The number of bacteria in the soil samples was detected and the Aspergillus flavus was isolated and identified. The effects of biological agents prepared by different methods on the number of Aspergillus flavus in soil samples and the proportion of toxin-producing Aspergillus flavus are compared as shown in Table 4.

[0148] Table 4 Changes in the number and proportion of Aspergillus flavus in the soil after applying biological agents prepared by different methods

[0149]

[0150]

[0151] From the comparison of the results of Example 3 and Comparative Example 1 in Table 4, it can be seen that the method for preparing the microbial agent uses edible mushroom sticks and produces sclerotia during the culture process, which can significantly improve the survival and inhibition ability of the microbial agent in different soil types. The texture of the mushroom stick is soft and can absorb moisture. During the field application process, the culture medium can absorb moisture for the strain, which is beneficial to the growth of the strain. From the comparison of the results of Example 3 and Comparative Examples 2, 3, 4, and 5 in Table 4, it can be seen that the ratio of the mushroom stick to distilled water during the culture process can significantly affect the survival and inhibition ability of the microbial agent in different soil types; within the mass ratio of the mushroom stick to distilled water in the range of 3:1-1:2, the microbial agent has a very good inhibitory effect, among which 1.5:1 has the best effect. From the comparison of the results of Example 3 and Comparative Example 6 in Table 4, it can be seen that the sclerotia have the effect of improving extreme environments and can improve the adaptability of the microbial agent in different soil environments.

[0152] Example 6 Application of biological preparation containing strain APqn-1 in preventing and controlling peanut fruit rot

[0153] Four different common types of peanut planting soil types, namely dry slope land, depression land, rice field and sandy loam land, were selected respectively. One month before the peanuts were harvested, the biological preparation prepared in Example 3 was spread on the rhizosphere of the peanuts at 30 kg / mu as the experimental group; the control group was blank; other daily management of the experimental group and the control group were the same.

[0154] Pick peanuts grown on dry slopes, depressions, rice fields, and sandy loam. Randomly select 100 peanut plants, pick the peanuts from the 100 plants, count the number of pods from the 100 plants, select the rotten fruits, count the number of rotten fruits, and calculate the rotten fruit rate according to the following formula:

[0155] Rotten fruit rate (%) = number of rotten fruits / number of pods*100.

[0156] Three replicates were performed for each soil type and the results are shown in Table 5:

[0157] Table 5 Effects of biological agents on peanut fruit rot

[0158] Dry slope depression Sandy plain Rice fields Control rotten fruit rate % 24.39±0.35 35.69±0.50 27.32±0.82 38.42±0.69 Test rotten fruit rate % 16.27±0.42 23.45±0.35 17.58±0.26 25.64±0.37

[0159] Table 5 shows that the addition of the biological agent prepared in Example 3 can significantly reduce peanut fruit rot, and the fruit rot rate in different types of soil has significantly decreased, with a decrease of 8.12% in dry slopes, 12.24% in depressions, 9.74% in sandy loam plains, and 12.78% in rice fields. Therefore, the biological agent prepared in Example 3 has a certain preventive and therapeutic effect on peanut fruit rot.

[0160] Example 7 Application of biological preparation containing strain APqn-1 in preventing and controlling peanut root rot

[0161] Four different common types of peanut planting soil types, namely dry slope land, depression land, rice field and sandy loam land, were selected respectively. One month before the peanuts were harvested, the biological preparation prepared in Example 3 was spread on the rhizosphere of the peanuts at 30 kg / mu as the experimental group; the control group was blank; other daily management of the experimental group and the control group were the same.

[0162] Pick peanuts grown on dry slopes, depressions, rice fields, and sandy loam, randomly select 100 peanuts, pick out plants with root rot, and calculate the incidence of peanut root rot according to the following formula:

[0163] Peanut root rot incidence % = number of plants with root rot / total number of peanut plants*100.

[0164] Three replicates were performed for each soil type and the results are shown in Table 6:

[0165] Table 6 Effects of biological agents on peanut root rot

[0166] Dry slope depression Sandy plain Rice fields Root rot incidence in control group % 12.35±0.15 15.32±0.240 7.32±0.26 18.42±0.79 Root rot incidence rate (%) 10.21±0.24 13.45±0.25 7.08±0.34 15.46±0.73

[0167] Table 6 shows that the addition of the biological agent prepared in Example 3 can reduce the incidence of peanut root rot. The incidence of root rot in different types of soils has been significantly reduced, with a decrease of 2.14% in dry slopes, 1.87% in depressions, 0.24% in sandy loam plains, and 2.96% in rice fields. Therefore, the biological agent prepared in Example 3 has a certain preventive and therapeutic effect on peanut root rot.

[0168] Example 8 Application of biological preparation containing strain APqn-1 in controlling peanut white rot

[0169] Four different types of peanut planting soil types, namely dry slope land, depression land, rice field and sandy loam land, were selected respectively. One month before the peanuts were harvested, the biological preparation prepared in Example 3 was spread on the rhizosphere of peanuts at 30 kg / mu as the experimental group; the control group was blank; other daily management of the experimental group and the control group were the same.

[0170] Pick peanuts grown on dry slopes, depressions, rice fields, and sandy loam. Randomly select 100 peanuts and pick the plants with white rot on the rhizomes. Calculate the incidence of white rot in peanuts according to the following formula:

[0171] The incidence of peanut white rot (%) = number of plants with white rot / total number of peanut plants*100.

[0172] Three replicates were performed for each soil type and the results are shown in Table 7:

[0173] Table 7 Effects of biological agents on peanut white disease

[0174] Dry slope land depression Sandy plain Rice fields The incidence of white disease in the control group 15.39±0.45 16.42±0.58 14.55±0.24 18.61±0.47 The incidence of white disease in the experiment 4.68±0.35 6.79±0.47 4.25±0.26 7.54±0.42

[0175] Table 7 shows that the addition of the biological preparation prepared in Example 3 can significantly reduce the incidence of peanut white rot, and the incidence of peanut white rot in different types of soil has been significantly reduced, with a decrease of 10.71% in dry slopes, 9.63% in depressions, 10.3% in sandy loam plains, and 11.07% in rice fields. Therefore, the biological preparation prepared in Example 3 has a certain preventive and therapeutic effect on peanut white rot.

[0176] Example 9 Application of biological preparation containing strain APqn-1 in improving germination rate of peanuts

[0177] Four different common types of peanut planting soil types, namely dry slope land, depression land, rice field and sandy loam land, were selected respectively. One month before the peanuts were harvested, the biological preparation prepared in Example 3 was spread on the rhizosphere of the peanuts at 30 kg / mu as the experimental group; the control group was blank; other daily management of the experimental group and the control group were the same.

[0178] After the peanuts matured, the shells of the picked peanuts were peeled and one complete seed was selected from each pod to determine the germination rate (about 70 seeds were selected for each sub-sample). The seeds were soaked in sterile water at room temperature for 12 hours to encourage them to absorb enough water. The seeds were placed in a tray covered with a wet cloth and cultured at room temperature for 7 days (pay attention to replenishing water to ensure that the bottom of the tray is moist). The proportion of germinated seeds was counted. The results are shown in Table 8:

[0179] Table 8 Effect of biological agents on peanut germination rate

[0180] Dry slope land depression Sandy plain Rice fields Control germination rate % 86.20±6.5 75.20±8.7 87.50±5.1 74.24±3.9 Test germination rate % 92.31±3.4 85.42±2.3 93.08±3.8 85.36±7.3

[0181] Table 8 shows that the biological preparation prepared in Example 3 can significantly increase the germination rate of harvested peanuts. The germination rate of peanuts harvested in different types of soil is significantly increased, with an increase of 6.11% in dry slopes, 10.22% in depressions, 5.58% in sandy loam plains, and 11.12% in paddy fields. Therefore, the biological preparation prepared in Example 3 can increase the germination rate of peanuts.

[0182] Example 10 Application of biological preparation containing strain APqn-1 in increasing peanut yield

[0183] Four different common types of peanut planting soil types, namely dry slope land, depression land, rice field and sandy loam land, were selected respectively. One month before the peanuts were harvested, the biological preparation prepared in Example 3 was spread on the rhizosphere of the peanuts at 30 kg / mu as the experimental group; the control group was blank; other daily management of the experimental group and the control group were the same.

[0184] When peanuts were harvested, the peanut yields of the control group and those after application of biological agents were counted. The results are shown in Table 9.

[0185] Table 9 Effects of applying biological agents on peanut yield

[0186] Group <![CDATA[Peanut yield (kg / 666.67m 2 )]]> Control group 249.68 Experimental Group 315.70

[0187] It can be seen from Table 9 that after applying the biological preparation prepared in Example 3, the peanut yield increased from 249.68kg / 666.67m 2 Increased to 315.7kg / 666.67m 2 , the yield increased by 26.44%, which is because the application of the microbial agent reduced the contamination of Aspergillus flavus, reduced the amount of rotten fruit, and inhibited a variety of peanut soil-borne diseases, such as fruit rot and root rot, thereby increasing the yield. Therefore, the biological agent prepared in Example 3 can increase the yield of peanuts.

[0188] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A non-toxic aflatoxin strain, characterized in that: The Aspergillus flavus is Aspergillus flavus ( Aspergillus flavus )APqn-1 strain, the deposit number is CGMCC NO.40535.

2. The use of the non-toxic aflatoxin fungus according to claim 1 in aflatoxin biological control, peanut disease control, improving peanut germination rate or increasing peanut yield, characterized in that: The peanut disease is at least one of fruit rot, root rot and white rot.

3. The use of the non-toxic aflatoxin fungus according to claim 1 in the preparation of a preparation for biological control of aflatoxin, control of peanut diseases, increasing peanut germination rate or increasing peanut yield, characterized in that: The peanut disease is at least one of fruit rot, root rot and white rot.

4. A biological agent, characterized in that: The active ingredient is the APqn-1 strain with a deposit number of CGMCC NO.40535.

5. The biological agent according to claim 4, characterized in that The number of Aspergillus flavus spores in the biological preparation is ≥ 10 8 Pieces / g.

6. The biological agent according to claim 5, characterized in that The preparation method is as follows: (1) Crush the mushroom sticks after picking the edible mushrooms, mix the mushroom sticks with distilled water in a mass ratio of 3:1-1:2, and sterilize to obtain the inoculum culture medium; (2) Inoculate the non-toxin-producing strain APqn-1 spore suspension onto the sterilized inoculum culture medium and culture until the number of Aspergillus flavus spores is ≥10 8 pcs / g medium; (3) The culture medium for culturing the strain APqn-1 is crushed and dried to prepare a biological preparation.

7. Use of the biological agent according to any one of claims 4 to 6 in biological control of Aspergillus flavus, control of peanut diseases, improving peanut germination rate or increasing peanut yield, characterized in that: The peanut disease is at least one of fruit rot, root rot and white rot.

8. A method for biological control of Aspergillus flavus, control of peanut diseases, increasing peanut germination rate or increasing peanut yield, characterized in that: One month before peanut harvest, the biological agent described in any one of claims 4 to 6 is spread on the root zone of peanuts, and the peanut disease is at least one of fruit rot, root rot and white rot.

9. The method for biological control of Aspergillus flavus, control of peanut diseases, increasing peanut germination rate or increasing peanut yield according to claim 8, characterized in that: The dosage of biological agents is 30kg / mu.

Images