SNP molecular markers used to construct DNA fingerprint of Ligusticum chuanxiong

Abstract

The present invention relates to a SNP molecular marker combination for constructing a DNA fingerprint map of Ligusticum chuanxiong, and the nucleotide sequence thereof is shown in SEQ ID NO.37-SEQ ID NO.48. A corresponding PCR amplification primer pair is also provided, and the nucleotide sequence is shown in SEQ ID NO.1-SEQ ID NO.36. The fingerprint map of Ligusticum chuanxiong can be constructed by combining 9 pairs of primer pairs, which is used to establish a molecular ID card of Ligusticum chuanxiong. The PCR amplification primer pair combination of the SNP molecular marker combination provided by the present invention is used for detection and identification, and the detection result is 100% accurate, and the detection result provides a high degree of reliability. This has important practical significance and protection significance for establishing a complete Ligusticum chuanxiong germplasm fingerprint map library to identify germplasm resources.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and germplasm resources, and relates to a SNP molecular marker combination for constructing a DNA fingerprint map of Ligusticum chuanxiong and a primer pair for detecting the molecular marker. Background Art

[0002] Lithocarpus litseifolius (Hance) Chun is an evergreen tree of the Fagaceae family, commonly known as "sweet tea" and "Xupu Yao tea". It is mainly distributed in provinces south of the Yangtze River and has been used as a daily drink for thousands of years. Lithocarpus litseifolius is a good source of natural sweeteners due to its high content of dihydrochalcone. In addition, in recent years, people have also discovered the medicinal value of Lithocarpus litseifolius. Its flavonoids are valued for their antioxidant, anti-allergic and antibacterial properties, as well as their ability to lower blood pressure, lower cholesterol and prevent diabetes. Lithocarpus litseifolius is a special plant resource with important economic, medicinal and breeding value.

[0003] So far, there is no standardized germplasm resource nursery of Ligusticum chuanxiong in China, and the identification of Ligusticum chuanxiong germplasm resources has always been based mainly on morphological trait identification. However, Ligusticum chuanxiong is a tall tree with a long sexual generation cycle. Not only is the identification cycle long during the trait identification process, but its agronomic traits are easily affected by environmental conditions and cultivation management measures. In addition, traditional identification methods are very difficult for some germplasm resources with small trait differences and close genetic relationships, which brings many inconveniences to the identification of Ligusticum chuanxiong germplasm resources. Therefore, accurate molecular marker methods are urgently needed to identify Ligusticum chuanxiong germplasm resources.

[0004] Molecular marker analysis methods are all based on DNA polymorphism, such as RFLP, RAPD, AFLP, ISSR, SSR, and SNP markers, which can all produce DNA fingerprints with high individual specificity. In the early days, RFLP, RAPD, and AFLP molecular marker technologies were used to build DNA fingerprint libraries for multiple species, but the above marker technologies often had problems such as poor stability, low polymorphism, and difficulty in data integration, and were not widely used. Therefore, the International Union for the Protection of New Varieties of Different Kinds of Breeds recommends SSR and SNP as the preferred DNA fingerprint marker technology. SNP markers will become the main marker type for genotype identification in the future because of their advantages such as full genome coverage, high throughput, site specificity, co-dominant inheritance, low false positive rate, sharply reduced development and detection costs, and easy data integration. With the development of sequencing technology, sequencing throughput has shown an exponential growth trend, while sequencing costs have dropped sharply, providing strong technical support for the detection of SNP markers at the whole genome level. There are abundant SNPs in each species. How to formulate SNP site screening principles, site numbers, site combinations, judgment thresholds, etc. according to different identification goals becomes the key to screening SNPs and constructing fingerprint maps. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a SNP molecular marker combination for constructing a DNA fingerprint of Ligusticum chuanxiong and a primer pair for detecting the molecular markers.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] 1. The SNP molecular marker combination used to construct the DNA fingerprint of Ligusticum chuanxiong includes the following SNP molecular markers:

[0008] The first SNP molecular marker is 306676_61, and its nucleotide sequence is shown in SEQ ID NO.37;

[0009] The second SNP molecular marker is 409640_49, and its nucleotide sequence is shown in SEQ ID NO.38;

[0010] The third SNP molecular marker is 49102_44, and its nucleotide sequence is shown in SEQ ID NO.39;

[0011] The fourth SNP molecular marker is 221537_45, and its nucleotide sequence is shown in SEQ ID NO.40;

[0012] The fifth SNP molecular marker is 328712_97, and its nucleotide sequence is shown in SEQ ID NO.41;

[0013] The 6th SNP molecular marker is 250643_87, and its nucleotide sequence is shown in SEQ ID NO.42;

[0014] The 7th SNP molecular marker 15302_129, whose nucleotide sequence is shown in SEQ ID NO.43;

[0015] The 8th SNP molecular marker 85497_65, whose nucleotide sequence is shown in SEQ ID NO.44;

[0016] The 9th SNP molecular marker is 8463_141, and its nucleotide sequence is shown in SEQ ID NO.45.

[0017] The SNP molecular marker combination further used to construct the DNA fingerprint of Ligusticum chuanxiong also includes the following SNP molecular markers:

[0018] The 10th SNP molecular marker is 185295_75, and its nucleotide sequence is shown in SEQ ID NO.46;

[0019] The 11th SNP molecular marker is 48830_118, and its nucleotide sequence is shown in SEQ ID NO.47;

[0020] The 12th SNP molecular marker is 12424_72, and its nucleotide sequence is shown in SEQ ID NO.48.

[0021] 2. The PCR primer pair combination for amplifying the above SNP molecular marker combination is designed according to the SNP molecular marker site sequence, and includes 2 upstream typing primers and 1 downstream universal primer; wherein,

[0022] The nucleotide sequences of the PCR amplification primer pairs for the first SNP molecular marker are shown in SEQ ID NO.1-3;

[0023] The nucleotide sequences of the PCR amplification primer pairs for the second SNP molecular marker are shown in SEQ ID NO.4-6;

[0024] The nucleotide sequences of the PCR amplification primer pairs for the third SNP molecular marker are shown in SEQ ID NO.7-9;

[0025] The nucleotide sequences of the PCR amplification primer pairs for the fourth SNP molecular marker are shown in SEQ ID NOs. 10-12;

[0026] The nucleotide sequences of the PCR amplification primer pairs for the fifth SNP molecular marker are shown in SEQ ID NOs. 13-15;

[0027] The nucleotide sequences of the PCR amplification primer pairs for the sixth SNP molecular marker are shown in SEQ ID NOs. 16-18;

[0028] The nucleotide sequences of the PCR amplification primer pairs for the seventh SNP molecular marker are shown in SEQ ID NOs. 19-21;

[0029] The nucleotide sequences of the PCR amplification primer pairs for the 8th SNP molecular marker are shown in SEQ ID NOs. 22-24;

[0030] The nucleotide sequences of the PCR amplification primer pairs for the 9th SNP molecular marker are shown in SEQ ID NOs. 25-27.

[0031] The PCR amplification primer pair combination of the SNP molecular marker combination further includes the following primer pairs:

[0032] The nucleotide sequences of the PCR amplification primer pairs for the 10th SNP molecular marker are shown in SEQ ID NOs. 28-30;

[0033] The nucleotide sequences of the PCR amplification primer pairs for the 11th SNP molecular marker are shown in SEQ ID NOs. 31-33;

[0034] The nucleotide sequences of the PCR amplification primer pairs for the 12th SNP molecular marker are shown in SEQ ID NOs. 34-36.

[0035] 3. Application of a primer pair combination for detecting the SNP molecular marker combination shown in SEQ ID NO.37-48 in constructing a DNA fingerprint of Ligusticum chuanxiong.

[0036] In the further described application, the primer pair combination is the PCR amplification primer pair combination shown in SEQ ID NO.1-27.

[0037] In the further described application, the primer pair combination is the PCR amplification primer pair combination shown in SEQ ID NO.28-36.

[0038] 4. Application of a primer pair combination for detecting the SNP molecular marker combination shown in SEQ ID NO.37-48 in identifying the germplasm of Ligusticum chuanxiong.

[0039] In the further described application, the primer pair combination is the PCR amplification primer pair combination shown in SEQ ID NO.1-27.

[0040] In the further described application, the primer pair combination is the PCR amplification primer pair combination shown in SEQ ID NO.28-36.

[0041] 5. A detection reagent or kit containing the PCR amplification primers shown in SEQ ID NO.1-27.

[0042] Furthermore, a detection reagent or kit containing the PCR amplification primers shown in SEQ ID NO. 1-36 is also within the scope of protection of the present invention.

[0043] The beneficial effects of the present invention are as follows: based on the simplified genome resequencing comparison of Ligusticum chuanxiong, the present invention obtains 13,883 Ligusticum chuanxiong SNPs, and then through SNP sequencing quality control, SNP site quality control, SNP screening judgment threshold setting, etc., finally obtains a SNP set for identifying Ligusticum chuanxiong germplasm, and designs primers for these SNPs, converts them into KASP markers, so as to obtain a standardized SNP fingerprint map construction process, which is used to establish a molecular ID card of Ligusticum chuanxiong. The PCR amplification primers of the SNP molecular marker combination provided by the present invention are used to detect and identify the combination, and the detection result is 100% accurate, and the detection result provides a high degree of reliability. This has important practical significance and protection significance for establishing a complete Ligusticum chuanxiong germplasm fingerprint map library to identify germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0045] Figure 1 It is part of the germplasm of Pinus armeniaca.

[0046] Figure 2 This is the genotype map of the Ligusticum chuanxiong sample at the 30667661SNP site.

[0047] Figure 3 This is the phylogenetic tree of the samples of Ligusticum chuanxiong.

[0048] Figure 4 This is the PCA analysis diagram.

[0049] Figure 5 The KASP marker was used for identification efficiency mapping.

[0050] Figure 6 It is the fingerprint of the leaf branch of Ligusticum chuanxiong.

[0051] Figure 7 This is the typing diagram of each sample at the 409640_49SNP site.

[0052] Figure 8 This is the typing diagram of each sample at the 49102_44SNP site.

[0053] Fig. 9This is the typing diagram of each sample at the 221537_45SNP site.

[0054] Fig.10 This is the typing diagram of each sample at the 250643_87SNP site.

[0055] Fig.11 This is the typing diagram of each sample at the 15302_129SNP site.

[0056] Fig.12 This is the typing diagram of each sample at the 85497_65SNP site.

[0057] Fig.13 This is the typing diagram of each sample at the 8463_141SNP site.

[0058] Fig.14 This is the typing diagram of each sample at the 328712_97SNP site. DETAILED DESCRIPTION

[0059] The preferred embodiment of the present invention will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. The experimental methods for which specific conditions are not specified in the embodiments are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0060] Example 1

[0061] SNP site filtering and primer design in Ligusticum chuanxiong

[0062] 1. The leaves of Ligusticum chuanxiong collected from different places were used as samples. The information table of Ligusticum chuanxiong from different sources is shown in Table 1. Figure 1 For some of the germplasms of Ligustrum lucidum, the DNA of this species was digested with a variety of restriction endonucleases, and the appropriate enzyme was selected for subsequent experiments based on the results of the digestion experiment. In this experiment, NlaIII (Hin1II, CATG^) at the end of Read1 and EcoRI (G^AATTC) at the end of Reads2 were used for double digestion experiments.

[0063] Table 1 Information of leaves and branches of Ligusticum chuanxiong from different sources

[0064]

[0065]

[0066] 2. For DNA samples that have passed the quality inspection, the ddRAD library construction method is used to construct a pair-end library with a length ranging from 300-500bp.

[0067] 3. Illumina HiSeq PE150 sequencing, valid data is used to analyze and find massive SNP markers. The original reads (double-end sequences) obtained by sequencing are evaluated to obtain the original reads of each sample, and then stacks (2.59) are used to call SNPs. After filtering the SNPs, the obtained SNP markers are used for PCA, phylogenetic tree, population structure and other analyses.

[0068] 3.1 SNP site steps

[0069] (1) In the first step, the sequence of the SNP site before and after the DNA chain on the chromosome was more than 30 bp conservative, and 13,883 SNP markers were obtained by filtering;

[0070] (2) In the second step, the following markers were retained, with an average depth of 10X or above, a minimum completeness greater than 0.9, a minimum allele frequency greater than 0.05, and the SNP was biallelic, resulting in 4864 SNP markers filtered;

[0071] (3) In the third step, 100 bp of sequence upstream and downstream of the SNP marker were intercepted, and then the sequence was aligned with the reference genome using blast software (version: 2.10.1+), markers at multiple positions in the alignment were removed, and 1229 SNP markers were filtered out;

[0072] (4) In the fourth step, markers with polymorphic information content (PIC) greater than 0.35 were retained. The PIC calculation formula was based on the references (Botstein D, et al. 1980 and Zhang, et al. 2020). 151 SNP markers were obtained by filtering, and some results are shown in Table 2;

[0073] Table 2 Some SNP markers

[0074]

[0075]

[0076]

[0077] Example 2

[0078] Primers were designed for the SNP markers obtained in Example 1 and converted into KASP markers. 108 markers were successfully designed, and finally the results including the design results shown in Table 3 were obtained.

[0079] Table 3

[0080]

[0081] Note: chr: chromosome sequence name; pos: marker position; ref: reference genome base; alt: variant base; Nmiss: number of missing markers in the sample; Nind: total number of samples; Nratio: percentage of missing markers in the sample to the total number of samples; NAllele: allele information and number of each marker; pAll: maximum allele frequency; qAll: minimum allele frequency; NGeno: all genotypes detected and their number; HetExpAll: expected heterozygosity; HetObsAll: observed heterozygosity; PIC: polymorphic information content; chr_pos: chromosome and position information.

[0082] KASP experimental method:

[0083] Main reagents and consumables: FASATM PCR Master Mix (2×), ABclonal; 96-well PCR TAPE, Shanghai Sangon Biotechnology Co., Ltd.

[0084] 1. Add universal fluorescent labels to the 5' end of the primers: FAM: GAAGGTGACCAAGTTCATGCT; VIC: GAAGGTCGGAGTCAACGGATT. The specific primer sequences are shown in Table 4.

[0085] The newly synthesized primers were diluted to 10 μM with TE (pH 8.0), and then mixed in the ratio of upstream typing primer F: upstream typing primer V: downstream universal primer R = 1:1:3 and loaded onto the machine. 1.25 uL of primer mixture was added to every 5 μL reaction system.

[0086] Table 4 Primer sequences

[0087]

[0088]

[0089] The sequences detected by the above KASP and the corresponding SNP sites are shown in Table 5:

[0090] Table 5

[0091]

[0092]

[0093]

[0094] Note: N = A, T, C or G.

[0095] 2. DNA sample dilution and addition:

[0096] The DNA samples were diluted to the single-digit ratio according to the lowest concentration of the sample. The concentration of the diluted sample was 2-20 ng. When using this concentration, the reaction system did not need to add H 2 O), Table 6 shows the PCR reaction system, each 5ul reaction system contains 1.25ul of diluted DNA sample.

[0097] Table 6 PCR reaction system construction

[0098]

[0099] 3. Seal the 96-well PCR reaction plate, shake, and centrifuge to ensure that the reaction system is evenly mixed.

[0100] 4. After centrifugation, PCR reaction was performed. The reaction conditions were as shown in Table 7:

[0101] Table 7 PCR reaction conditions

[0102]

[0103] 5. If the typing results are not ideal, you can optimize by adding PCR reactions. The conditions are as shown in Table 8:

[0104] Table 8

[0105] Step Tem Time NO.of cycle 1 95℃ 20sec 3 2 55℃ 60sec

[0106] The genotype results of all samples at 12 SNP sites are shown in Table 9. The identification efficiency of the markers that were screened out and successfully used for KASP experiments was further plotted. Figure 5 As shown, the horizontal axis represents the number of markers and the vertical axis represents the identification efficiency. Table 10 shows the relevant identification efficiency data. That is, a group of only 9 SNP markers can completely distinguish all samples. SEQ ID No.1-SEQ ID No.27 in Table 4 are KASP primer sets designed based on 9 SNP markers.

[0107] The genotype diagram of each sample at the 306676_61 SNP site is as follows Figure 2 As shown, the genotype diagram of each sample at the 409640_49 SNP site is as follows Figure 7 As shown; the genotype diagram of the 49102_44 SNP site is as follows Figure 8 As shown; the genotype diagram of the 221537_45 SNP site is as follows Fig. 9 As shown; the genotype diagram of the 250643_87 SNP site is as shown Fig.10As shown; the genotype diagram of the 15302_129 SNP site is as shown Fig.11 As shown; the genotype diagram at the 85497_65 SNP site is as follows Fig.12 As shown; the genotype diagram of the 8463_141 SNP site is as shown Fig.13 As shown; the genotype diagram of the 328712_97 SNP site is as shown Fig.14 In the genotyping diagram, the FAM fluorescence on the horizontal axis accounts for a higher proportion, which is homozygous type 1 (yellow dots); the VIC / HEX fluorescence on the vertical axis accounts for a higher proportion, which is homozygous type 2 (blue squares); the two fluorescence proportions in the middle area are equal, which is a heterozygous type (green triangle); the black in the lower left corner is the negative control (NTC). Figure 3 This is the phylogenetic tree of the samples of Ligustrum lucidum. Figure 4 This is the PCA analysis diagram.

[0108] Table 9

[0109]

[0110]

[0111] Table 10

[0112] Number Percent ClusterNum Sample_Num #ID info 1 0.078947 3 38 306676_61 0.669986 2 0.236842 9 38 409640_49 0.877667 3 0.526316 20 38 8463_141 0.950213 4 0.710526 27 38 85497_65 0.97724 5 0.868421 33 38 49102_44 0.990043 6 0.894737 34 38 15302_129 0.99431 7 0.947368 36 38 221537_45 0.997155 8 0.973684 37 38 328712_97 0.998578 9 1 38 38 250643_87 1 10 1 38 38 48830_118 1 11 1 38 38 12424_72 1 12 1 38 38 185295_75 1

[0113] According to the results in Table 4, a Perl language program was used to finally calculate a set of markers that can completely distinguish all samples using only 9 markers. The specific mapping of the marker fingerprint is as follows: Figure 6 Note: One row is one marker, one column is one sample, and different colors represent different genotypes.

[0114] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A SNP molecular marker combination for constructing a DNA fingerprint of Ligusticum chuanxiong, characterized in that: Includes the following SNP molecular markers: The first SNP molecular marker is 306676_61, and its nucleotide sequence is shown in SEQ ID NO.37; The second SNP molecular marker is 409640_49, and its nucleotide sequence is shown in SEQ ID NO.38; The third SNP molecular marker is 49102_44, and its nucleotide sequence is shown in SEQ ID NO.39; The fourth SNP molecular marker is 221537_45, and its nucleotide sequence is shown in SEQ ID NO.40; The fifth SNP molecular marker is 328712_97, and its nucleotide sequence is shown in SEQ ID NO.41; The 6th SNP molecular marker is 250643_87, and its nucleotide sequence is shown in SEQ ID NO.42; The 7th SNP molecular marker 15302_129, whose nucleotide sequence is shown in SEQ ID NO.43; The 8th SNP molecular marker 85497_65, whose nucleotide sequence is shown in SEQ ID NO.44; and the 9th SNP molecular marker 8463_141, whose nucleotide sequence is shown in SEQ ID NO.

45.

2. The SNP molecular marker combination for constructing the DNA fingerprint of Ligusticum chuanxiong according to claim 1, characterized in that: The following SNP molecular markers are also included: The 10th SNP molecular marker is 185295_75, and its nucleotide sequence is shown in SEQ ID NO.46; The 11th SNP molecular marker is 48830_118, and its nucleotide sequence is shown in SEQ ID NO.47; And the 12th SNP molecular marker 12424_72, whose nucleotide sequence is shown in SEQ ID NO.

48.

3. A PCR amplification primer pair combination for amplifying the SNP molecular marker combination according to claim 1, characterized in that: Designed according to the SNP molecular marker site sequence, including 2 upstream typing primers and 1 downstream universal primer; The nucleotide sequences of the PCR amplification primer pairs for the first SNP molecular marker are shown in SEQ ID NO.1-3; The nucleotide sequences of the PCR amplification primer pairs for the second SNP molecular marker are shown in SEQ ID NO.4-6; The nucleotide sequences of the PCR amplification primer pairs for the third SNP molecular marker are shown in SEQ ID NO.7-9; The nucleotide sequences of the PCR amplification primer pairs for the fourth SNP molecular marker are shown in SEQ ID NOs. 10-12; The nucleotide sequences of the PCR amplification primer pairs for the fifth SNP molecular marker are shown in SEQ ID NOs. 13-15; The nucleotide sequences of the PCR amplification primer pairs for the sixth SNP molecular marker are shown in SEQ ID NOs. 16-18; The nucleotide sequences of the PCR amplification primer pairs for the seventh SNP molecular marker are shown in SEQ ID NOs. 19-21; The nucleotide sequences of the PCR amplification primer pairs for the 8th SNP molecular marker are shown in SEQ ID NOs. 22-24; The nucleotide sequences of the PCR amplification primer pairs for the 9th SNP molecular marker are shown in SEQ ID NOs. 25-27.

4. A PCR amplification primer pair combination for amplifying the SNP molecular marker combination according to claim 2, characterized in that: Designed according to the SNP molecular marker site sequence, including 2 upstream typing primers and 1 downstream universal primer; The nucleotide sequences of the PCR amplification primer pairs for the first SNP molecular marker are shown in SEQ ID NO.1-3; The nucleotide sequences of the PCR amplification primer pairs for the second SNP molecular marker are shown in SEQ ID NO.4-6; The nucleotide sequences of the PCR amplification primer pairs for the third SNP molecular marker are shown in SEQ ID NO.7-9; The nucleotide sequences of the PCR amplification primer pairs for the fourth SNP molecular marker are shown in SEQ ID NOs. 10-12; The nucleotide sequences of the PCR amplification primer pairs for the fifth SNP molecular marker are shown in SEQ ID NOs. 13-15; The nucleotide sequences of the PCR amplification primer pairs for the sixth SNP molecular marker are shown in SEQ ID NOs. 16-18; The nucleotide sequences of the PCR amplification primer pairs for the seventh SNP molecular marker are shown in SEQ ID NOs. 19-21; The nucleotide sequences of the PCR amplification primer pairs for the 8th SNP molecular marker are shown in SEQ ID NOs. 22-24; The nucleotide sequences of the PCR amplification primer pairs for the 9th SNP molecular marker are shown in SEQ ID NOs. 25-27; The nucleotide sequences of the PCR amplification primer pairs for the 10th SNP molecular marker are shown in SEQ ID NOs. 28-30; The nucleotide sequences of the PCR amplification primer pairs for the 11th SNP molecular marker are shown in SEQ ID NOs. 31-33; The nucleotide sequences of the PCR amplification primer pairs for the 12th SNP molecular marker are shown in SEQ ID NOs. 34-36.

5. Use of a primer pair combination for detecting the SNP molecular marker combination according to claim 1 or claim 2 in constructing a DNA fingerprint of Ligusticum chuanxiong.

6. The use according to claim 5, characterized in that: The primer pair combination is the PCR amplification primer pair combination according to claim 3 or claim 4.

7. Use of a primer pair combination for detecting the SNP molecular marker combination described in claim 1 or claim 2 in identifying germplasm of Ligusticum chuanxiong.

8. The use according to claim 7, characterized in that: The primer pair combination is the PCR amplification primer pair combination according to claim 3 or claim 4.

9. A detection reagent or kit comprising the PCR amplification primer pair combination according to claim 3 or claim 4.

Images