A molecular marker combination, method and application for identifying cotton anther color traits

Abstract

The present invention belongs to the technical field of plant molecular biology, and particularly relates to a molecular marker combination, method and application for identifying cotton anther color traits, and specifically relates to a SNP molecular marker and application of a cotton anther color trait gene locus, wherein the SNP molecular marker is located on the nucleotide sequence consisting of the 105079550, 105080001, 105080116 bases and their upstream and downstream bases on chromosome A05 of cotton. The SNP molecular marker is directly expressed in the form of DNA, can be detected in various developmental stages and different tissues and organs of cotton, and is not restricted by the environment and season, and is not affected by problems such as whether it is expressed or not. Therefore, the marker operation is simple, the amplification result is accurate, and the required reagent cost is low. The development of the marker can be used for the screening and identification of cotton yellow anthers and other color anther varieties, and accelerates the molecular marker-assisted selection breeding efficiency of target traits.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology, and particularly relates to a molecular marker combination, method and application for identifying cotton anther color traits. Background Art

[0002] Cotton is an important economic crop in the world, the main source of natural fiber for the textile industry, and an important source of edible oil and protein. Improving cotton yield, quality and other traits is the main goal of breeders. Cotton has brightly colored flowers and a variety of plant types (Lu et al., 2022(https: / / doi.org / 10.3389 / fpls.2022.914206); Wang et al., 2023(https: / / doi.org / 10.1016 / j.jia.2022.10.007)), leaf shapes (Hu et al., 2022) and leaf colors (Gao et al., 2013(https: / / doi.org / 10.1371 / journal.pone.0077891); Shao et al., 2021(https: / / doi.org / 10.1016 / j.plantsci.2021.110827)), which makes it an ornamental crop. Cotton has become an important economic crop that combines fiber, food and ornamental value.

[0003] Anthers are an important part of the stamens, and the anther sac is a structure that produces pollen. Only when pollen is produced smoothly can the plant reproduce sexually. The anther color of upland cotton is mostly white, the anther color of sea island cotton is yellow, and the anther color of some wild cotton is also mostly yellow. Studies have reported that the formation of anther color is mostly related to flavonoids such as anthocyanins and carotenoids, and the degree of pigment accumulation in anthers is related to the photosynthetic rate and stress tolerance of plants (Laikova et al., 2005 (https: / / doi.org / 10.1007 / s11177-005-0216-4)). At the same time, bright colors help insect pollination (Ison et al., 2019 (https: / / doi.org / 10.1093 / aob / mcy211)), improve the fruiting rate based on insect pollination in the hybrid seed production process, reduce seed production costs, and improve seed production efficiency. Therefore, the study of anther color traits is of great significance for the breeding of new ornamental cotton varieties and cotton hybrid seed production. The research also provides some ideas for the genetic evolution of cotton varieties and the formation of important ornamental traits.

[0004] Whole genome resequencing (WGRS) is a whole genome sequencing of different individuals of species with known reference genome sequences. It has the advantages of rich detection types of variation, high cost performance, and wide application. Individuals with whole genome resequencing can find a large number of single nucleotide polymorphism sites (SNPs), insertion / deletion sites (InDels), and structure variation sites (SVs) through sequence alignment, which can be applied to the detection of pathogenic genes, genetic variation and many other fields. Single nucleotide polymorphism mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. This variation can be caused by the conversion or inversion of a single base. SNPs are widely distributed in the genome, and non-synonymous SNPs located in the gene coding region can lead to changes in gene function. Due to the dimorphism of SNPs, SNPs often only need + / - analysis in genome screening, rather than analyzing the length of the fragment, which is conducive to the development of automated technology to screen or detect SNPs. The purpose of the present invention is to develop SNP markers for detecting gene loci of cotton anther color traits, and to use the marker combination for detection and verification in a large number of natural varieties / lines, to provide a new method for early detection of yellow anther traits in cotton, and to provide practical markers for utilization of hybrid vigor in cotton and breeding of new varieties. Summary of the invention

[0005] In view of the deficiencies of the prior art, the object of the present invention is to provide a SNP marker combination for identifying cotton anther color traits, and the application of the SNP marker combination in identifying cotton anther color traits.

[0006] The above objectives are achieved through the following technical solutions:

[0007] The first object of the present invention is to provide a SNP molecular marker combination for identifying cotton anther color traits, wherein the SNP molecular marker combination includes three SNP molecular marker sites, all of which are located on chromosome A05 of the cotton genome, specifically:

[0008] SNP ID No.1: The genotype of base 105079550 is T or C;

[0009] SNP ID No.2: The genotype of base 105080001 is C or T;

[0010] SNP ID No.3: The genotype of base 105080116 is A or T.

[0011] The second object of the present invention is to provide an application of the above-mentioned SNP molecular marker combination in cotton molecular marker-assisted breeding.

[0012] The third object of the present invention is to provide an application of the above-mentioned SNP molecular marker combination in breeding cotton anther color varieties.

[0013] As a further improvement of the above technical solution, when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are respectively a CTA combination or a TCT combination, the color of the cotton anther is yellow; when SNP ID No.1, SNP ID No.2 and SNP IDNo.3 are a TCA combination, the color of the cotton anther is white.

[0014] As a further improvement of the above technical solution, when the cotton varieties are Sea Island cotton and Asiatic cotton, and SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a CTA combination, the color of the cotton anther is yellow.

[0015] As a further improvement of the above technical solution, if the cotton variety is upland cotton, when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a TCT combination, the color of the cotton anther is yellow; when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a TCA combination, the color of the cotton anther is white.

[0016] The fourth object of the present invention is to provide a method for identifying the color traits of cotton anthers, comprising the following steps:

[0017] Step S1, extracting cotton tissue DNA to be tested;

[0018] Step S2, designing specific primers according to the SNP molecular marker combination of claim 1, using cotton tissue DNA as a template, and performing PCR amplification using the designed specific primers;

[0019] Step S3: detecting the genotype of the SNP molecular marker site for rapid identification of cotton anther color varieties.

[0020] As a further improvement of the above technical solution, the specific primer is specifically:

[0021] SNP ID No.1P-upstream primer: AGTGCCCATAATTGCTCTTCCATA;

[0022] SNP ID No.1P-downstream primer:TTCGAGGACAAGTGAGCGATAAAT;

[0023] SNP ID No.1P detects the SNP nucleotide sequence information of the SNPIDNo.1 site.

[0024] SNP ID No.2 / 3P-upstream primer: TTCCCATTACCGGAACACTCATTA;

[0025] SNP ID No.2 / 3P-downstream primer:TGTCTCAAACTACGCTCTTGGTAT.

[0026] SNP ID No.2 / 3P primers can simultaneously detect the SNP nucleotide sequence information of SNP ID No.2 and SNP ID No.3 sites.

[0027] The fifth object of the present invention is to provide a SNP marker primer for identifying the anther color trait of cotton, wherein the SNP marker primer is designed with the sequence of the site where the above-mentioned SNP molecular marker combination is located and the sequence of the upstream and downstream bases as the target sequence, and the sequence of the SNP marker primer is:

[0028] SNP ID No.1P-upstream primer: AGTGCCCATAATTGCTCTTCCATA;

[0029] SNP ID No.1P-downstream primer:TTCGAGGACAAGTGAGCGATAAAT;

[0030] SNP ID No.2 / 3P-upstream primer: TTCCCATTACCGGAACACTCATTA;

[0031] SNP ID No.2 / 3P-downstream primer:TGTCTCAAACTACGCTCTTGGTAT.

[0032] The sixth object of the present invention is to provide a kit for detecting cotton anther color traits, the kit comprising the above-mentioned SNP marker primers.

[0033] The beneficial effects of the present invention are:

[0034] The present invention uses the third-generation molecular marker SNP to determine the genotype of different anther color varieties, and realizes accurate and rapid identification of different anther color varieties. The present invention has the characteristics of simple operation, accurate results, and easy repetition. It is suitable for screening different cotton anther colors, identifying excellent sites with potential application value and anther color molecular marker-assisted selection breeding, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1Comparison of anther colors of sea island cotton (A) and upland cotton (B). The top of the picture shows the flowers and yellow anthers of sea island cotton, and the bottom of the picture shows the flowers and white anthers of upland cotton. DETAILED DESCRIPTION

[0036] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0037] The invention provides a SNP molecular marker combination for identifying cotton anther color traits. The SNP molecular marker is a nucleotide sequence consisting of bases at positions 105079550, 105080001 and 105080116 on cotton chromosome A05 and their upstream and downstream bases, wherein the genotypes of bases at positions 105079550, 105080001 and 105080116 on cotton chromosome 5 are T / C, C / T and A / T.

[0038] The present invention also provides an application of the above-mentioned SNP molecular markers related to the cotton anther color trait in detecting the cotton anther color trait. The genotype combination of the sea island cotton (yellow anther) variety and the Asian cotton (yellow anther) variety at the SNP ID No.1, SNP ID No.2 and SNP ID No.3 sites is CTA; the genotype combination of the upland cotton (yellow anther) variety at the SNP ID No.1, SNP ID No.2 and SNP ID No.3 sites is TCT; the genotype combination of the upland cotton (white anther) variety at the SNP ID No.1, SNP ID No.2 and SNP ID No.3 sites is TCA, as shown in the following table:

[0039]

[0040] Figure 1 Comparison of anther colors of sea island cotton (A) and upland cotton (B). The top of the picture shows the flowers and yellow anthers of sea island cotton, and the bottom of the picture shows the flowers and white anthers of upland cotton.

[0041] 1. Materials

[0042] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0043] 2. Methods

[0044] 2.1 Whole genome resequencing and development of SNP molecular markers

[0045] Based on the hybrid combination of two cotton varieties with white anthers (upland cotton) and yellow anthers (sea island cotton), the anther color of the F1 plant was yellow. The F1 plant was self-pollinated to obtain an F2 population containing 676 individuals. The yellow anther and white anther individuals in the population were sequenced by BSA-seq pooling. The high-throughput Illumina HiSeq TM sequencing technology was used to perform whole-genome resequencing on the DNA pools of two different anther color traits, and a total of 42.13G of raw data base sequence fragments were obtained. The raw sequencing sequence obtained by sequencing may contain adapter sequences or low-quality bases. Through quality control and data filtering, high-quality clean data was obtained for subsequent analysis. The bases with base error rates less than 1% (Q20) accounted for an average of 98.06%, and the bases with base error rates less than 0.1% (Q30) accounted for an average of 94.31%, and the GC distribution was normal. A total of 290,567,574 high-quality sequences were obtained for the two samples, and the average ratio of sequencing data of the samples aligned to the reference genome was 94.80%, which met the requirements of subsequent experimental analysis.

[0046] Based on the cotton reference genome data, the BSA-seq analysis of the yellow anther trait of cotton obtained that the 103.76Mb-105.87Mb interval of chromosome A05 of cotton was the candidate interval for the yellow anther trait of cotton. Molecular markers were developed in this interval, and a total of 49 pairs of molecular markers were developed, further narrowing the candidate interval to 88.7kb. Through the statistical analysis of the genotypes and phenotypes of the SNP sites in the candidate interval in the progeny, it was found that the SNP sites SNP ID No.1 (genotype is T / C) and SNP ID No.2 (genotype is C / T), these two SNP sites and their combination can completely distinguish the cotton progeny with two different colors of anthers from the sea and land populations. The genotype combination of yellow anther plants at SNP ID No.1 and SNP ID No.2 sites is CT: the genotype combination of white anther plants at SNP ID No.1 and SNP ID No.2 sites is TC. In the Hailu F2 population used in this study, the genotype of SNPID3No.3 in cotton progenies with different anther colors was A / A.

[0047] The detection primer sequences of the SNP ID No. 1 site, the forward primer sequence SEQ ID No. 1: 5'-AGTGCCCATAATTGCTCTTCCATA-3', the reverse primer sequence SEQ ID No. 2: 5'-TTCGAGGACAAGTGAGCGATAAAT-3'.

[0048] The detection primer sequence of SNP ID No.2 / 3 site, the forward primer sequence SEQ ID No.3: 5'-TTCCCATTACCGGAACACTCATTA-3', the reverse primer sequence SEQ ID No.4: 5'-TGTCTCAAACTACGCTCTTGGTAT-3', SNP ID No.2 / 3P primer can simultaneously detect the SNP nucleotide sequence information of SNP ID No.2 and SNP ID No.3 sites.

[0049] 2.2. Validation of SNP markers in different cotton germplasm resources

[0050] (1) Extracting DNA from cotton leaves using the CTAB method;

[0051] ① Weigh 0.2 g of leaves into a centrifuge tube, cool with liquid nitrogen and quickly grind using a tissue grinder, add 1 ml of CTAB solution after a 65°C water bath, mix well and place in a water bath, heat at 65°C for 30 min, and invert every 8 min.

[0052] ② After water bath, take out the centrifuge tube, centrifuge at 4℃ for 10min, take the supernatant and add 800μl of chloroform and isoamyl alcohol mixture with a volume ratio of 24:1, slowly invert upside down until mixed and no layers are formed, and centrifuge at 12000rpm for 10min at 4℃.

[0053] ③Repeat the previous step

[0054] ④ The supernatant should be transferred to another 1.5 ml centrifuge tube. Add 2 volumes of ice-cold isoamyl alcohol (pre-stored in a -20°C refrigerator) and 200 μl of sodium acetate solution, slowly invert until flocculent DNA is generated, and let it stand for 30 minutes.

[0055] ⑤ Centrifuge at 12000 rpm for 10 min at 4°C, discard the waste liquid, add 70% (v / v) ethanol solution to wash twice, and wash once with anhydrous ethanol.

[0056] ⑥ Dry overnight, add ddH2O to dissolve the DNA until it is completely dissolved, and store at 4℃ for later use.

[0057] (2) Using genotyping technology, specific primers were designed according to the SNP site, and the sequences were as follows:

[0058] SEQ ID No. 1: Forward primer sequence: 5′-AGTGCCCATAATTGCTCTTCCATA-3′;

[0059] SEQ ID No. 2: Reverse primer sequence: 5′-TTCGAGGACAAGTGAGCGATAAAT-3′;

[0060] SEQ ID No. 3: Forward primer sequence: 5'-TTCCCATTACCGGAACACTCATTA-3';

[0061] SEQ ID No. 4: Reverse primer sequence: 5'-TGTCTCAAACTACGCTCTTGGTAT-3'.

[0062] (3) Using cotton tissue DNA as a template, PCR amplification was performed using the designed specific primers.

[0063] The specific reaction system and procedure are as follows:

[0064] The PCR reaction system is:

[0065]

[0066] The PCR reaction program is:

[0067]

[0068]

[0069] (4) Detect the genotype of the SNP molecular marker site in the PCR amplification product for rapid identification of cotton varieties.

[0070] To further verify the universality of the SNP molecular markers related to cotton anther color traits developed based on the sea-land F2 population in this study, the above SNP ID No.1P and SNP ID No.2 / 3P primers were used to detect 48 cotton germplasms of different species and different anther colors, and the results are shown in Table 1. The test results showed that among the 48 cotton germplasms, the genotype combinations of 29 sea island cotton (yellow anthers) and Asian cotton (yellow anthers) at SNP ID No.1, SNP ID No.2 and SNP ID No.3 were all CTA; the genotype combinations of 9 upland cotton (yellow anthers) varieties at SNP ID No.1, SNP ID No.2 and SNP ID No.3 were all TCT; the genotype combinations of 10 upland cotton (white anthers) varieties at SNP ID No.1, SNP ID No.2 and SNP ID No.3 were all TCA.

[0071] The sequence of the SNP ID NO.1P primer amplification product is as follows:

[0072] AGTGCCCATAATTGCTCTTCCATAAGCCAGTGGAAGTGAAGCAAATTTCTTTGCTTTCCCTACATAAGCCCTTTTGGTGAAATTATTATAGTCATTTTCTTCGATGACATCTAAGATTTGTCTATACAACAACAATGATG CCCACA[T / C]TGGCCATCTGCTTGCCTCCGTTAGCTCCGCAACCCCTTTTTCGGCCTCATCGAAGTACATTCTTGCTCGTTTTATTTGATTTTTCATGAAAATTTTCCATTTATCGCTCACTTGTCCTCGAA(269bp)

[0073] The sequence of the SNP ID NO.2 / 3P primer amplification product is as follows:

[0074] TTCCCATTACCGGAACACTCATTAGTCCGACCGTCCCAGCAACATAGTAGCAGTATAGATAGAG[C / T]TCATCAAAGTTGTTATATCTGGTTTTCAATAAATCTAATCTCATCCCTTCTATCATGTCCT TGAAGGGCTGCACAAAACAAAATTAATTAATTTGTTGATATAGTTCCAAATCTC[A / T]ATAATTTTGTGAATGTCAAACATGGCTATGCATCTAACCTGAATACCAAGAGCGTAGTTTGAGACA(246bp)

[0075] Among them, "AGTGCCCATAATTGCTCTTCCATA, ATTTATCGCTCACTTGTCCTCGAA" and "TTCCCATTACCGGAACACTCATTA, ATACCAAGAGCGTAGTTTGAGACA" are the binding positions of the upstream and downstream primers to the DNA template, and the positions and variation types of the SNP bases are in square brackets.

[0076] When the SNP ID No.1 site is T, the sequence is shown as SEQ ID No.5; when the SNP ID No.1 site is C, the sequence is shown as SEQ ID No.6.

[0077] When the SNP ID No.2 site is C and the SNP ID No.3 site is A, the sequence is shown in SEQ ID No.7; when the SNP ID No.2 site is C and the SNP ID No.3 site is T, the sequence is shown in SEQ ID No.8; when the SNP ID No.2 site is T and the SNP ID No.3 site is A, the sequence is shown in SEQ ID No.9.

[0078] The above results show that although the combination of SNP ID No.1 and SNP ID No.2 cannot distinguish varieties with different anther colors in upland cotton, the combination of SNP ID No.1 and SNP ID No.3, or the combination of SNP ID No.2 and SNP ID No.3, or the combination of the three SNP loci SNP ID No.1, SNP ID No.2 and SNP ID No.3 can completely distinguish cotton germplasms of different species and different anther colors. The combination of the three SNP loci is closely linked or co-segregated with the anther color trait of cotton, and can be used as a molecular marker for molecular detection of the anther color trait of cotton, and can also be used for cotton genetic background analysis, as well as molecular marker-assisted selection breeding of the anther color trait of cotton, and has broad application prospects.

[0079] Table 1 Marker identification of 48 cotton varieties

[0080]

[0081]

[0082] The above varieties are all from the National Cotton Germplasm Resources Medium-term Bank (No. 38, Yellow River Avenue, Development Zone, Anyang City, Henan Province).

[0083] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that for ordinary technicians in this field, several improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. An application of a SNP molecular marker combination for identifying cotton anther color traits in breeding cotton anther color varieties, characterized in that: The SNP molecular marker combination includes three SNP molecular marker sites: SNP ID No.1, SNP ID No.2 and SNP ID No.3, wherein: SNP ID No. 1 site is located at the 147th base of the nucleotide sequence shown in SEQ ID NO. 5 and SEQ ID NO. 6, and the genotype is C or T; The SNP ID No. 2 site is located at the 65th base of the nucleotide sequence shown in SEQ ID NO. 7 and SEQ ID NO. 9, and the genotype is C or T; SNP ID No.3 site is located at the 180th base of the nucleotide sequence shown in SEQ ID NO.7 and SEQ ID NO.8, and the genotype is A or T; The cotton is sea island cotton, Asiatic cotton and upland cotton; When the cotton variety is sea island cotton or Asian cotton, when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a CTA combination, the cotton anther color is yellow; When the cotton variety is upland cotton, when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a TCT combination, the cotton anther color is yellow, and when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a TCA combination, the cotton anther color is white.

2. A method for identifying the color traits of cotton anthers, characterized in that: The following steps are involved: Step S1, extracting DNA from cotton tissue to be tested, wherein the cotton is sea island cotton, Asiatic cotton and upland cotton; Step S2, designing specific primers according to the SNP molecular marker combination, taking cotton tissue DNA as a template, and performing PCR amplification using the designed specific primers; The SNP molecular marker combination includes three SNP molecular marker sites: SNP ID No.1, SNP ID No.2 and SNP ID No.3, wherein: SNP ID No. 1 site is located at the 147th base of the nucleotide sequence shown in SEQ ID NO. 5 and SEQ ID NO. 6, and the genotype is C or T; The SNP ID No. 2 site is located at the 65th base of the nucleotide sequence shown in SEQ ID NO. 7 and SEQ ID NO. 9, and the genotype is C or T; SNP ID No.3 site is located at the 180th base of the nucleotide sequence shown in SEQ ID NO.7 and SEQ ID NO.8, and the genotype is A or T; The specific primers are specifically: SNP ID No.1P-upstream primer: AGTGCCCATAATTGCTCTTCCATA; SNP ID No.1P-downstream primer:TTCGAGGACAAGTGAGCGATAAAT; SNP ID No.2 / 3P-upstream primer: TTCCCATTACCGGAACACTCATTA; SNP ID No.2 / 3P-downstream primer:TGTCTCAAACTACGCTCTTGGTAT; Step S3, detecting the genotype of the SNP molecular marker site for rapid identification of cotton anther color varieties; When the cotton variety is sea island cotton or Asian cotton, when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a CTA combination, the cotton anther color is yellow; When the cotton variety is upland cotton, when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a TCT combination, the cotton anther color is yellow, and when SNP ID No.1, SNP ID No.2 and SNP ID No.3 are a TCA combination, the cotton anther color is white.

3. A SNP marker primer for identifying cotton anther color traits, characterized in that: The SNP marker primers are designed with the sequence of the site where the SNP molecular marker combination is located and its upstream and downstream bases as the target sequence, wherein the SNP molecular marker combination includes three SNP molecular marker sites, SNP ID No.1, SNP ID No.2 and SNP ID No.3, wherein: SNP ID No. 1 site is located at the 147th base of the nucleotide sequence shown in SEQ ID NO. 5 and SEQ ID NO. 6, and the genotype is C or T; The SNP ID No. 2 site is located at the 65th base of the nucleotide sequence shown in SEQ ID NO. 7 and SEQ ID NO. 9, and the genotype is C or T; SNP ID No.3 site is located at the 180th base of the nucleotide sequence shown in SEQ ID NO.7 and SEQ ID NO.8, and the genotype is A or T; The SNP marker primer sequence is: SNP ID No.1P-upstream primer: AGTGCCCATAATTGCTCTTCCATA; SNP ID No.1P-downstream primer:TTCGAGGACAAGTGAGCGATAAAT; SNP ID No.2 / 3P-upstream primer: TTCCCATTACCGGAACACTCATTA; SNP ID No.2 / 3P-downstream primer:TGTCTCAAACTACGCTCTTGGTAT.

4. A kit for detecting the color traits of cotton anthers, characterized in that: The kit comprises the SNP marker primers described in claim 3.

Images