Marker for predicting occurrence of recurrent implantation failure and application thereof

By detecting the expression levels of lipid peroxidation-related biological elements, this study predicts recurrent implantation failure and improves endometrial receptivity, resolving the unclear regulation of lipid peroxidation during pregnancy, improving pregnancy success rates, and providing a new treatment strategy.

CN117512096BActive Publication Date: 2026-03-17SHANDONG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-21
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

In the current technology, there is limited research on lipid peroxidation in the endometrium, and it is unclear how the dynamic balance of lipid peroxidation is regulated during pregnancy and whether it affects the endometrium's ability to maintain the pregnancy environment. As a result, there is a lack of effective means to predict and treat recurrent implantation failure.

Method used

By detecting the expression levels of lipid peroxidation-related biological elements such as glutathione peroxidase 4 (GPX4), active aldehyde MDA, 4HNE, and non-heme iron, products and systems can be developed to predict recurrent implantation failure and improve endometrial receptivity by clearing lipid peroxides or promoting GPX4 expression, thereby preventing implantation failure.

Benefits of technology

It provides a non-invasive and stable method for predicting recurrent implantation failure, improves clinical pregnancy rates, offers new treatment strategies for the prevention and treatment of related diseases, and clarifies the harmful effects of redox homeostasis imbalance on embryo implantation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117512096B_ABST
    Figure CN117512096B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of biological medicine and molecular biology technology, and particularly relates to a marker for predicting the occurrence of repeated implantation failure and application thereof. The present application finds that abnormal lipid peroxidation in uterine epithelium can cause implantation defects, and the lipid peroxidation level of the uterus in patients with repeated implantation failure or repeated spontaneous abortion is enhanced, wherein the content of active aldehyde substance MDA and non-heme iron in serum can be used as a new non-invasive clinical index for predicting RIF patients; further, eliminating uterine lipid ROS to improve endometrial receptivity can be used as a potential new treatment strategy to improve embryo implantation and clinical pregnancy rate, and therefore has good practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and molecular biology, specifically relating to biomarkers for predicting recurrent implantation failure and their applications. Background Technology

[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] The interaction between a receptive uterus and a blastocyst capable of implantation is a prerequisite for successful implantation. The uterine epithelium (LE), as the first point of contact between the embryo and the mother, undergoes dramatic molecular, physiological, and morphological changes, transmitting embryonic signals to the uterine stromal cells (ST) and initiating implantation. In mice, the appearance of the vaginal plug is considered day 1 of pregnancy. The uterus is in the pre-receptive phase from day 1 to day 3 of pregnancy, and in the receptive phase on day 4. Implantation occurs in the evening of day 4 and ends in the early morning of day 5, closing the uterine window. In humans, days 1-7 post-ovulation (early luteal phase) are considered the pre-receptive phase, days 7-10 post-ovulation (mid-luteal phase) are the receptive phase, and the receptive phase closes after day 10 (late luteal phase). The first type of endometrial cells the embryo encounters during implantation are epithelial cells; therefore, the normal physiological state of these epithelial cells is crucial for embryo adhesion and invasion, and the homeostasis of epithelial cell receptivity is regulated by multiple factors.

[0004] In mice, preovulatory estrogen (E2) has a dominant effect on the luminal epithelium. E2 secreted on day 1 of pregnancy acts on estrogen receptor α (ERα) in stromal cells, promoting epithelial cell proliferation. Subsequently, on day 2, the decline in estrogen levels leads to epithelial cell death. On day 3, the elevated progesterone (P4) level in the newly formed corpus luteum delays uterine epithelial cell death and induces stromal cell proliferation. During uterine receptivity, luminal epithelial cells cease proliferation and begin differentiation under the influence of E2 and P4. Cell surface microvilli gradually disappear, and polarity changes to promote embryo adhesion and implantation. Numerous human studies have also shown that the proliferation and death of epithelial cells during the menstrual cycle require coordinated action among ovarian hormones, uterine transcription factors, cytokines, and other pregnancy-related molecular signaling pathways. Uterine epithelial abnormalities, altered microenvironment, or defects in endometrial receptivity can all lead to implantation failure and adverse pregnancy outcomes. Therefore, given the complex regulatory mechanisms of epithelial cell homeostasis during the pregnancy receptivity period, further exploration of the key factors affecting the establishment of epithelial receptivity is beneficial for understanding the maternal-fetal dialogue mechanism during embryo implantation and provides more theoretical basis for the clinical treatment of related pregnancy diseases.

[0005] The dynamic balance of oxidants and reductants within cells, known as cellular redox homeostasis, is essential for maintaining normal cellular physiological processes. Redox imbalances affect many physiological processes, including gene transcription, cell signal transduction, cell proliferation, differentiation, death, and organ damage. Increased lipid peroxides are a key factor mediating cell death and disease. Reactive oxygen species (ROS) react nonspecifically with lipid components of the membrane to produce lipid hydroperoxides. This process of oxidizing lipid membranes to produce lipid peroxides is called lipid peroxidation. Polyunsaturated fatty acids (PUFAs) are excellent substrates for lipid peroxidation. Lipid hydroperoxides participate in the Fenton reaction mediated by iron ions or other metal ions, producing secondary metabolites such as malondialdehyde (MDA) and 4-hydroxynonenoic acid (4-HNE). MDA can lead to protein-DNA crosslinking, thereby altering molecular activity and cellular physiological states; 4-HNE modifies proteins, changing their function and localization. These covalent modifications by secondary messengers of lipid peroxidation alter the structure and function of proteins and nucleic acids, producing cytotoxicity. Therefore, MDA and 4-HNE are the most suitable tools for detecting and quantifying lipid peroxidation in biological samples. Currently, lipid peroxidation is also being used as a novel target for clinical treatment, and some related drugs are already in clinical use: for example, inhibiting glutamine metabolism during lipid peroxidation can significantly alleviate cardiac damage; mitochondrial lipid peroxidation leading to neurotoxicity is one of the causes of Parkinson's disease, and developing antioxidants targeting mitochondria to block lipid peroxidation has potential application value in the treatment of neurodegenerative diseases; lipid peroxidation also regulates cancer development, and approved drugs such as sorafenib have been put into clinical treatment. Currently, lipid peroxidation is also considered the most important marker of ferroptosis. Ferroptosis, as a novel iron-dependent programmed cell death mechanism, is widely involved in regulating organ development and disease occurrence. However, to date, research on lipid peroxidation in the endometrium has mainly focused on endometrial diseases such as endometrial cancer and endometriosis, with relatively little research on the process of pregnancy. Questions remain to be answered regarding how the dynamic balance of lipid peroxidation is regulated during pregnancy, whether the production of lipid peroxides affects the endometrial environment necessary for maintaining pregnancy, and whether lipid peroxidation triggers pregnancy-related diseases.

[0006] Glutathione peroxidase 4 (GPX4) is an evolutionarily highly conserved enzyme that primarily uses glutathione (GSH) as a substrate to reduce lipid hydroperoxides (LOOH) to non-toxic lipid alcohols (L-OH), inhibiting the accumulation of lipid reactive oxygen species (ROS) on biological membranes and thus maintaining the healthy physiological state of cells. GSH consumption or GPX4 inactivation in cells leads to the excessive production of lipid peroxides and ROS, impairing redox homeostasis and triggering cell death. Direct or indirect inhibition of GPX4 induces ferroptosis and is considered one of the core molecules of ferroptosis. Studies have shown that systemic GPX4 knockout mice experience intrauterine absorption around day 7.5 of embryonic development, resulting in embryonic lethality. This protein also plays a wide range of roles in maintaining the physiological functions of various organs, such as the kidneys, brain, liver, and immune system. Conditional knockout of GPX4 in mice can lead to diseases such as acute nephritis and colitis. GPX4-specific knockout in the mouse brain leads to ferroptosis in neurons, accompanied by astrocyte gliosis, consistent with Alzheimer's disease (AD). Conditional knockout of GPX4 in T cells also induces ferroptosis, resulting in a reduced immune response during infection. Adverse reactions to oxidative imbalance caused by GPX4 dysfunction can be blocked by lipid ROS scavengers or by intercepting the biosynthesis of PUFA-containing phospholipids (PUFA-PLs). Our analysis of single-cell data from the human endometrium revealed high expression of GPX4 in uterine epithelial and stromal cells; however, its involvement in endometrial regulation of pregnancy establishment and maintenance remains unclear, as does whether GPX4-regulated lipid peroxidation affects the maternal-fetal communication environment during endometrial establishment in pregnancy. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide biomarkers for predicting recurrent implantation failure (RIF) and their applications. The present invention has discovered that abnormal lipid peroxidation in the uterine epithelium leads to implantation defects, and that the level of lipid peroxidation in the uterus is enhanced in patients with recurrent implantation failure or recurrent spontaneous abortion. Furthermore, clinically, the levels of lipid peroxidation products, such as reactive aldehydes (MDA) and non-heme iron, often show a significant upward trend in the serum of RIF patients. Moreover, eliminating uterine lipid ROS to improve endometrial receptivity can serve as a potential novel treatment strategy to improve embryo implantation and clinical pregnancy rates. Based on the above research findings, the present invention has been completed.

[0008] Specifically, the technical solution of this invention is as follows:

[0009] In a first aspect, the invention provides the use of reagents for detecting lipid peroxidation and the expression levels of related biological elements in the preparation of products for predicting recurrent implantation failure;

[0010] The lipid peroxidation-related biological elements include lipid peroxidation-related proteins or lipid peroxidation-related products, such as glutathione peroxidase 4 (GPX4), active aldehyde MDA, 4HNE, and non-heme iron.

[0011] The product can predict recurrent implantation failure (RIF) by detecting lipid peroxidation and the expression levels of related biofactors. Specifically, this invention has shown through experiments that in RIF patients with recurrent implantation failure, the expression of GPx4 in endometrial epithelial cells is decreased, and lipid peroxides are abnormally increased. Furthermore, high levels of lipid peroxidation in serum during early human pregnancy are strongly correlated with RIF patients experiencing implantation failure. In particular, the levels of active aldehyde MDA and non-heme iron in serum serve as novel non-invasive clinical indicators for predicting RIF patients, primarily addressing the problems of cumbersome, invasive, unstable, and traumatic detection techniques currently available. Therefore, lipid peroxidation and related biofactors can be used as biomarkers for recurrent implantation failure. The lipid peroxidation-related biofactors can be from human and non-human mammals (such as mice, rats, guinea pigs, rabbits, dogs, monkeys, and chimpanzees).

[0012] The reagents used to detect lipid peroxidation and the expression levels of related biological elements include any reagents commonly used in existing methods for detecting the above substances, such as those used in the thiobarbituric acid method, high performance liquid chromatography, enzyme-linked immunosorbent assay, fluorescence method, and electron spin resonance (ESR) method for detecting lipid peroxidation.

[0013] The reagents for detecting related biological elements may also include reagents for detecting the transcription of the GPX4-encoded gene based on real-time quantitative PCR, in situ hybridization, gene chips, and gene sequencing, and / or reagents for detecting glutathione peroxidase 4 expression based on immunoassay methods.

[0014] The products include, but are not limited to, primers, probes, (gene or protein) chips, nucleic acid membrane strips, detection kits, detection devices or equipment for detecting lipid peroxidation and the expression levels of related biological elements in the sample to be tested.

[0015] The test sample may be a human or non-human sample, including but not limited to the subject's blood (such as serum) sample and endometrial sample (such as endometrial epithelial cells).

[0016] A second aspect of the present invention provides a system for predicting recurrent implantation failure, the system comprising at least:

[0017] The acquisition unit is configured to acquire the expression levels of subject biomarkers;

[0018] An assessment unit is configured to assess the recurrent implantation failure of a subject based on the expression levels of the biomarkers obtained by the acquisition unit.

[0019] The biomarkers include lipid peroxidation and related biological elements;

[0020] The lipid peroxidation-related biological elements include lipid peroxidation-related proteins or lipid peroxidation-related products, such as glutathione peroxidase 4 (GPX4) and active aldehydes MDA, 4HNE, and non-heme iron.

[0021] A third aspect of this invention provides the application of lipid peroxidation and related biological elements as targets in the prevention and / or screening of drugs for recurrent implantation failure-related diseases.

[0022] The method for screening drugs for recurrent implantation failure-related diseases includes:

[0023] 1) Treat systems expressing and / or containing lipid peroxidation and related biological elements with candidate substances; set up parallel controls without candidate substance treatment;

[0024] 2) After completing step 1), detect the expression levels of lipid peroxidation and related biological elements in the system; if the lipid peroxidation level is significantly reduced and / or the expression level of GPX4 is significantly increased in the system treated with the candidate substance compared with the parallel control, the candidate substance can be used as a candidate drug for the prevention and treatment of recurrent implantation failure.

[0025] The system can be a cellular system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

[0026] A fourth aspect of the invention provides the use of substances that scavenge lipid peroxides or promote the expression levels of GPX4 and its encoding genes in any one or more of the following:

[0027] (a) Improving endometrial receptivity or preparing products that improve endometrial receptivity;

[0028] (b) Preventing implantation failure, improving clinical pregnancy rate, or preparing products that prevent implantation failure and improve clinical pregnancy rate;

[0029] (c) Products for treating infertility.

[0030] Furthermore, the present invention also provides the use of substances that knock out long-chain acyl-CoA synthase 4 (ACSL4) in the preparation of products that reverse GPX4 deficiency-mediated infertility.

[0031] The above products can be drugs or experimental reagents, and the experimental reagents can be used for basic research.

[0032] According to the present invention, when the product is a drug, the drug further includes at least one inactive pharmaceutical ingredient.

[0033] The inactive components of the drug can be pharmaceutically commonly used carriers, excipients, and diluents. Furthermore, according to conventional methods, it can be formulated into oral, topical, suppository, and sterile injectable solutions such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and sprays.

[0034] The non-pharmaceutical active ingredients that may be included, such as carriers, excipients, and diluents, are well known in the art, and those skilled in the art can determine that they meet clinical standards.

[0035] In another specific embodiment of the present invention, the carrier, excipient and diluent include, but are not limited to, lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylparaben, propylparaben, talc, magnesium stearate and mineral oil, etc.

[0036] In another specific embodiment of the invention, the drug of the invention can be administered into the body by known means. For example, it can be delivered to the tissue of interest via intravenous systemic delivery or local injection. Alternatively, it can be administered via intravenous, percutaneous, intranasal, mucosal, or other delivery methods. Such administration can be performed via a single dose or multiple doses. Those skilled in the art will understand that the actual dose to be administered in the invention can vary considerably depending on a variety of factors, such as the target cells, biological type or tissue, the general condition of the subject to be treated, the route of administration, the manner of administration, etc.

[0037] The beneficial technical effects of one or more of the above technical solutions are as follows:

[0038] The above-mentioned technical solution reveals for the first time the harmful effects of redox homeostasis imbalance on embryo implantation, clarifies the conservative role of this process in the endometrium of mice and humans in early pregnancy, and suggests that the clearance of lipid peroxides is a potential treatment method to prevent implantation failure and improve clinical pregnancy rate in clinical diagnosis and treatment, thus having good potential practical application value. Attached Figure Description

[0039] The accompanying drawings, which constitute a part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0040] Figure 1In this embodiment of the invention, the absence of GPX4 in the endometrium leads to abnormal endometrial receptivity, affecting embryo implantation and consequently causing female infertility. a) Immunohistochemical results show the expression pattern of GPX4 in the uterus of mice on days 1-5 and day 8 of gestation. Arrows point to the location of the embryo. Scale bar, 200 μm (days 1-5) and 500 μm (day 8). le, luminal epithelium; ge, glandular epithelium; st, stromal cells; myo, myometrium. b) Dotted bar graph representing GPX4. f / f and GPX4 f / f Pgr Cre / + Pregnancy outcome in mice. Gpx4 f / f Pgr Cre / + Females are completely sterile, and n represents the number of mice counted. c) Image shows Gpx4 f / f and GPX4 f / f Pgr Cre / + The implantation site of the embryo on day 5 of gestation in female mice; the weak blue band indicated by the arrows indicates implantation defects. d) Statistical graph shows Gpx4 f / f and GPX4 f / f Pgr Cre / + Number of embryos implanted on day 5 of gestation in female mice (n = 12-13 mice per group). e) For Gpx4 f / f and GPX4 f / f Pgr Cre / + HE staining was performed on the implantation site of the embryo in the uterus of female mice on day 5 of gestation to observe histological morphology. Arrows indicate the location of the implantation chamber crypt. Scale bar, 200 μm. f) Gpx4 f / f and GPX4 f / f Pgr Cre / + COX2 and CK8 immunofluorescence staining was performed on the implantation site in the uterus of female mice on day 5 of pregnancy. Arrows indicate embryo implantation locations. Scale bar, 100 μm. In situ hybridization experiments showed that the Muc1(g) and Ltf(h) genes were located in GPX4. f / f and GPX4 f / f Pgr Cre / + Expression in the uterus of female mice on day 4 of pregnancy. Scale bar, 200 μm. Real-time quantitative PCR was used to detect the expression of genes related to uterine receptivity, including the E2 response gene (i) and the P4 response gene (j). The results showed that Gpx4... f / f Pgr Cre / + Mice showed abnormal uterine receptivity on day 4 of pregnancy (n=5 mice per group). k) on Gpx4 f / f and GPX4 f / f Pgr Cre / +On day 4 of gestation in female mice, the uterus was stained with Ki67 and CTNNB1 immunofluorescence. Scale bar, 100 μm. l) TUNEL assay to detect GPx4. f / f and GPX4 f / f Pgr Cre / + Endometrial cell death in female mice on day 4 of pregnancy, with CK8 as the uterine epithelial marker. Scale bar: 100 μm. The statistical error bars in figures (b), (d), (i), and (j) are mean ± SEM. Statistical analysis was performed using the two-sample, equal-variance Student's t-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, ns: no significant difference.

[0041] Figure 2 In this embodiment of the invention, the specific absence of Gpx4 in the uterine epithelium leads to infertility in females due to embryo implantation failure or defects. a) Isolation of Gpx4 f / f and GPX4 f / f ltf Cre / + Gpx4 expression was detected by qPCR in uterine epithelial cells and stromal cells of mice on day 4 of pregnancy (n=5 mice per group). LE, luminal epithelium; ST, stromal cells. b) In situ hybridization experiments showed that Gpx4 expression was present in Gpx4 cells. f / f and GPX4 f / f ltf Cre / + Expression in the uterus of female mice on day 4 of pregnancy. Scale bar, 200 μm. c) Statistical graph representing Gpx4 f / f and GPX4 f / f ltf Cre / + Pregnancy outcome in mice, Gpx4 f / f ltf Cre / + Females are completely infertile. f / f and GPX4 f / f ltf Cre / + Analysis of embryo implantation and pregnancy status in mice on day 5 (d), day 10 (e), and day 14 (f) of gestation. Parentheses indicate embryo resorption sites, and arrows indicate implantation sites. g) qPCR detection of Gpx4 f / f ltf Cre / + Expression of uterine receptivity-related genes in isolated epithelial cells on day 4 of mouse gestation (n=5 mice per group). h)Gpx4 f / f and GPX4 f / f ltf Cre / + Immunofluorescence staining of Ki67 and CTNNB1 in the uterus of mice on day 4 of pregnancy. Scale bar, 100 μm. i) TUNEL assay for GPx4. f / f and GPX4 f / fltf Cre / + Epithelial cell death in mice on day 4 of pregnancy. Scale bar, 100 μm. Statistical error bars in figures (a), (c), and (g) are mean ± SEM. Statistical analysis was performed using Student's t-test with two samples and equal variances. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0042] Figure 3 In this embodiment of the invention, GPX4 deficiency causes an increase in lipid peroxidation levels in the uterus on day 4 of pregnancy. a) Immunohistochemical detection of GPX4 f / f GPX4 f / f Pgr Cre / + and GPX4 f / f Ltf Cre / + Malondialdehyde (MDA) signal in the uterus of mice on day 4 of pregnancy. Scale bar, 200 μm. Arrows indicate MDA signal. b) Analysis of GPX4 on day 4 of pregnancy using an MDA detection kit. f / f GPX4 f / f Pgr Cre / + and GPX4 f / f Ltf Cre / + MDA levels in female mouse serum. n represents the number of mice tested. c) ELISA kit detection of GPX4 on day 4 of gestation. f / f GPX4 f / f Pgr Cre / + and GPX4 f / f Ltf Cre / + Non-heme iron levels in female mouse serum. d) IHC detection of Gpx4 f / f GPX4 f / f Pgr Cre / + and GPX4 f / f Ltf Cre / + 4-Hydroxynonenal (4-HNE) signal in the uterus of female mice on day 4 of pregnancy. Scale bar, 200 μm. (ef) GPX4 was assessed by flow cytometry using C11-BODIPY 581 / 591 probe staining. f / f GPX4 f / f Pgr Cre / + and GPX4 f / f Ltf Cre / + Lipid peroxidation levels in uterine epithelial cells (e) and stromal cells (f) isolated from female mice on day 4 of pregnancy (n=4 mice per group). LE, luminal epithelial cells; ST, stromal cells. g) Transmission electron microscopy image showing Gpx4 f / f GPX4 f / f Pgr Cre / + and GPX4 f / f LtfCre / + Changes in apical microvilli of the uterine cavity epithelium and mitochondria of endometrial cells in female mice on day 4 of pregnancy. MV, microvilli; Mito, mitochondria. LE, luminal epithelium; ST, matrix. Scale bar, 500 nm. h) Protein carbonyl ELISA Kit detection of Gpx4 on day 4 of pregnancy. f / f GPX4 f / f Pgr Cre / + and GPX4 f / f Ltf Cre / + Carbonylation levels of uterine proteins in female mice. The statistical error bars in figures (bc), (ef), and (h) are mean ± SEM. Statistical analysis was performed using one-way ANOVA and Dunnett's post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001, ns: no significant difference.

[0043] Figure 4 For the purposes of this invention, Gpx4 during pregnancy f / f Ltf Cre / + Female mice were treated with the lipid peroxidation inhibitor Liproxstatin-1 (Lip1). a) Timeline of Lip1 treatment. b) GPX4 after Lip1 treatment. f / f and GPX4 f / f Ltf Cre / + Pregnancy outcomes in female mice. n represents the number of mice tested. The statistical error bar is mean ± SEM. Statistical analysis was performed using Student's t-test with two samples and equal variances. P < 0.0001. (cd) Lip1 drug treatment Gpx4 f / f and GPX4 f / f Ltf Cre / + Pregnant mice were assessed for pregnancy on day 10 (c) and day 5 (d). Gpx4 was isolated on day 4 after Lip1 treatment. f / f and GPX4 f / f Ltf Cre / + Lipid peroxidation levels were detected in mouse uterine epithelial cells (e) and stromal cells (f) (n=4 mice per group). The statistical error bars in figures (e) and (f) are mean ± SEM. Statistical analysis was performed using one-way ANOVA and Dunnett's post hoc test. ***P<0.001, ns: no significant difference. g) IHC detection of Gpx4 f / f and GPX4 f / f Ltf Cre / + and Gpx4 after Lip1 treatment f / f Ltf Cre / +4-HNE signal in mice on day 4 of pregnancy. Scale bar, 200 μm. Immunofluorescence of Ki67 and CTNNB1 shows Gpx4. f / f Ltf Cre / + Uterine epithelial cell proliferation on day 4 of pregnancy in mice after Lip1 treatment. Scale bar, 200 μm.

[0044] Figure 5 In this embodiment of the invention, lipid ROS accumulation affects the level and activity of STAT3 in uterine epithelial cells. a) qPCR analysis showed that Gpx4 f / f and GPX4 f / f Ltf Cre / + Expression of uterine receptivity-related genes in mice after Lip1 treatment (n=5 mice per group). The statistical error bar in the figure is mean ± SEM. Statistical analysis was performed using one-way ANOVA and Dunnett's post-hoc test. *P<0.05, **P<0.01, ns: no significant difference. bc) Lip1 treatment for GPX4 f / f Ltf Cre / + On day 4 of pregnancy, IHC was performed on the mice and Gpx4. f / f and GPX4 f / f Ltf Cre / + Levels of STAT3(b) and p-STAT3(Tyr705)(c) in the uterus of female mice. Scale bar, 200 μm. d) Western blot analysis of GPx4. f / f and GPX4 f / f Ltf Cre / + and Gpx4 after Lip1 treatment f / f Ltf Cre / +Changes in protein levels of STAT3, p-STAT3 (Tyr705), and p-STAT3 (Ser727) in the uterus of female mice on day 4 of pregnancy. e) Western blot analysis of protein levels of STAT3, p-STAT3 (Tyr705), and p-STAT3 (Ser727) in in vitro Ishikawa cell lines. f) Changes in DNP-labeled carbonylated protein levels in three Ishikawa cell lines: Ctrl-sg, Gpx4-sg, and Gpx4-sg+Lip1. g) Western blot analysis of DNP-labeled carbonylated proteins in Ctrl-sg, Gpx4-sg, and Gpx4-sg+Lip1 Ishikawa cells after transfection with STAT3-Flag. h) LC-MS mass spectrometry showing the carbonylation modification site of STAT3 at Pro689. i) Western blot analysis of DNP-labeled carbonylated proteins in GPX4 knockout Ishikawa cells after transfection with STAT3 and STAT3(P689A)-Flag.

[0045] Figure 6 In this embodiment of the invention, Acsl4 deletion in the uterine epithelium can improve implantation defects caused by GPx4 knockout in epithelial cells and preserve fertility. a) Regarding GPx4 f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Serial sections of uterine tissue from female mice on day 4 of pregnancy were subjected to immunohistochemistry with GPX4 and Acsl4. Scale bar, 200 μm. b) GPX4 f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Pregnancy outcome in pregnant mice. c) Observe Gpx4 f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Pregnancy status of female mice on day 18 of gestation. Parentheses indicate absorption sites, and arrows indicate viable fetuses. (d) Immunofluorescence staining for Ki67 and CTNNB1 and qPCR detection of proliferation-related genes (e) Ccnd1, Mcm2, and Mcm7 expression, showing Gpx4 f / f Acsl4 f / f Ltf Cre / + No abnormal epithelial cell proliferation was observed in female mice on day 4 of gestation (n=6 mice per group). Scale bar, 100 μm. (fg) Isolation of Gpx4f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Lipid peroxidation levels were assessed in uterine epithelial cells (f) and stromal cells (g) from female mice on day 4 of pregnancy (n=4 mice per group). LE, luminal epithelium; ST, stroma. h)Gpx4 f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Immunohistochemical results of 4-HNE in the uterus of female mice on day 4 of pregnancy. Scale bar, 200 μm. i)Gpx4 f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Embryo implantation status in the uterus of female mice on day 5 of pregnancy. j)Gpx4 f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Expression of COX2 and CK8 at the implantation site in female mice on day 5 of gestation. Scale bar, 200 μm. Arrows indicate embryonic location. f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Uterine changes in female mice on day 6 of pregnancy. f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + Immunofluorescence results of Ki67 and CTNNB1 implantation sites on day 6 of gestation in female mice. Scale bar, 500 μm. Statistical error bars in figures (b), (e), and (fg) are mean ± SEM. Statistical analysis was performed using Student's t-test with two samples and equal variances. *P<0.05, ****P<0.0001, ns: no significant difference.

[0046] Figure 7In this embodiment of the invention, recurrent implantation failure (RIF) patients undergoing in vitro fertilization (IVF) treatment showed a high correlation with decreased endometrial GPX4 levels and increased lipid peroxide levels. ab) Serum MDA levels (a) and non-heme iron levels (b) in women with recurrent implantation failure (n=33) and control pregnant women (n=44) showed increased serum lipid peroxide levels in patients with recurrent implantation failure. All serum samples were collected one day before embryo transfer. c) Real-time quantitative PCR was used to detect GPX4 and ACSL4 expression in endometrial tissues of women with normal successful pregnancies (n=8) and patients with recurrent implantation failure (n=16). d) GPX4 and ACSL4 protein levels in endometrial tissues of women with normal successful pregnancies (n=8) and patients with recurrent implantation failure (n=16). e) Multiplex immunofluorescence staining of GPX4, ACSL4, and CK8 showed significantly decreased GPX4 expression in the uterine epithelium of patients with recurrent implantation failure. CK8 is a human uterine epithelial marker. Scale bar, 200 μm. f) Immunohistochemistry showed a significant increase in 4-HNE levels in the uterine epithelium of RIF patients with low GPX4 expression, indicating that low GPX4 expression in uterine cells of these patients is often accompanied by significant lipid peroxidation. Scale bar, 200 μm. g) Analysis of DNP-labeled carbonylated protein content in human endometrial tissue demonstrated that increased lipid ROS levels in the uterus of RIF patients led to changes in protein carbonylation modification levels. β-Actin was used as a loading control. The statistical error bar in figure (ac) is mean ± SEM. Statistical analysis was performed using the two-sample, equal-variable Student's t-test. *P<0.05, **P<0.01, ns: no significant difference. Detailed Implementation

[0047] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0048] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the invention. As used herein, the singular form includes the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this invention, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0049] The present invention will now be further illustrated with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Unless otherwise specified, experimental conditions not explicitly stated in the examples are generally performed under conventional conditions or as recommended by the reagent company. Unless otherwise specified, all reagents and consumables used in the following examples are commercially available.

[0050] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. The following examples illustrate test methods with specific conditions, which are generally performed under conventional conditions.

[0051] Example

[0052] 1. Materials and Methods

[0053] 1.1 Human Serum Collection: Female patients undergoing in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI) at the Reproductive Hospital Affiliated to Shandong University were selected. All serum samples were collected one day before embryo transfer. The normal human blood sample control group included 44 women who successfully conceived after IVF / ICSI treatment due to tubal factors, ovulation disorders, or male factors. Serum samples from women with recurrent implantation failure (RIF) were collected from patients who had at least three failed IVF-ET attempts, including at least 4-6 high-scoring 8-cell embryos or 3 high-quality blastocysts. Furthermore, all 33 patients in the RIF group experienced implantation failure after embryo transfer. Table 1 details the patients' clinical parameters. Both groups of patients had good baseline hormone levels and a good response to hormone stimulation. Peripheral blood was centrifuged (3500 g / min, 10 min) to collect serum samples, which were then frozen at -80°C for testing.

[0054] Table 1. Human clinical parameters collected from serum samples of patients with successful pregnancies and recurrent implantation failure after in vitro fertilization (IVF) treatment.

[0055]

[0056]

[0057] BMI (Body Mass Index); FSH (Follicle-Stimulating Hormone); LH (Luteinizing Hormone); AFC (Antral Follicle Count); P-values ​​were analyzed using the non-parametric Kolmogorov-Smirnov test.

[0058] 1.2 Human Endometrial Sample Collection: Endometrial tissue was collected from female patients on day 7 post-ovulation (detected by ultrasound) using a Pipellede catheter for biopsy. All participants had experienced at least 2-3 IVF-ET failures, with a total of at least 4-6 high-grade 8-cell embryos or 2 high-quality blastocysts transferred. Patients who received hormone therapy during their last three menstrual cycles were excluded. Participants were divided into implantation success and implantation failure groups based on the pregnancy outcome of the next transfer cycle following the endometrial biopsy. The criterion for successful implantation was the presence of a gestational sac on ultrasound. Detailed clinical parameters of the human endometrial donor are shown in Table 2. Each tissue sample was divided into two pieces, immediately frozen in liquid nitrogen or fixed in 4% formalin, and subjected to immunohistochemical or other experimental analyses.

[0059] Table 2. Clinical parameters of endometrial donors in patients with successful pregnancies and recurrent implantation failure after IVF treatment.

[0060]

[0061]

[0062] E, Endometritis; N, Normal; F, Recurrent Implantation Failure; PRL, Prolactin; T, Testosterone; TSH, Thyroid-Stimulating Hormone

[0063] 1.3 Multiplex Immunofluorescence Analysis of Human Endometrial Tissue Samples: Multiplex immunofluorescence detection of Gpx4 (1:100), Acsl4 (1:200), and CK8 (1:500) in paraffin sections of endometrial tissue from RIF patients and controls was performed using the OPAL Polaris system (Akoya Biosciences). Primary antibody and Oppl Polymer HRP Anti-Mouse / Rabbit secondary antibody (ARH1001EA) were applied according to the manufacturer's instructions, followed by tyramine signal amplification and staining with an OPAL fluorophore (NEL811001KT). Opal fluorophore detectors were used for Opal 620 (Gpx4), 690 (Acsl4), and 520 (CK8) dyes, and DAPI was used for nuclear staining. The stained slides were scanned using a multispectral panoramic tissue scanning microscope (tissufaxs Spectra), and the expression levels of Gpx4 and Acsl4 proteins were compared and analyzed by fluorescence intensity.

[0064] 1.4 Mouse model construction and pregnancy event analysis: Pgr Cre / + Mice were provided by the laboratories of John Lydon and Francesco DeMayo (Baylor College of Medicine, Houston, TX, USA), Acsl4 f / fThe mice were produced by WeiGu's laboratory (Columbia University, New York, NY, USA). Cre / + and GPX4 f / f The mouse strain was purchased from Jackson Laboratories. Floxed female mice were used in combination with Pgr... Cre / + and Ltf Cre / + Male mice were mated to obtain Gpx4. f / f Pgr Cre / + GPX4 f / f Ltf Cre / + Acsl4 f / f Ltf Cre / + and GPX4 f / f Acsl4 f / f Ltf Cre / + Female mice. Mating of eligible female mice with fertile wild-type male mice to induce pregnancy (vaginal plug = day 1 of pregnancy), pregnancy status was assessed. Pregnant mice were examined for implantation site via intravenous injection of Chicago blue dye at the canthus on day 5 of pregnancy, and litter size was analyzed from days 17 to 21 of pregnancy. For drug treatment of pregnant mice, each female mouse received an intraperitoneal injection of 600 μg of Liprostatin-1 daily from day 1 of pregnancy until the pregnancy checkpoint at 9:00 AM.

[0065] 1.5 In situ hybridization (ISH) detection of changes in Gpx4 and endometrial receptivity genes: Frozen uterine tissues of various genotypes were mounted on the same slide, fixed with 4% PFAT (PFA + 0.1% Tween 20), dehydrated and rehydrated with graded methanol, and digested. After hybridization with digoxigenin (DIG)-labeled probes, Anti-DIG-AP (Roche, 11093274910) antibody was applied. The colorimetric reaction was observed using a BCIP / NBT chromogenic kit (Roche, 11697471001). The signal was observed under bright-field scanning using an OLYMPUS (VS120) panoramic scanner. Probe preparation: Probes for Gpx4 and receptivity-related genes such as Muc1 and Ltf were constructed using the SP6 / T7 transcription kit (Roche, 11175025910) for detection.

[0066] 1.6 Immunofluorescence (IF) and immunohistochemistry (IHC) analysis of embryo implantation, uterine receptivity, and lipid peroxidation levels: Frozen sections of uterine tissue were prepared at -20℃, fixed with 4% paraformaldehyde (PFA), washed with 1×PBST (PBS + 0.1% Triton X-100), and blocked with 5% bovine serum albumin (BSA). Subsequently, primary antibodies such as Cox2 and Ki67, and secondary antibodies conjugated with Alexa 488 or Alexa 594 were applied and stained. TUNEL staining was performed using a cell death detection kit (Beyotime, C1086). Finally, panoramic scanning fluorescence microscopy was used to acquire images and assess embryo implantation and uterine receptivity. Uterine tissue for IHC was fixed in 10% neutral formalin, sections were dehydrated with gradient ethanol, blocked with endogenous peroxidase blocking solution (Beyotime, P0100A) and 5% BSA, and then incubated with MDA, 4HNE, Stat3 and other antibodies and corresponding secondary antibodies. The lipid peroxidation level was detected by colorimetric observation using a DAB kit.

[0067] 1.7 Isolation of Uterine Epithelial and Stromal Cells and Flow Cytometry Detection of Lipid ROS Accumulation: Uterine tissue blocks from pregnant rats were digested with trypsin (Sigma, P3292) and dispersin (Roche, 4942078001). Epithelial cells were separated from the tissue fragments under a stereomicroscope and obtained by collagenase digestion. The remaining tissue was further digested using an enzymatic method (Sigma, C5138) to obtain a cell suspension, which was then filtered through a nylon mesh and centrifuged to obtain uterine stromal cells. Cells were resuspended and stained with C-11BODIPY 581 / 591 dye (Invitrogen, D3861). Lipid ROS levels in different cell types of the uterus were detected by flow cytometry (Gallios), and data were analyzed using FlowJo software.

[0068] 1.8 Determination of MDA and Non-heme Iron Levels in Human and Pregnant Mouse Serum: The method for determining MDA content was improved based on published literature. A quantitative amount of 1-methyl-2-phenylindole solution was added to 100 μL of serum, and the reaction was incubated with 37% hydrochloric acid. After centrifugation (10 min, 15,000 g, 4℃), the supernatant was collected, and the absorbance at 595 nm was measured. 1,1,3,3-Tetramethoxypropane (Sigma-Aldrich, 108383) was used as a standard to determine the MDA concentration. For the detection of non-heme iron levels, iron colorimetric solutions and working solutions were prepared using disodium-4,7-diphenyl-1,10-phenanthroline disulfonate (Solarbio, 52746-49-3) and 70% mercaptoacetic acid (Sigma, T6750). Iron standard solutions with concentrations ranging from 0 to 1000 μg / dL were prepared according to the instructions for use with Sigma, 02583. The reaction of serum and iron standard solutions was performed in 96-well plates using iron chromogenic working solution. The absorbance values ​​at 535 nm were measured and analyzed using a TECAN microplate reader (INFINITE 200PRO).

[0069] 1.9 Protein carbonylation level determination and serum P4 and E2 content detection: The protein carbonylation level in the endometrium of pregnant mice was detected using the OxiSelect proteinCarbonyl ELISA Kit (Cell Biolabs, STA-310). Hormone levels were detected by collecting serum from female mice on day 4 of pregnancy and measuring them using enzyme-linked immunosorbent assay kits (Cayman, 582601 and 501890).

[0070] 1.10 qRT-PCR and Immunoblot Analysis: Uterine tissue homogenates were prepared using TRIzol reagent (Invitrogen, 15596-018), and RNA was extracted using the chloroform-isopropanol precipitation method. The RNA was washed with ethanol and purified. RNA was reverse transcribed into cDNA using the Evo M-MLVRT kit and gDNAClean Kit (Accurate Biology, AG11711). Quantitative PCR was performed using SYBR Green Master Mix (Vazyme, Q311-02) and specific primers, and analyzed using a real-time PCR system (Light Cycler 96). The expression levels of GPx4 and Acsl4 in human endometrial RIF patients and changes in uterine cell proliferation, death, and receptivity in pregnant mice were compared. For immunoblotting analysis, tissue or cellular proteins were extracted using RIPA buffer (Beyotime, P0013B) and purified using Pierce PCR. TMProtein concentration was determined using a BCA kit (Thermo, 23227) for quantification. Proteins were separated by SDS-PAGE gel electrophoresis and transferred to a PVDF membrane. The membrane was blocked with 5% skim milk powder and then incubated with Stat3, p-Stat3 antibodies, and secondary antibodies. Bands were detected using an ECL kit (Thermo, 32106) and an Amersham Imager 680 system.

[0071] 1.11 Detection of Total Protein Carbonylation and Protein Immunoprecipitation (IP): The OxiSelect Protein Carbonylation Immunoblotting Kit (Cell Biolabs, STA-308) was used to detect the carbonylated protein levels in Ishikawa cells and endometrial samples from human RIF patients. Dinitrophenylhydrazine (DNPH)-derived oxidized proteins were analyzed in PVDF membranes, and the carbonylated proteins were visualized using Western blotting. The IP experiment mainly involved Stat3-Flag plasmid transfection with flag antibody and A / G agarose beads (Santa Cruz, B2422). Immunoprecipitated proteins were separated by SDS-PAGE. Western blot analysis using flag (Sigma, F1804) and DNP (Cell Biolabs) antibodies confirmed that Gpx4 deficiency caused significant carbonylation modification of Stat3 proteins.

[0072] 1.12 Transmission electron microscopy observation of mitochondrial and microvilli changes in endometrial cells to assess uterine epithelial function: Fresh pregnant mouse uterine tissue was fixed sequentially in 2.5% glutaraldehyde / 0.1M phosphate buffer (pH 7.4) and osmium tetroxide fixative. Samples were then treated with a gradient of ethanol and acetone, followed by epoxy resin embedding and polymerization. Semi-thin sections and ultrathin sections were prepared using a Leica EMUC7 microtome, with a thickness accurate to 50 nm. Ultrathin sections were stained with saturated uranium acetate and lead citrate solutions, and then imaged and analyzed using a Thermo Fisher transmission electron microscope (Talos F200C).

[0073] 1.13 Analysis of Lip-1 rescue efficiency in Ishikawa cells after GPX4 knockout and drug treatment: GPX4 was knocked out in Ishikawa cells using a CRISPR / Cas9 system for cell culture. The sgRNA sequences were designed as CACCGAGAGATCAAAGAGTTCGCCG (SEQ ID NO.1) and AAACCGGCGAACTCTTTGATCTCTC (SEQ ID NO.2). Ishikawa cells were treated with different concentrations of Liproxstatin-1 (Selleck, S7699), Necrostatin-1 (Selleck, S8037), and z-VAD-FMK (Selleck, S7023). Cells were collected to detect lipid ROS levels. GPX4 deficiency caused significant accumulation of lipid ROS, and Lip-1 significantly reduced this phenomenon.

[0074] 1.14 Protein quantification and carbonylation modification site identification by LC-MS / MS: Proteins from control and Gpx4-deficient Ishikawa cells were collected, incubated with flag antibody and magnetic beads, and then separated by SDS-PAGE to obtain immunoprecipitated proteins. Tandem mass spectrometry was performed using a Thermo EASY-nLC 1000 UPLC system and Q Exactive microarray data provided by Jingjie Biotechnology Co., Ltd. TM Plus (Thermo) performed NSI source analysis on the stat3 peptide, a uterine receptivity protein, and processed the obtained mass spectrometry data using Proteome Discoverer 1.3 software. In the GPX4 knockout cell line, a specific carbonylation modification of proline at position 689 of the stat3 protein was detected, with a peptide ion score >20, while no change at this modification site was detected in the control group.

[0075] 2. Results and Discussion

[0076] 2.1 Glucophora 4 deficiency in the uterus leads to complete infertility in female mice and defects in embryo implantation.

[0077] The GPX family consists of eight proteins that are widely distributed in the body and break down peroxidation products. Previously, we sequenced RNA from uterine epithelial and stromal cells isolated from mice on day 4 of pregnancy and found that Gpx4 was one of the most abundant genes expressed in this family. To investigate whether Gpx4 plays a role in female pregnancy, we collected uterine tissue at different stages of early pregnancy. Through sectioning and immunohistochemical (IHC) experiments, we found that Gpx4 was mainly localized in uterine epithelial cells from day 1 to day 4 of pregnancy, and subsequently expressed primarily in stromal cells and decidual cells on days 5 and 8. Figure 1a). At the same time, in situ hybridization (ISH) technology confirmed at the RNA level that Gpx4 has the same spatiotemporal expression pattern during the implantation period.

[0078] To further investigate the physiological function of GPX4 in the uterus, we used progesterone receptor transgenic tool mice (Pgr-Cre) and GPX4... flox Mouse hybridization was used to generate GPX4-specific knockout (KO) female mice with inactivated GPX4 in the endometrium. Experiments confirmed that GPX4 expression in the uterus of KO mice was significantly reduced at both RNA and protein levels. Statistical analysis revealed that GPX4... f / f Pgr Cre / + Female mice were completely infertile, while the control group Gpx4... f / f Mice can conceive and give birth normally. Figure 1 b). We examined the implantation site status in mice on day 5 of pregnancy by injecting Chicago blue and found that, compared with the control group, Gpx4 f / f Pgr Cre / + Mouse embryo implantation failed, and some implantation defects occurred. Figure 1 cd). Hematoxylin-eosin staining and immunofluorescence results showed that the morphology of the crypt chambers in the uterus of this mouse was abnormal on the 5th day of pregnancy. Figure 1 e), the expression of cyclooxygenase 2 (COX2) also changed. Figure 1 f) Cox2 is a marker molecule for embryo implantation. These results further demonstrate that the absence of GPX4 in the endometrium leads to abnormal embryo implantation and infertility, indicating that GPX4 is crucial for normal fertility in female mice. Since GPX4 is expressed in small amounts in ovarian follicles, and Pgr-Cre is also expressed in the ovary, to rule out the influence of ovarian function, we... f / f and GPX4 f / f Pgr Cre / + Serum progesterone (P4) and 17β-estradiol (E2) levels in mice were measured, and no significant difference was found between KO mice and the control group on day 4 of gestation. Cytochrome p450 side-chain cleavage enzyme (P450scc) and 3β-hydroxysteroid dehydrogenase (3β-HSD) are two key enzymes affecting P4 biosynthesis and can serve as markers for assessing ovarian function. Subsequently, we detected the expression of these two markers on day 4 of gestation in the ovaries of control and Gpx4-Pgr KO mice, and found no significant change in their levels in the ovaries, indicating that Gpx4 deficiency does not affect female ovarian development and uterine morphology.

[0079] 2.2 Abnormal Gpx4 expression in the uterus leads to endometrial receptivity disruption.

[0080] To further investigate the reasons for Gpx4-Pgr KO implantation failure in pregnant mice, we used frozen section immunofluorescence to detect the expression of estrogen receptor 1 (ESR1) and progesterone receptor 1 (PR) in the uterus on day 4 of mouse gestation. We found that both proteins were expressed in Gpx4... f / f and GPX4 f / f Pgr Cre / + No significant difference was observed in FOXA2 expression in the mouse uterus. FOXA2, a marker molecule for uterine gland function, also showed no significant change in expression pattern compared to control mice. Subsequently, we examined the expression of the uterine epithelial estrogen response genes mucin 1 (Muc1) and Ltf on day 4 of pregnancy. In situ hybridization results showed that Muc1 and Ltf were expressed in GPX4. f / f Pgr Cre / + Significantly increased expression in mouse uterine epithelial cells ( Figure 1 The presence of g,h indicates that Gpx4 deficiency leads to an abnormally enhanced estrogen response. Next, analysis of genes related to uterine receptivity using real-time quantitative PCR (qRT-PCR) revealed significantly elevated expression levels of E2-responsive genes such as Muc1, Ltf, Wnt7b, insulin-like growth factor 1 (Igf1), and Stat3 on day 4 of gestation in Gpx4-Pgr KO mice. Figure 1 i) further confirms the previous results. Meanwhile, the expression of leukemia inhibitory factor (lif) was not different in the uterus of control and Gpx4-Pgr KO mice, indicating that Gpx4 deficiency in the uterus does not affect embryo implantation by altering glandular function. Figure 1 i). On day four, the uterine epithelium responds to P4 signaling, inhibiting the cell cycle and adjusting cell polarity in preparation for embryo implantation. Subsequently, we detected the expression of p4 response-related genes and found that in GPx4... f / f Pgr Cre / + In the uterus of mice on day 4 of pregnancy, expression of the dual-regulatory protein (Areg) and the Indian hedgehog homolog (Ihh) was decreased, while expression of Wnt family member 4 (Wnt4) was increased, while Hoxa10 and Hand2 levels showed no significant change. Figure 1 j) indicates that the absence of Gpx4 affects specific p4-responsive genes in the uterus, leading to abnormal endometrial progesterone responses. The synergistic effect of estrogen and progesterone is one of the key factors in the establishment of receptivity. These results suggest that Gpx4-Pgr KO implantation failure is due to altered uterine sensitivity to hormones, hindering the establishment of receptivity homeostasis.

[0081] For an embryo to locate, adhere, and implant within the uterine cavity, it must enter the window period of pregnancy. A key characteristic of the mouse uterus entering the receptive state is the cessation of cell proliferation and cell death in the luminal epithelial cells. Therefore, on day 4 of mouse pregnancy, we performed immunofluorescence staining of the uterus with the proliferation markers Ki-67 and pHH3 to observe cell proliferation. We found that compared with flux mice, Gpx4... f / f Pgr Cre / + Significant abnormal cell proliferation was observed in the uterine epithelium of mice. Figure 1 k), qRT-PCR analysis revealed that the expression levels of cell proliferation markers Ccnd1, Mcm2, and Mcm7 were significantly upregulated on day 4 of mouse gestation, further demonstrating that Gpx4 deficiency causes abnormal uterine cell proliferation. Furthermore, TUNEL staining revealed that Gpx4 expression was significantly upregulated on day 4 of gestation. f / f Pgr Cre / + Abnormal cell death also occurred in the uterine epithelial cells. However, this cell death was not caused by apoptosis. By detecting the expression of pyroptosis-related genes (Casp11, Casp1, and Gsdmd) and ferroptosis-related genes (Ptgs2, Mdm2, Tfrc, Fth, Alox12, and Slc7a11), it was found that Gpx4 was present on day 4 of pregnancy. f / f Pgr Cre / + Increased pyroptosis and ferroptosis in mouse uterine cells. These results further demonstrate that Gpx4 deficiency leads to dysfunction of the uterine cavity epithelium and impairs uterine receptivity.

[0082] 2.3 Specific inactivation of GPX4 in the uterine epithelium can cause abnormal embryo implantation and lead to infertility.

[0083] Since crossbreeding Pgr-Cre-driven gene expression tool mice with flux mice can knock out Gpx4 gene expression in almost all uterine cell types, including myometrium, uterine stromal cells, and epithelial cells, we constructed a Gpx4 gene-inducing system by crossbreeding Ltf-Cre (expressed in uterine epithelial cells) tool mice with flux mice. f / f ltf Cre / + A mouse model was established in which Gpx4 was specifically knocked out only in uterine epithelial cells. qPCR experiments using isolated mouse uterine epithelial and stromal cells confirmed the effective deletion of Gpx4 in the mouse uterine epithelium at the RNA level. In situ hybridization and immunohistochemical results also validated this conclusion. Figure 2 Interestingly, Gpx4 deficiency in the uterine epithelium leads to increased Gpx4 expression in stromal cells. Figure 2 a) This may be due to feedback regulation of signaling molecules among different cell types in the uterus. Next, regarding Gpx4...f / f ltf Cre / + Pregnancy outcomes and litter size in mice were observed and statistically analyzed, and Gpx4 was found to be... f / f ltf Cre / + The mice are still unable to reproduce. Figure 2 c). Chicago blue staining results showed that the mouse embryos experienced implantation defects or failures on day 5 of gestation. Figure 2 d). Further observation of its reproductive phenotype revealed that Gpx4 f / f ltf Cre / + In mice, complete fetal resorption occurs during mid-pregnancy. Figure 2 e,f).

[0084] Since the absence of Gpx4 in only uterine epithelial cells leads to female infertility, similar to the phenotype of Gpx4-Pgr KO mice, we hypothesized that the complete infertility in these mice might also be due to abnormal uterine receptivity, similar to that in Gpx4-Pgr KO females. Further investigation into Gpx4... f / f ltf Cre / + The reason for the phenotypic defects in mice was determined by isolating Gpx4. f / f and GPX4 f / f ltf Cre / + On day 4 of gestation in female mice, qPCR was used to detect the expression of receptivity-related genes crucial for uterine epithelial function. The results showed that the absence of Gpx4 in uterine epithelial cells led to abnormal E2 and P4 responses in the epithelium, and impaired estrogen-progesterone response and synergistic effects. Figure 2 g). Immunostaining analysis with Ki67 and pHH3 revealed that Gpx4 f / f ltf Cre / + Abnormal proliferation of uterine epithelial cells was also observed in mice on day 4 of pregnancy. Figure 2 h). Simultaneously, TUNEL staining also detected different types of cell death in the mouse uterine epithelial cells, including ferroptosis and pyroptosis. Figure 2 i). In summary, these data suggest that uterine epithelial cell Gpx4 is crucial for epithelial remodeling, receptivity establishment, and embryo implantation during female pregnancy.

[0085] 2.4Gpx4 knockout mice showed increased lipid peroxidation levels in the uterus, disrupting redox homeostasis.

[0086] Literature reports that GPX4 maintains cellular redox homeostasis by reducing the accumulation of lipid hydroperoxides. Does GPX4-deficient uterine epithelial cells undergo lipid peroxidation, thus causing epithelial dysfunction? As previously mentioned, lipid peroxidation products include initial lipid hydrogen peroxides (LOOHs) and subsequent reactive aldehydes, primarily malondialdehyde (MDA) and 4-hydroxynonenal (4HNE). Both are produced by non-heme iron-induced lipid peroxidation reactions and can serve as optimal tools for detecting and quantifying lipid peroxidation in biological samples. Surprisingly, no MDA signal was observed in the uterus of normal mice and GPX4-deficient mice on day 1 of gestation. However, on day 2 of gestation, a large accumulation of the lipid peroxide malondialdehyde was observed in the uterus of all three mouse types, and this accumulation gradually decreased from day 3 of gestation. Since the uterus of mice is in the receptive phase on day 4 of gestation, preparing for embryo implantation at this critical stage, we further examined the accumulation of lipid peroxides in the uterus on day 4 of gestation. The results showed that, compared with the control group, GPX4... f / f Pgr Cre / + MDA signaling was significantly increased in uterine stromal cells of female mice. Figure 3 a) and Gpx4 f / f Pgr Cre / + and GPX4 f / f ltf Cre / + The MDA signal on the uterine epithelial surface of female mice was significantly higher than that of flox mice. Simultaneously, by detecting malondialdehyde and non-heme iron levels in the serum of mice on day 4 of pregnancy, we found that the MDA and non-heme iron levels in the serum of uterine GPX4 knockout mice were significantly higher than those in the control group. Figure 3 (b, c) This indicates that Gpx4 deficiency not only leads to the accumulation of lipid peroxides in the mouse uterus but also causes an increase in serum lipid peroxidation levels. Next, we analyzed the level of 4-hydroxynonenal in the mouse uterus using immunohistochemistry and found that Gpx4... f / f Pgr Cre / + and GPX4 f / f ltf Cre / + 4-HNE signal was significantly enhanced in the uterine epithelium of female mice. Figure 3 d).

[0087] Next, to further confirm the changes in intrauterine lipid peroxidation levels, we used the Bodipy-C11581 / 591 probe (commonly used to detect phospholipid peroxides in cell membranes) to stain and label uterine epithelial cells and uterine stromal cells isolated on day 4 of pregnancy. Flow cytometry sorting analysis revealed Gpx4... f / f Pgr Cre / + and GPX4 f / f ltf Cre / + Increased lipid peroxidation levels were detected in all female mouse uterine epithelial cells. Figure 3 e). Furthermore, Gpx4 f / f Pgr Cre / + Significant lipid peroxidation also occurred in mouse uterine stromal cells, while Gpx4 f / f ltf Cre / + No significant increase in fluorescence intensity of Bodipy-C11 581 / 591 was observed in mouse uterine stromal cells. Figure 3 f). Subsequently, we observed using transmission electron microscopy (EM) that Gpx4 f / f Pgr Cre / + and GPX4 f / f ltf Cre / + In the uterus of female mice on the 4th day of pregnancy, the mitochondrial structure and morphology of epithelial cells were abnormal, with a reduction in mitochondrial cristae in the luminal epithelium and the disappearance of some mitochondrial cristae. Figure 3 g), this is a marker of ferroptosis in cells. It should be noted that, compared to the control group, although Gpx4 f / f ltf Cre / + The mitochondrial morphology of the vast majority of uterine stromal cells in female mice showed no significant changes. Figure 3 While the mouse stromal cells surrounding the epithelium showed mitochondrial abnormalities, we hypothesized that these stromal cells, located near the epithelium, are crucial for embryo implantation, crypt formation, and the formation of the primary decidua. Therefore, they may be affected by the bioactive substance lipid aldehyde released by Gpx4-deficient epithelial cells. Simultaneously, in the Gpx4-deficient uterus, we observed a reduction in microvilli on the apical surface of luminal epithelial cells and a shortening of villus length, further indicating epithelial dysfunction. Subsequently, we analyzed the results using an ELISA kit and found higher levels of protein carbonylation in the Gpx4-deficient uterus on day 4 of gestation. Figure 3 h), an irreversible protein modification caused by aldehyde molecules derived from lipid peroxidation, indicates that Gpx4 deficiency in the uterine epithelium makes epithelial cells more sensitive to lipid peroxidation. In summary, these results suggest that Gpx4 deficiency in early pregnancy increases lipid peroxidation levels in the uterine epithelium, thereby affecting uterine receptivity establishment and leading to abnormal homeostasis of the epithelial-stromal cell interaction required for implantation, ultimately resulting in infertility.

[0088] 2.5 The lipid peroxidation inhibitor Lip1 effectively inhibited lipid ROS accumulation in mice induced by GPX4 deficiency, but failed to salvage embryo implantation.

[0089] Since GPX4 deficiency induces significant lipid peroxidation in uterine cells, leading to implantation failure and infertility, could inhibiting epithelial lipid peroxidation salvage fertility in mice? To answer this question, we first established a GPX4 knockout Ishikawa cell line in human endometrial cancer epithelial cells using CRISPR-Cas9 technology. As expected, significantly elevated lipid peroxidation levels were observed in GPX4 knockout Ishikawa monoclonal cells, and the lipid peroxidation inhibitor (Lip1) effectively reduced lipid peroxidation in the GPX4 knockout Ishikawa cell line. Subsequently, we evaluated the effect of Lip1 on GPX4... f / f Ltf Cre / + Improvement in pregnancy outcomes in female mice, Gpx4 f / f and GPX4 f / f Ltf Cre / + Female mice were intraperitoneally injected with Lip1 (600 μg / d) starting from day 1 of pregnancy. Observations showed that although the dosage of Lip1 had an effect on GPx4... f / f The pregnancy outcome in control mice was not significantly adversely affected, ruling out the toxicological effects of the drug, but it failed to salvage Gpx4. f / f Ltf Cre / + The fertility of female mice ( Figure 4 a, b). We assessed the pregnancy status of the mice on day 10 after Lip1 treatment and found Gpx4 f / f Ltf Cre / + The implantation site in female mice is degenerate. Figure 4 c) and Lip1 failed to completely save GPX4 f / f Ltf Cre / + female implantation defects ( Figure 4 d). To further determine whether Lip1 can effectively reduce lipid peroxidation in mouse uterus, we evaluated Gpx4 using the Bodipy C11 581 / 591 probe staining method. f / f and GPX4 f / f Ltf Cre / + The levels of lipid peroxidation in uterine epithelial cells and stromal cells of female mice after treatment with Lip1. The results indicate that Lip1 effectively attenuates Gpx4. f / f Ltf Cre / + Lipid ROS accumulation in uterine epithelial cells on day 4 of pregnancy ( Figure 4 e, f). 4-HNE immunohistochemical experiments also confirmed that intraperitoneal injection of Lip1 effectively reduced GPx4. f / f Ltf Cre / + Lipid peroxidation of uterine epithelial cells ( Figure 4g). However, Ki67 immunofluorescence revealed that Gpx4 was present on day 4 after Lip1 treatment. f / f Ltf Cre / + Abnormal cell proliferation of uterine epithelium still exists. Figure 4 h).

[0090] Subsequently, we tested for genes related to uterine receptivity and found that, compared with the control group, GPX4 levels were lower after Lip1 treatment. f / f Ltf Cre / + Some gene expression has returned to normal levels, but other key genes are still expressing abnormally. Figure 5 a). Gpx4 f / f Pgr Cre / + Similar results were observed in mice treated with the drug (Lip1 improved intrauterine lipid peroxidation levels but failed to salvage impaired uterine receptivity). Previous studies have shown that STAT3 regulates epithelial estrogen response and functional remodeling during pregnancy, and mice lacking STAT3 in the uterine epithelium are infertile. We treated Gpx4 KO mice with Lip1 and found that Gpx4… f / f Ltf Cre / + STAT3 remained abnormally expressed in the uterine epithelium of female mice, a finding further confirmed by Western blotting and IHC experiments. Figure 5 Meanwhile, in vitro experimental results also showed that STAT3 expression was upregulated and phosphorylation levels were abnormal in the GPX4 knockout Ishikawa cell line, consistent with the results of in vivo experiments in mice. Figure 5 e). Our previous results ( Figure 3 i) shows that Gpx4 f / f Ltf Cre / + On day 4 of gestation in female mice, the level of protein carbonylation increased in the uterus. Normally, protein carbonylation modification often leads to protein inactivation. Therefore, we hypothesized that irreversible carbonylation modification of a key protein related to receptivity in the GPX4-deficient uterine epithelium might explain why Lip1 treatment failed to rescue embryo implantation. To answer this question, we constructed a GPX4 knockout cell line in vitro and examined the protein carbonylation level in the Ishikawa cell line. We found that downregulation of GPX4 expression increased the level of protein carbonylation in the cells. Figure 5 f). Subsequently, we used transient transfection of STAT3-Flag to perform immunoprecipitation (IP) experiments with dinitrophenol (DNP) in GPX4 knockout Ishikawa cells to detect whether STAT3 protein underwent abnormal carbonylation modification. IP results showed that even with Lip1 treatment, elevated STAT3 carbonylation levels were detected in the GPX4 knockout Ishikawa cell line. Figure 5 g). Furthermore, we performed liquid chromatography-mass spectrometry (LC-MS) experiments using recombinant STAT3 protein in vitro and performed carbonylation analysis to identify potential carbonylation sites for STAT3. We found a specific STAT3 carbonylation modification site, Pro689, in the GPX4 knockout Ishikawa cell line. Figure 5 h). Since STAT3 is an evolutionarily highly conserved gene, its residue P689 is also conserved across species. To verify this alteration of the carbonylation site, we constructed a STAT3 mutant lacking this site, in which the proline residue was replaced by alanine (P689A). Subsequently, transfecting the STAT3 P689A mutant into GPX4 knockout Ishikawa cells revealed a significant decrease in STAT3 carbonylation levels (h). Figure 5 i) This indicates that Pro689 is a necessary residue site for the carbonylation of STAT3. These results suggest that while Lip1 treatment can inhibit lipid peroxidation in mice, it is insufficient to achieve complete recovery of uterine epithelial cell function in early pregnancy. This is due to the irreversible carbonylation modification of STAT3, a key protein related to receptivity.

[0091] 2.6 Acsl4 elimination can partially salvage fertility defects in female mice caused by Glux4 deficiency in uterine epithelium.

[0092] All the above results indicate that abnormal lipid peroxidation in the uterine epithelium during early pregnancy directly causes infertility in female mice. Our next question is whether genetic intervention at the level of key factors regulating lipid peroxidation can salvage fertility defects caused by GPX4 deficiency. Studies have reported that acyl-CoA synthase long chain member 4 (ACSL4) is an enzyme that promotes the biosynthesis of polyunsaturated phospholipids and is an important gene in lipid metabolism pathways. Recent literature shows that ACSL4-deficient cancer cells are resistant to lipid peroxidation induced by GPX4 inhibition or inactivation. Does this phenomenon also occur in vivo? To answer this question, we first analyzed the expression pattern of ACSL4 in the uterus and found that ACSL4 is located in luminal epithelial cells, with strong expression levels during days 1-4 of preimplantation pregnancy, and relatively low expression in glandular epithelial cells. The high expression of ACSL4 in the uterine epithelium suggests that ACSL4 expression can be intervened at the gene level to assess the resistance of GPX4-deficient uterine cells to lipid peroxidation under ACSL4-elimination conditions. We hypothesize that ACSL4 inactivation may rescue infertility caused by GPX4 deficiency in the uterine epithelium.

[0093] Therefore, we constructed mice with Acsl4 deficiency in uterine epithelial cells (Acsl4... f / f Ltf Cre / +Interestingly, Acsl4 f / f Ltf Cre / + The female mice did not exhibit any adverse reproductive phenotypes. Subsequently, we used Gpx4... f / f Ltf Cre / + Male rats and Acsl4 f / f Mating female mice produced mice with conditional deletion of uterine epithelium GPX4 and Acsl4 (GPX4... f / f Acsl4 f / f Ltf Cre / + ()( Figure 6 a). To test its fertility, we will use Gpx4 f / f Acsl4 f / f Ltf Cre / + When female mice were mated with WT fertile males, it was found that the double knockout female mice could produce a small number of offspring, indicating that ACSL4 inactivation can, to some extent, improve the infertility phenotype caused by the absence of GPx4 in the uterine epithelium. Figure 6 (b, c). Next, we evaluated Gpx4. f / f Acsl4 f / f Ltf Cre / + The uterine receptivity status of female mice. Surprisingly, Gpx4... f / f Acsl4 f / f Ltf Cre / + On day 4 of pregnancy in mice, there was no significant difference in uterine epithelial cell proliferation compared to the control group. Figure 6 d,e). Subsequently, by separating Gpx4 f / f Acsl4 f / f Ltf Cre / + Detection of lipid peroxidation levels in uterine epithelial and stromal cells of female mice revealed that, although the lipid peroxidation level in uterine epithelial cells of double knockout mice was still slightly higher than that of Gpx4... f / f Acsl4 f / f female mouse ( Figure 6 f,g), but with Gpx4 f / f Ltf Cre / + Compared to the group, GPX4 f / f Acsl4 f / f Ltf Cre / + The increase in lipid peroxidation levels in female mice was significantly lower than in mice with single Gpx4 deletion. Further 4-HNE immunohistochemical analysis revealed no significant change in signaling between double-mutant mice and control female mice. Figure 6h). qRT-PCR results showed that the expression of most uterine receptivity-related genes was not significantly different from that of the control group. Immunohistochemical staining revealed that the protein and phosphorylation levels of STAT3 were comparable between the double knockout mice and the control group. These results indicate that Acsl4 deficiency can ameliorate excessive lipid peroxidation induced by GPx4 knockout in uterine epithelial cells and rescue uterine receptivity defects.

[0094] Subsequently, we detected Gpx4 using Chicago blue staining. f / f Acsl4 f / f Ltf Cre / + The female mouse showed a distinct blue band at the implantation site on day 5, indicating a relationship with Gpx4. f / f Ltf Cre / + Compared to female mice, double knockout mice showed significantly improved embryo attachment. Figure 6 i) The crypt shape and COX2 expression at the implantation site also tended to normalize. Figure 6 j) indicates that Acsl4 inactivation can partially salvage embryo implantation defects caused by Gpx4 deficiency. However, further observation revealed that Gpx4 f / f Acsl4 f / f Ltf Cre / + Abnormal embryo distribution and spacing in female mice on day 6 of gestation ( Figure 6 k). During normal pregnancy, on day 6, stromal cells around the implantation site can be observed to transform into epithelial-like cells, forming an avascular primary decidual zone (PDZ). This phenomenon is observed in Gpx4. f / f Acsl4 f / f and GPX4 f / f Acsl4 f / f Ltf Cre / + It can be observed in pregnant mice, but Gpx4 f / f Acsl4 f / f Ltf Cre / + Female mice exhibited abnormal PDZ formation and decidualization response. Figure 6 This phenomenon explains why the uterine receptivity of double knockout mice tends to be normal, but the reproductive phenotype is not completely salvaged.

[0095] 2.7 In patients with recurrent implantation failure (RIF), the expression level of GPX4 in the endometrial epithelium was decreased, and abnormally high levels of lipid peroxidation were observed.

[0096] Next, we evaluated the association between lipid peroxidation levels or Gpx4 activity and implantation failure in early human pregnancy. Serum samples were collected from participants one day prior to embryo transfer: the control group underwent in vitro fertilization-embryo transfer (IVF-ET) treatment due to ovulatory dysfunction, fallopian tube factors, and male factors, and ultimately achieved successful pregnancy; the RIF group experienced recurrent implantation failure (at least 3 times), and patients with ovulatory dysfunction, chronic diseases such as diabetes or hypertension, and liver or kidney dysfunction were excluded. Detailed clinical parameters for both groups are shown in Table 1. Our analysis revealed significantly elevated serum MDA and non-heme iron levels in the RIF group compared to the control group, indicating significant lipid peroxidation in RIF patients. Figure 7 a,b).

[0097] We further collected endometrial samples during the secretory phase (7 days post-ovulation) from the control group and RIF patients who successfully conceived after IVF-ET treatment (patient parameters are detailed in Table 2). We found that the expression level of GPX4 mRNA was significantly lower in the RIF group than in the control group. In contrast, there was no significant difference in ACSL4 mRNA levels between the two groups. Figure 7 c). Low expression of GPX4 protein was also observed in some RIF patients, particularly in the endometrial epithelium, while ACSL4 protein levels showed no significant change between the two groups. Figure 7 d, e). Furthermore, patients with recurrent implantation failure showed significantly enhanced 4-HNE signal in the endometrium. These results indicate that RIF patients exhibit both low GPX4 expression and high levels of lipid peroxidation in uterine cells. Figure 7 f). Subsequently, we also examined the protein carbonylation level in human uterine tissue and found that RIF patients with higher levels of lipid peroxidation also showed increased protein carbonylation modification in their endometrium, which was highly consistent with the results of in vivo experiments in mice. Figure 7 g). The above analysis based on human experimental data indicates that abnormal expression of GPX4 in the endometrium and elevated lipid peroxidation levels are among the causes of recurrent implantation failure and infertility in women.

[0098] In summary, our clinical data suggest that abnormal lipid peroxidation in the uterine epithelium can lead to implantation defects, and that uterine lipid peroxidation levels are enhanced in patients with recurrent implantation failure or recurrent spontaneous abortion. Furthermore, further investigation into the role of lipid peroxidation in uterine stromal cells may deepen our understanding of endometrial redox homeostasis during implantation. These findings suggest that eliminating uterine lipid ROS to improve endometrial receptivity could be a potential novel therapeutic strategy to enhance embryo implantation and clinical pregnancy rates.

[0099] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. Use of reagents for detecting expression level of glutathione peroxidase 4 and detecting active aldehyde substances MDA, 4HNE, non-heme iron content in preparation of products for predicting infertility caused by repeated implantation failure.

2. The use according to claim 1, characterized in that, The glutathione peroxidase 4, active aldehyde substances MDA, 4HNE and non-heme iron are from human and non-human mammal.

3. The use according to claim 1, characterized in that, The reagents for detecting expression level of glutathione peroxidase 4 and detecting active aldehyde substances MDA, 4HNE, non-heme iron content include reagents used in thiobarbituric acid method, high performance liquid chromatography or enzyme-linked immunosorbent assay for detecting active aldehyde substances MDA, 4HNE; include reagents used in enzyme-linked immunosorbent assay for detecting non-heme iron; also include reagents for detecting expression of glutathione peroxidase 4 based on immune detection method.

4. The use according to claim 1, characterized in that, The products include primers, probes, chips, nucleic acid membrane strips, detection reagent kits, detection devices or equipment for detecting expression level of glutathione peroxidase 4 in the sample to be detected. The sample to be detected is a human or non-human sample, selected from blood samples, endometrial samples.

5. The use as claimed in claim 4, characterised in that The chip is a gene or protein chip.

6. The use as claimed in claim 4, characterised in that The blood sample is selected from serum samples.

7. The use as claimed in claim 4, characterised in that The endometrial sample is selected from endometrial epithelial cells.

8. A system for predicting the occurrence of infertility due to recurrent implantation failure, comprising, The system at least includes: An acquisition unit configured to acquire expression level of glutathione peroxidase 4 and content of active aldehyde substances MDA, 4HNE, non-heme iron of a subject; An evaluation unit configured to evaluate risk level of adverse pregnancy outcome caused by repeated implantation failure of the subject according to the expression level of glutathione peroxidase 4 and content of active aldehyde substances MDA, 4HNE, non-heme iron obtained by the acquisition unit.

Citation Information

Patent Citations

  • Method of determining indications for the appointment of antioxidant therapy in case of miscarriage

    RU2797680C1