Aeromonas dakar ugd and phoB gene single and double deletion mutants, complemented strains and construction methods and applications thereof

Abstract

The invention discloses single and double deletion mutants of ugd and phoB genes of Aeromonas dakar, complemented strains and construction methods and applications thereof. The invention successfully constructs a single deletion mutant of Δugd gene of Aeromonas dakar and a double deletion mutant of ΔugdΔphoB gene of Aeromonas dakar by a traceless knockout method, and successfully constructs a complemented strain ΔugdΔphoB+CphoB by a seamless cloning method. Studies have shown that compared with wild strains, the virulence of the Δugd mutant strain (LD50) is reduced by 73 times (reduced by 17.4 times), and the virulence of the ΔugdΔphoB mutant strain (LD50) is reduced by 7.45 times. The immune protection rate of the Δugd mutant strain is 60%, and the immune protection rate of the ΔugdΔphoB double mutant strain is 36.7%. It can be used as a candidate attenuated vaccine to resist infection of wild-type Aeromonas dakar C160501 strain. The invention provides a technical means for the research of attenuated live vaccines for Aeromonas dakar disease.

Description

Technical Field

[0001] The present invention relates to a single deletion mutant strain of the ugd gene of Aeromonas dakar, a double deletion mutant strain of the ugd and phoB genes and a complemented strain thereof, and also relates to a construction method and application of the deletion mutant strain and the complemented strain. The present invention belongs to the field of biotechnology. Background Art

[0002] Aeromonas is widely distributed in the environment, causing significant economic losses to the global aquaculture industry and can cause serious infections in humans and aquatic animals. Compared with other Aeromonas, Aeromonas dhakensis is the most virulent of the Aeromonas genus. Therefore, the development of vaccines is an effective strategy for the prevention and control of Aeromonas dhakensis diseases under the pressure of lack of useful antibiotics.

[0003] Crocodile is a rare and protected wild animal. Its whole body is a treasure. Crocodile meat is rich in high-quality protein. Crocodile skin can be used to make high-grade leather. Crocodile blood has a wide range of beneficial effects, including antibacterial, antiviral, antioxidant, anti-inflammatory, anti-tumor, anti-anemia, promotion of wound healing, treatment of asthma, allergies and other diseases (Deniz et al., 2013). In April 2016, Aeromonas dakarensis was isolated from infected and dead young crocodiles in Hainan crocodile farms and named as C160501 strain (Pue et al., 2019). The infection of Aeromonas dakarensis has caused serious economic losses to crocodile farms. Therefore, it is of great significance to strengthen the prevention and control research of this bacterium. Summary of the invention

[0004] One of the purposes of the present invention is to provide a single deletion mutant of the ugd gene of Aeromonas dakar and a double deletion mutant of the ugd and phoB genes and a complemented strain thereof;

[0005] The second purpose of the present invention is to provide a construction method and application of the above-mentioned gene deletion mutant strain and its complemented strain.

[0006] In order to achieve the above object, the present invention adopts the following technical means:

[0007] The invention discloses an Aeromonas dakar ugd gene deletion mutant strain, wherein the Aeromonas dakar ugd gene deletion mutant strain is obtained by deleting the ugd gene on the basis of the wild strain of Aeromonas dakar.

[0008] Among them, preferably, the wild strain of Aeromonas dhakensis is A. dhakensisC160501.

[0009] Furthermore, the present invention also proposes a double deletion mutant strain of ugd and phoB genes of Aeromonas dakar or a complemented strain thereof, wherein the double deletion mutant strain of ugd and phoB genes of Aeromonas dakar is obtained by simultaneously deleting the ugd and phoB genes from the wild strain of Aeromonas dakar; the complemented strain is obtained by complementing and expressing the phoB gene on the basis of the double deletion mutant strain of ugd and phoB genes of Aeromonas dakar.

[0010] Among them, preferably, the complemented strain constitutively expresses the phoB gene.

[0011] Among them, preferably, the wild strain of Aeromonas dhakensis is A. dhakensisC160501.

[0012] Furthermore, the present invention also proposes a method for constructing the Aeromonas dakar ugd gene deletion mutant, characterized in that it comprises the following steps:

[0013] (1) Design and synthesize the following primers:

[0014] Up-F:AC GAATTC GAGCATCCGCACCTTGTCT

[0015] Up-R: GCAGTTGCCGTAGATGATGTTGCGTTGCAGCAGG

[0016] Down-F:ATCTACGGCAACTGCGACA

[0017] Down-R:AC AAGCTT CCACTCTCTCACCTCATCGG

[0018] △ugd-F:CGTGGAAGGAGAAGATGG

[0019] △ugd-R:CAACATGCTGGTCAATCTG

[0020] pK18-F:ATGAACATCAAAAAGTTTGCA

[0021] pK18-R:TTATTTGTTAACTGTTAATTGTCC

[0022] ugd-F:AC TCTAGA ATGAACATTACTGTATTTGG

[0023] ugd-R:AC GGATCC TTATTTCATTACCGATTCGC

[0024] (2) Construction of Δugd knockout strain

[0025] 1) Extraction of the genome of Aeromonas dakar C160501

[0026] Aeromonas dakar C160501 frozen in a -80°C ultra-low temperature freezer was taken out and activated on a clean bench. An inoculation loop was used to streak the bacteria on an LB solid plate. After overnight culture at 37°C, a single colony was picked and inoculated into LB liquid culture medium for expansion culture. The bacteria were shaken at 37°C, 180 rpm overnight to extract bacterial genomic DNA.

[0027] 2) Amplification of upstream and downstream homology arms of ugd gene

[0028] The upstream and downstream primers Up-F / R and Down-F / R of ugd gene were used to amplify the upstream and downstream homology arms of ugd gene respectively, with the genome of Aeromonas dakar C160501 as template and mixed with other PCR components;

[0029] 3) PCR amplified fragment recovery

[0030] Purify and recover the PCR product according to the instructions of the gel recovery / DNA purification kit;

[0031] 4) Fusion of upstream and downstream homology arms of ugd gene

[0032] After completing the PCR amplification of the upstream and downstream homologous arms of the ugd gene and the purification and recovery of the products, the fusion PCR method is used to make the upstream and downstream homologous arms perform base complementary pairing through the common 15bp sequence and then amplify the fusion fragment; after the above PCR reaction is completed, the upstream homologous arm primer up-F and the downstream homologous arm primer Down-R are added to the PCR tube to continue amplifying the fusion fragment; after the PCR amplification of the upstream and downstream homologous arm fusion fragments is completed, the PCR product is gel recovered;

[0033] 5) Construction of Δugd-pK18mobsacB knockout plasmid

[0034] The upstream and downstream homology arm fusion fragment gel recovery products were double-digested with the pK18mobsacB plasmid using restriction endonucleases EcoRI and HindIII, and the gel containing the target fragment was cut out and then gel-recovered;

[0035] 6) Ligation reaction

[0036] Use T4 DNA ligase to connect the double-digested plasmid and the purified and recovered products of the fusion fragment;

[0037] 7) Transformation of Δugd-pK18mobsacB recombinant plasmid

[0038] The above ligation solution was added to WM3064 E. coli competent cells, and the bacterial solution was spread on LB solid plates containing kanamycin and DAP in a clean bench, and cultured in a constant temperature incubator at 37°C for 12 hours;

[0039] 8) Verification of Δugd-pK18mobsacB recombinant plasmid

[0040] Use the fusion fragment amplification primers Up-F / Down-R to perform colony PCR, and after the PCR amplification is completed, perform gel electrophoresis to detect whether the target band is contained to screen positive clones; perform double enzyme digestion verification on the positive clones screened by colony PCR, and perform gel electrophoresis to detect the enzyme digestion products. After verifying that the bands are correct, purify and recover the enzyme digestion products and send them for sequencing. After the sequencing is correct, save the strains containing the recombinant plasmid;

[0041] 9) Construction and screening of ugd gene deletion mutants:

[0042] Activate the Aeromonas dakar C160501 strain and the WM3064 Escherichia coli strain containing the recombinant plasmid Δugd-pK18mobsacB stored in a -80°C refrigerator, co-culture the obtained WM3064 Escherichia coli strain containing the recombinant plasmid Δugd-pK18mobsacB with the Aeromonas dakar C160501 strain, and transfer the recombinant plasmid from the Escherichia coli cells to the Aeromonas dakar C160501 strain by conjugation transfer during this period; extract the single colony on the plate, use the PK18-F / PK18-R primers designed according to the recombinant plasmid sequence as a template to perform colony PCR, detect positive clones, and after verifying that the band is correct, purify and recover the PCR product and send it for sequencing, and after the sequencing result is correct, store the positive clone strain in a -80°C ultra-low temperature refrigerator;

[0043] Colony PCR was performed using primers Δugd-F / Δugd-R designed based on the gene sequences outside the upstream and downstream homologous arms of the ugd gene to screen positive clones. After colony PCR verification was correct, the PCR products were purified and recovered and sent for sequencing. After the sequencing results were correct, the positive clone strains were stored in a -80°C ultra-low temperature refrigerator to obtain the ugd gene deletion mutant strain of Aeromonas dakar.

[0044] Furthermore, the present invention also proposes a method for constructing the Aeromonas dakar ugd and phoB gene double deletion mutant strain or its complemented strain, comprising the following steps:

[0045] (1) Design and synthesize the following primers:

[0046] Up-F-SacI:AC GAGCTCTTGGCAACGGTCATCCCAATAT

[0047] Up-R: CAACATAAGTGCCTCATCCCTTCTCTCTCCTCTGTGAA

[0048] Down-F: GAGGCACTTATGTTGCAACCATAC

[0049] Down-R-XbaI: AC TCTAGA TGCACCATGAACTCGATCTGG

[0050] pRE112-F: GTGCGCAACAACCGTCTTC

[0051] pRE112-R: CCTGGTTGCTACGCCTGAATA

[0052] ΔphoB identification-F: TTGGCAACGGTCATCCCAATAT

[0053] ΔphoB identification-R: TCATCCTGCACCGCAAACAG

[0054] phoB-F: ATGGCTAAGCGAATTCTGGTG

[0055] phoB-R: TTAGAGACGGGTTGAGAAGCG

[0056] phoB bridging-F: ACACAGGAAACAGCTATGGCTAAGCGAATTCTGGTG

[0057] phoB bridging-R: ACAAAATATTAACGCTTAGAGACGGGTTGAGAAGCG

[0058] pBBR1MCS-2Δ(lacZα)-F: AGCTGTTTCCTGTGTGAAATTG

[0059] pBBR1MCS-2Δ(lacZα)-R: GCGTTAATATTTTGTTAAAATTCGCG

[0060] pBBR1MCS-2 identification-F: TATTTAACGACCCTGCCCTG

[0061] pBBR1MCS-2 identification-R: ATCTCATGCTGGAGTTCTTCG

[0062] (2) Construction of ΔugdΔphoB knockout strain

[0063] 1) Amplification and fusion of upstream and downstream homology arms of phoB gene

[0064] The upstream homology arm forward and reverse primers Up-F-SacI and Up-R or the downstream homology arm forward and reverse primers Down-F and Down-R-XbaI were used as templates, and PCR amplification was performed followed by electrophoresis purification and recovery to obtain the upstream and downstream homology arms;

[0065] 2) Fusion of upstream and downstream homology arms of phoB gene

[0066] The purified and recovered upstream and downstream homology arm fragments were used as templates for fusion PCR experiments; then primers Up-F-SacI / Down-R-XbaI were added for bridge construction; after PCR amplification, the gel was recovered to obtain the fusion fragment;

[0067] 3) Double digestion of plasmid and fusion fragment

[0068] The pRE112 plasmid and the fusion fragment gel recovery products were double-digested with SacI and XbaI restriction endonucleases, respectively, and the temperature was adjusted to 37°C in a thermostatic metal bath. After 2 hours of reaction, gel recovery was performed;

[0069] 4) Plasmid and fusion fragment ligation

[0070] The double-digested pRE112 plasmid and fusion fragment product recovered from the gel were ligated using T4 DNA ligase, and the reaction was carried out in a 16°C water bath overnight;

[0071] 5) Preparation and transformation of competent cells

[0072] Place the prepared competent cells and ligation solution on ice, add the ligation solution and the competent cells and mix well, and place the mixture on ice for 30 minutes; heat shock at 42°C for one and a half minutes and place on ice for 3 minutes; then add 900 μL of LB liquid culture medium containing 50 μg / mL DAP, and culture at 37°C, 180 rpm for 2 hours in a constant temperature shaking culture; spread the bacterial solution on the LB solid plate containing CAP and DAP, and culture it in a constant temperature incubator at 37°C overnight;

[0073] 6) Verification of ΔphoB-pRE112 recombinant plasmid

[0074] Pick a single colony in the clean bench, use the primers pRE112-F / pRE112-R on the pRE112 plasmid to perform colony PCR, and use gel electrophoresis to verify whether the target band is contained to screen positive clones; the verified positive clones are inoculated into LB liquid culture medium containing DAP and CAP (50 μg / mL), and the plasmids are extracted after overnight culture, double enzyme digestion is performed for secondary verification, and after the verification band is correct, the strains are purified and recovered and sent for sequencing. If the sequencing is correct, the strains are stored at 80°C;

[0075] 7) Construction of the ΔugdΔphoB double mutant

[0076] Combined transfer experiment: Take out WM3064 Escherichia coli and Δugd knockout strain containing ΔphoB-pRE112 recombinant plasmid from -80℃ ultra-low temperature refrigerator, streak the Escherichia coli on LB solid plate containing 50μg / mL LDAP, pick a single colony, inoculate it in LB liquid culture medium at 37℃, 180rpm overnight culture, mix it in the ratio of 1:3, 5:1, 10:1, let it stand for 1h, then spot the bacterial liquid on the center of the antibiotic-free LB solid plate and culture it for 24h, scrape the bacteria on the plate; dilute it 10 times, 20 times, and 100 times respectively, and then spread it on LB solid plate containing chloramphenicol (50μg / mL) without DAP and culture it overnight, pick a single colony, and use the primers pRE112-F / pRE112-R on the pRE112 plasmid for colony PCR;

[0077] Screening of mutant strains: The verified Δugd Aeromonas dakar containing the recombinant plasmid ΔphoB-pRE112 was inoculated into LB liquid medium containing CAP for overnight culture (37°C, 180rpm), and fresh LB liquid medium was used to make 10, 50, and 100-fold gradient dilutions and then spread on a plate containing 20% ​​sucrose, and cultured in a constant temperature shaking incubator at 37°C overnight; a single colony was picked, and the primers ΔphoB identification-F / ΔphoB identification-R designed on the genome outside the phoB homology arm were used for colony PCR verification, and the verified ΔugdΔphoB mutant strain was sequenced. If the sequencing was correct, the strain was expanded and cultured and stored at -80°C to obtain a ΔugdΔphoB double mutant strain;

[0078] (3) Construction of the ΔugdΔphoB+CphoB complementation strain

[0079] 1) Amplification of phoB gene

[0080] Using the genome of wild strain C160501 as a template, the upstream and downstream primers phoB-F / R of phoB were designed to amplify the phoB gene fragment. The product purified by gel electrophoresis after amplification was used as a template, and primers phoB bridge-F / R were added to perform PCR amplification.

[0081] 2) Linearized cloning vector

[0082] The pBBRMCS-2 plasmid was linearized by single restriction enzyme digestion with SacI, purified by gel electrophoresis, and amplified with primers pBBR1MCS-2Δ(lacZα)-F / R using the single restriction enzyme digestion pBBRMCS-2 plasmid as a template, and then purified and recovered;

[0083] 3) Seamless cloning

[0084] Use a pipette to add the sample as follows on ice at 4°C, gently pipette to mix, centrifuge briefly, place in a 50°C water bath for 10 min, and then immediately place on ice;

[0085]

[0086] 4) Transformation of recombinant fluid and identification of complementing plasmid

[0087] Take 10 μL of the ligation solution and add it to 100 uL of WM3064 E. coli competent cells. After ice bathing for 30 minutes and incubating at 42°C for 90 seconds, immediately place it on ice for 3 minutes, add LB medium containing DAP and culture on a shaker for 1.5 hours, spread it on a solid LB plate with DAP and kanamycin, and use pBBR1MCS-2 identification-F / R primer colony PCR for verification after 12-16 hours. The amplification system is as shown in the table below. After the colony PCR verification is correct, extract the plasmid and use pBBR1MCS-2 identification-F / R as primers for verification. If the band is correct, send the PCR product for sequencing, and store the remaining bacterial solution in a 30% glycerol tube;

[0088] 5) Screening of complement strains

[0089] The ΔugdΔphoB double mutant strain and WM3064 Escherichia coli containing the complementing plasmid were combined using the same method as the above-mentioned conjugation of the ΔugdΔphoB mutant strain. The conjugated colonies were then scraped off, washed twice with LB liquid, diluted 1000 times, and 50 μL was spread on an LB solid plate containing 50 μg / mL kanamycin and ampicillin. After incubation at 37°C, a single colony was picked, and primers pBBR1MCS-2 identification-F / R (product size 1350 bp) and phoB primers phoB-F / R were added for colony PCR. After electrophoresis verification, the colony was inoculated into LB liquid culture medium for overnight culture. The plasmid was extracted and PCR amplified with primers pBBR1MCS-2 identification-F / R. The electrophoresis product was sent for sequencing, and the remaining bacterial liquid was preserved with 30% glycerol to obtain the complementing strain ΔugdΔphoB+CphoB.

[0090] Furthermore, the present invention also proposes the use of the Aeromonas dakar ugd gene deletion mutant and the Aeromonas dakar ugd and phoB gene double deletion mutant or its complemented strain in the preparation of a drug for treating or preventing a disease caused by Aeromonas dakar infection. Preferably, the drug is a vaccine.

[0091] Compared with the prior art, the present invention has the following beneficial effects:

[0092] The present invention successfully constructs a single deletion mutant strain of the Δugd gene of Aeromonas dakar and a double deletion mutant strain of the ΔugdΔphoB gene of Aeromonas dakar by a traceless knockout method, and successfully constructs a complemented strain ΔugdΔphoB+CphoB by a seamless cloning method. The study found that compared with the wild strain, the virulence of the Δugd mutant strain (LD50) decreased by 73 times (reduced by 17.4 times), and the virulence of the ΔugdΔphoB mutant strain (LD50) decreased by 7.45 times. The immune protection rate of the Δugd mutant strain was 60%, and the immune protection rate of the ΔugdΔphoB double mutant strain was 36.7%. Both the Δugd mutant strain and the ΔugdΔphoB mutant strain can weaken the virulence of Aeromonas dakar C160501. However, the Δugd mutant strain has a better immune protection effect than the ΔugdΔphoB double mutant strain. It can be used as a candidate attenuated vaccine to resist the infection of the wild-type Aeromonas dakar C160501 strain. The invention provides a technical means for the research of attenuated live vaccine for Aeromonas dakar infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Figure 1 Amplification of upstream and downstream homology arm fragments;

[0094] Among them, 1: upstream homology arm; 2: downstream homology arm; M: molecular weight 5000bp marker;

[0095] Figure 2 Fusion fragment PCR verification;

[0096] Among them, 1: homology arm fusion fragment; 2: fusion fragment double enzyme digestion recovery product; M: molecular weight 5000bp marker;

[0097] Figure 3 pK18mobsacB plasmid double restriction enzyme digestion verification

[0098] Among them, 1: complete plasmid; 2: double-enzyme-digested plasmid; M1: molecular weight 15000bp marker; M2: molecular weight 5000bp marker;

[0099] Figure 4 Colony PCR verification;

[0100] Wherein, M: molecular weight 5000bp marker; 1-3: colony PCR results;

[0101] Figure 5 Double enzyme digestion identification;

[0102] Wherein, M: molecular weight 15000bp marker; 1: double enzyme digestion fragment; 2: recombinant plasmid;

[0103] Figure 6 Aeromonas dakar colony PCR;

[0104] Wherein, M: molecular weight 2000bp marker; 1-2: colony PCR products;

[0105] Figure 7 Verification of ugd gene knockout strain;

[0106] Wherein, M: molecular weight 5000bp marker; 1: wild-type strain PCR product; 2: knockout strain PCR product;

[0107] Figure 8 Amplification of upstream and downstream homology arm fragments (A) and fusion fragment PCR amplification (B);

[0108] In Figure A, M: 5000bp Marker; 1: upstream homology arm; 2: downstream homology arm; in Figure B, M: 5000bp Marker; 1, 2: homology arm fusion fragment;

[0109] Fig. 9 The fusion fragment and plasmid were double-digested;

[0110] Wherein, M: 5000bp Marker; 1: double enzyme digestion fusion fragment; 2: double enzyme digestion fusion fragment recovery product; 3: extracted plasmid; 4: double enzyme digestion plasmid;

[0111] Fig.10 Colony PCR verification;

[0112] Among them, M: 5000bp Marker; P1, P2: ΔphoB-pRE112 recombinant plasmid;

[0113] Fig.11 Double restriction enzyme digestion verification of recombinant plasmid ΔphoB-pRE112

[0114] Among them, M1: 15000bp Marker; M2: molecular weight 5000bp Marker; 1, 2: enzyme-digested fragments;

[0115] Fig.12 Identification of the ΔugdΔphoB double knockout strain;

[0116] Among them, M: 5000bp Marker; 1: double knockout strain amplification product; 2: wild-type strain amplification product;

[0117] Fig.13 Amplification of the phoB gene and pBBR1MCS-2 plasmid;

[0118] Among them, M1: 5000bp Marker; M2: 2000bp Marker; 1: pBBR1MCS-2Δ(lacZα) amplified fragment; 2: pBBR1MCS-2 plasmid: phoB gene fragment; 3: phoB bridge fragment;

[0119] Fig.14 phoB-pBBR1MCS-2 complementation recombinant plasmid verification;

[0120] Wherein, M: molecular weight 2000bp marker; 1, 2: phoB-pBBR1MCS-2 back-complemented recombinant plasmid amplification product fragment;

[0121] Fig.15 ΔugdΔphoB+CphoB complemented strain colony PCR verification;

[0122] Wherein, M: molecular weight 2000bp marker; 1,2: complement strain amplification product fragments;

[0123] Fig.16 ΔugdΔphoB+pBBR1MCS-2 empty vector strain colony PCR verification;

[0124] Among them, M: 2000bp Marker; 1,2: amplification products of empty vector strain;

[0125] Fig.17 Genetic stability of the ΔugdΔphoB double mutant;

[0126] Wherein, M: Marker with molecular weight of 5000 bp; 1: wild strain C160501; 2: 30th generation mutant strain;

[0127] Fig.18 Growth curve chart;

[0128] Among them, A: growth curve of strain under low phosphorus condition; B: growth curve of strain under high phosphorus condition;

[0129] Fig.19 H 2 O 2 Resistance test. DETAILED DESCRIPTION

[0130] The present invention is further described below by way of examples, the purpose of which is only to provide a better understanding of the research content of the present invention rather than to limit the protection scope of the present invention.

[0131] Example 1 Construction of Aeromonas dakar Δugd single mutant strain

[0132] 1 Materials and Methods

[0133] 1.1 Experimental Materials

[0134] 1.1.1 Strains

[0135] The wild strain of A. Dhakensis C160501 was isolated from farmed Siamese crocodiles in Hainan Province, recorded in the literature (Pu, W., G. Guo, N. Yang, Q. Li, F. Yin, P. Wang, J. Zheng, and J. Zeng. "Three Species of Aeromonas (A. Dhakensis, A. Hydrophila and A. Jandaei) Isolated from Freshwater Crocodiles (Crocodylus Siamensis) with Pneumonia and Septicemia." Lett Appl Microbiol 68, no. 3 (2019): 212-18.), and was isolated and preserved by this laboratory.

[0136] 1.1.2 Model Animals

[0137] The zebrafish used in this study were purchased from the Narcissus Pond Aquarium on Boai North Road, Haikou City. They were uniform in size, vigorous and healthy. After being raised in an aquarium at 28°C and a flow rate of 150 L / min for one week according to the Wester method (Westerfield, 1995), healthy individuals were selected for the experiment.

[0138] 1.1.3 Preparation of relevant culture media

[0139] ① Aeromonas basal medium: Weigh 5.63 g of Aeromonas basal medium powder, add 100 mL of distilled water, sterilize at high temperature, place in a clean bench and cool to 50°C, aseptically add ampicillin (50 μg / mL), mix well and pour into a sterile plate, seal with sealing film and store in a 4°C refrigerator.

[0140] ②LB liquid medium: weigh 0.5 g yeast extract, 1 g tryptone, and 1 g NaCl into a 250 mL conical flask, add distilled water and stir to dissolve, then adjust the pH to 7.0, make the volume to 100 mL, and sterilize in an autoclave at 121°C for 15 minutes.

[0141] ③LB solid medium: Weigh 1.8 g agar and add it to 100 mL LB liquid medium. After autoclaving at 121°C for 15 minutes, pour it into a sterile plate in a clean bench, seal it and store it in a 4°C refrigerator.

[0142] ④0.5% TSA medium: Weigh 1.5 g of tryptic peptone, 0.5 g of vegetable peptone, 1.5 g of sodium chloride, and 0.5 g of agar respectively and place them in a conical flask. Add 100 mL of distilled water and stir to dissolve. Sterilize at 121°C under high pressure for 20 min. Pour into a sterile plate in a clean bench and let it stand to solidify after use.

[0143] ⑤Sucrose screening medium: Dissolve 20 g of sucrose in 100 mL of LB solid medium, sterilize under high pressure at 115°C for 15 minutes, pour into a sterile culture dish in a clean bench, seal with sealing film, and store in a 4°C refrigerator.

[0144] 1.2 Experimental methods

[0145] 1.2.1 Primers used in the experiment

[0146] Table 1 Primers used in the experiment

[0147]

[0148] 1.2.2 Construction of Δugd knockout strain

[0149] (1) Extraction of the genome of Aeromonas dakar C160501

[0150] The Aeromonas dakar C160501 frozen in a -80°C ultra-low temperature freezer was taken out and activated on a clean bench. An inoculation loop was used to streak on an LB solid plate for separation. After overnight culture at 37°C, a single colony was picked and inoculated into LB liquid culture medium for expansion culture. The bacteria were shaken at 37°C and 180 rpm overnight, and the bacterial genomic DNA was extracted according to the instruction manual of the Nanjing Novezan Bacterial DNA Extraction Kit (FastPureBacteriaDNAIsolationMiniKit).

[0151] (2) Amplification of upstream and downstream homology arms of ugd gene

[0152] The upstream and downstream primers Up-F / R and Down-F / R of the ugd gene were used, and the genome of Aeromonas dakar C160501 was used as a template. After mixing with other PCR components, the upstream and downstream homologous arms of the ugd gene were amplified respectively.

[0153] (3) Recovery of PCR amplified fragments

[0154] Purify and recover the PCR product by referring to the operating instructions of the gel recovery / DNA purification kit (Fast Pure Gel DNA Extraction Mini Kit).

[0155] (4) Fusion of upstream and downstream homology arms of ugd gene

[0156] After completing the PCR amplification of the upstream and downstream homology arms of the ugd gene and the purification and recovery of the products, the fusion PCR method is used to make the upstream and downstream homology arms perform base complementary pairing through the common 15bp sequence and then amplify the fusion fragment. After the above PCR reaction is completed, the upstream homology arm primer up-F and the downstream homology arm primer Down-R are added to the PCR tube to continue amplifying the fusion fragment. After the PCR amplification of the upstream and downstream homology arm fusion fragments is completed, the PCR product is gel recovered.

[0157] (5) Construction of Δugd-pK18mobsacB knockout plasmid

[0158] The upstream and downstream homology arm fusion fragment gel recovery products were double-digested with the pK18mobsacB plasmid using restriction endonucleases EcoRI and HindIII, reacted in a constant temperature water bath at 37°C for 30 minutes, and then subjected to gel electrophoresis. The gel containing the target fragment was cut out in a gel imager and then subjected to gel recovery.

[0159] (6) Ligation reaction

[0160] Use T4 DNA ligase to connect the double-digested plasmid and the purified and recovered products of the fusion fragment. The plasmid and the fusion fragment are added in a molar ratio of 1:4, and then other components are added and mixed, centrifuged briefly, and reacted in a 22°C water bath for 120 minutes.

[0161] (7) Transformation of Δugd-pK18mobsacB recombinant plasmid

[0162] Add the above ligation solution to WM3064 E. coli competent cells and immediately place on ice for 30 minutes. Place the mixture in the previous step in a 42°C constant temperature water bath, heat shock for 45 seconds and immediately take it out and place it on ice for 5 minutes. Add 900μL of LB liquid culture medium containing 50μg / mL LDAP, and culture it in a constant temperature shaking culture at 37°C, 180rpm for 60 minutes. Spread the bacterial solution on an LB solid plate containing kanamycin and DAP in a clean bench, and culture it in a constant temperature incubator at 37°C for 12 hours.

[0163] (8) Verification of Δugd-pK18mobsacB recombinant plasmid

[0164] Positive clone screening:

[0165] In the clean bench, use an inoculation loop to pick up a single colony on the transformation plate and dissolve it in PCR containing 6 mL of sterile deionized water. Take out 3 μL and heat it in a microwave oven for 3 minutes. Use the fusion fragment amplification primers Up-F / Down-R to perform colony PCR. After the PCR amplification is completed, perform gel electrophoresis to detect whether the target band is contained to screen positive clones.

[0166] Verification of recombinant plasmid:

[0167] The positive clones screened by colony PCR were inoculated into LB liquid culture medium containing kanamycin and DAP, cultured overnight in a constant temperature shaking incubator at 37°C, 180rpm and the recombinant plasmid was extracted. The extracted recombinant plasmid was double-enzyme digestion verified, and the enzyme digestion products were detected by gel electrophoresis. After verifying that the bands were correct, the enzyme digestion products were purified and recovered and sent for sequencing. After the sequencing was correct, the strain containing the recombinant plasmid was preserved.

[0168] (9) Construction of ugd gene deletion mutant

[0169] Joint transfer:

[0170] ① Take out Aeromonas dakar C160501 and Escherichia coli WM3064 containing the recombinant plasmid from the -80℃ ultra-low temperature freezer, use an inoculation loop to streak inoculation on the LB solid plate and the LB solid plate containing 50μg / mL LDAP in the clean bench, culture at 37℃ overnight, pick a single colony and inoculate it into LB liquid culture medium, and culture it in a constant temperature shaking incubator at 37℃, 180rpm overnight.

[0171] ② Use a pipette to transfer 1 mL of Aeromonas dakar and Escherichia coli culture medium into 50 mL of LB liquid medium, and culture in a constant temperature shaking incubator at 37°C and 180 rpm until OD 600 The value is between 0.4 and 0.6.

[0172] ③ In the clean bench, pipette 2 mL of bacterial solution into sterile centrifuge tubes, centrifuge at 6000 rpm for 10 minutes, discard the supernatant and save the bacterial pellet.

[0173] ④Add fresh culture medium again and repeat the previous step to wash the bacteria.

[0174] ⑤ After thoroughly mixing WM3064 Escherichia coli and Aeromonas dakar in a ratio of 3:1, 5:1 and 7:1, use a spreader to apply it on an LB solid plate without antibiotics in an ultra-clean workbench, and culture it in a constant temperature incubator at 37°C for 12 to 16 hours.

[0175] ⑥ Scrape the bacteria off the plate in a clean bench, make 10-fold gradient dilutions with clean culture medium, spread on a solid LB plate containing kanamycin (50 μg / mL) and without DAP, and culture overnight in a constant temperature incubator at 37°C.

[0176] ⑦ Extract single colonies on the plate, use PK18-F / PK18-R primers designed according to the recombinant plasmid sequence as a template for colony PCR, detect positive clones, and after verifying that the bands are correct, purify and recover the PCR products and send them for sequencing. After the sequencing results are correct, store the positive clones in a -80℃ ultra-low temperature refrigerator.

[0177] Screening of mutant strains:

[0178] ① Take out the Dhaka Aeromonas strain containing the recombinant plasmid Δugd-pK18mobsacB from the -80℃ ultra-low temperature freezer, use an inoculation loop to streak on the LB solid plate in the clean bench, culture at 37℃ overnight, pick a single colony and inoculate it into LB liquid culture medium, and culture it in a constant temperature shaking incubator at 37℃, 180rpm overnight.

[0179] ② Use fresh LB liquid medium to make serial 10-fold gradient dilutions, use a spreader to spread on LB solid plates (20% sucrose), and culture in a constant temperature incubator at 37°C overnight.

[0180] ③ In the clean bench, pick a single colony on the plate as a template, and use the primers Δugd-F / Δugd-R designed for the gene sequences outside the upstream and downstream homologous arms of the ugd gene to perform colony PCR to screen positive clones.

[0181] ④ After the colony PCR verification is correct, the remaining bacterial liquid is inoculated into LB liquid culture medium, the PCR product is purified and recovered and sent for sequencing. After the sequencing results are correct, the positive clone strains are stored in a -80℃ ultra-low temperature refrigerator.

[0182] 2 Results Analysis

[0183] 2.1 Construction of Δugd Aeromonas dakar strain

[0184] 2.1.1 Amplification of upstream and downstream homology arms of ugd gene

[0185] Using the genome of Aeromonas dakar C160501 as a template, the upstream homology arm of the ugd gene was amplified using primers Up-F / Up-R, and the amplified fragment size was 1016bp; the downstream homology arm of the ugd gene was amplified using primers Down-F / Down-R, and the amplified fragment size was 1008bp; 1% agarose gel electrophoresis was used to verify the upstream and downstream homology arm amplification products, and the verification results were correct, as shown in the following figure. Figure 1 shown.

[0186] 2.1.2 Fusion of upstream and downstream homology arms of ugd gene

[0187] The upstream and downstream homology arms were connected by overlapping 15 bp sequences through fusion PCR to form a fusion fragment with a size of 2024 bp ( Figure 2 ). The fusion fragment was amplified by PCR, and after amplification, restriction endonucleases EcoRI and HindIII were used for double digestion, and the digestion products were recovered by gel.

[0188] 2.1.3 Double restriction enzyme digestion of pK18mobsacB plasmid

[0189] The pK18mobsacB plasmid was double-digested with restriction endonucleases EcoRI and HindIII as with the fusion fragment. The plasmid digestion products were recovered after 1% agarose gel electrophoresis. Lane M1 represents the molecular weight 15000bp Marker, lane M2 represents the molecular weight 5000bp Marker, lane 1 represents the undigested pK18mobsacB plasmid, and lane 2 represents the double-digested pK18mobsacB plasmid. Both are 5721bp in size, and the verification result is correct ( Figure 3 ).

[0190] 2.1.4 Identification of Δugd-pK18mobsacB recombinant plasmid

[0191] (1) Colony PCR verification

[0192] The upstream and downstream homology arm fusion fragments of the ugd gene and the double enzyme digestion recovery product of the pK18mobsacB plasmid were connected by T4 DNA ligase, and transformed into WM3064 Escherichia coli competent cells by heat shock, and cultured at 37°C, 180rpm for 1 hour. WM3064 Escherichia coli cannot grow in a culture medium lacking DAP (diaminopimelic acid). After the bacterial solution was revived for 1 hour, 100 μL of bacterial solution was drawn with a pipette in the clean bench and spread on an LB solid plate (50 μg / mL LDAP, 50 μg / mL Kan), and cultured in a constant temperature incubator at 37°C overnight. A single colony on the plate was picked and colony PCR verification was performed using primers Up-F / Down-R. The size of the PCR product was 2024 bp ( Figure 4 ).

[0193] (2) Double enzyme digestion verification

[0194] In the clean bench, the positive clones were inoculated into LB liquid culture medium and cultured overnight in a constant temperature shaking incubator at 37°C and 180rpm. The recombinant plasmid was extracted and double-digested with EcoRI and HindIII for verification. The recombinant plasmid fragment size was 7745bp, and the double-digested fragment sizes were 5721bp and 2024bp, respectively. The verification results were correct ( Figure 5 ).

[0195] 2.1.5 Identification of ugd gene deletion mutants

[0196] (1) Identification of Aeromonas dakar containing recombinant plasmids

[0197] The WM3064 Escherichia coli containing the Δugd-pK18mobsacB plasmid was mixed with Aeromonas dakar for conjugation transfer. The recombinant plasmid contained a kanamycin resistance marker and the WM3064 Escherichia coli could not grow in a medium without DAP for preliminary screening. The primers pK18-F / pK18-R designed with the pK18mobsacB plasmid sequence were used for colony PCR verification to verify the Aeromonas dakar containing the recombinant plasmid. The PCR amplified fragment size was 1422 bp, and the verification result was correct ( Figure 6 ).

[0198] (2) Identification of ugd gene knockout strains

[0199] The Aeromonas dakaensis containing the recombinant plasmid that was verified by colony PCR was expanded in LB liquid culture medium and coated on LB solid plates containing 20% ​​sucrose in a clean bench for negative screening. Single colonies on the sucrose plate were picked and colony PCR was performed using primers Δugd-F / Δugd-R designed based on the genome sequence outside the homology arm of the ugd gene. The size of the fragment amplified using the genome of Aeromonas dakaensis C160501 as a template was 3437bp, the amplified fragment of the ugd gene deletion strain was 2090bp, and the size of the ugd gene fragment was 1347bp. The verification result was correct ( Figure 7 ), the Δugd mutant strain was constructed.

[0200] Example 2 Construction of Aeromonas dakar ΔugdΔphoB double mutant and complemented strain

[0201] 1 Experimental methods

[0202] 1.1 Primers used in the experiment

[0203] Table 2 Primers used in the experiment

[0204]

[0205]

[0206] 1.2 Construction of ΔugdΔphoB knockout strain

[0207] (3) Amplification and fusion of upstream and downstream homologous arms of the phoB gene

[0208] A 1000 bp fragment was selected from the upstream and downstream of the phoB gene to be knocked out as the upstream and downstream homology arms for primer design. The forward and reverse primers of the upstream homology arm were Up-F-SacI and Up-R, and the forward and reverse primers of the downstream homology arm were Down-F and Down-R-XbaI. The Aeromonas dakar C160501 strain was used as a template for PCR amplification and electrophoresis purification and recovery.

[0209] (4) Fusion of upstream and downstream homology arms of the phoB gene

[0210] The upstream and downstream homology arm fragments obtained by purification and recovery were used as templates for fusion PCR experiments. Then primers Up-F-SacI / Down-R-XbaI were added for bridge construction. After PCR amplification, the gel was recovered.

[0211] (3) Double restriction digestion of plasmid and fusion fragment

[0212] The WM3064 E. coli containing the pRE112 plasmid was taken out from -80°C, streaked on a solid LB plate with DAP and CAP (50 μg / mL), cultured overnight at 37°C, and a single colony was dipped into the LB liquid medium with an inoculation loop, cultured overnight at 37°C, 180 rpm, and then the plasmid was extracted. The extracted pRE112 plasmid and fusion fragment gel recovery products were double-digested with SacI and XbaI restriction endonucleases, respectively, and adjusted to 37°C using a constant temperature metal bath. After 2 hours of reaction, gel recovery was performed.

[0213] (4) Plasmid and fusion fragment ligation

[0214] The double-digested pRE112 plasmid and fusion fragment product recovered from the gel were added in a molar ratio of 1:3 and ligated using T4 DNA ligase. The reaction was carried out in a 16°C water bath overnight.

[0215] (5) Preparation and transformation of competent cells

[0216] Place the prepared competent cells and ligation solution on ice, add 10 μL of ligation solution and mix with the competent cells, and place the mixture on ice for 30 minutes. Heat shock at 42°C for one and a half minutes and place on ice for 3 minutes. Then add 900 μL of LB liquid culture medium containing 50 μg / mL LDAP and culture at 37°C, 180 rpm for 2 hours in a constant temperature shaker. Spread the bacterial solution on the LB solid plate containing CAP and DAP and culture overnight at 37°C in a constant temperature incubator.

[0217] (6) Verification of ΔphoB-pRE112 recombinant plasmid

[0218] Pick a single colony in a clean bench and place it in 8uL sterile ddHO 2 Pipette 3uL of the culture medium into a PCR tube containing 50 μL of pRE112 as a template and perform colony PCR using primers pRE112-F / pRE112-R on the pRE112 plasmid. Verify the presence of the target band by gel electrophoresis to screen positive clones.

[0219] The verified positive clones were inoculated into LB liquid medium containing DAP and CAP (50 μg / mL), and the plasmids were extracted after overnight culture. The plasmids were double-digested for secondary verification. After the bands were verified to be correct, they were purified and recovered and sent for sequencing. If the sequencing was correct, the strains were stored at 80°C.

[0220] (7) Construction of the ΔugdΔphoB double mutant

[0221] Combined transfer experiment: Take out WM3064 E. coli and Δugd knockout strain containing ΔphoB-pRE112 recombinant plasmid from -80℃ ultra-low temperature refrigerator, streak E. coli on LB solid plate containing 50μg / mL LDAP, pick single colony, inoculate in LB liquid medium at 37℃, 180rpm overnight culture, mix at a ratio of 1:3, 5:1, 10:1, let stand for 1h, then spot the bacterial liquid on the center of LB solid plate without antibiotics and culture for 24h, scrape the bacteria on the plate. Dilute 10 times, 20 times, 100 times respectively, and then apply on LB solid plate containing chloramphenicol (50μg / mL) without DAP overnight culture, pick single colony, and use primers pRE112-F / pRE112-R on pRE112 plasmid for colony PCR.

[0222] Screening of mutants: The verified Δugd Aeromonas dakar containing the recombinant plasmid ΔphoB-pRE112 was inoculated into LB liquid medium containing CAP for overnight culture (37°C, 180rpm), and fresh LB liquid medium was used to make 10, 50, and 100 times gradient dilutions and then spread on a plate containing 20% ​​sucrose, and cultured in a constant temperature shaking incubator at 37°C overnight. Pick a single colony, and use the primers ΔphoB identification-F / ΔphoB identification-R designed on the genome outside the phoB homology arm to perform colony PCR verification, and the verified ΔugdΔphoB mutant was sequenced. If the sequencing is correct, the strain is expanded and cultured and stored at -80°C.

[0223] 1.3 Construction of phoB complementation strain

[0224] (1) Amplification of the phoB gene

[0225] Using the genome of wild strain C160501 as a template, the upstream and downstream primers phoB-F / R of phoB were designed to amplify the phoB gene fragment. The product purified by gel electrophoresis after amplification was used as a template and primers phoB-bridge-F / R were added for PCR amplification.

[0226] (2) Linearized cloning vector

[0227] The pBBRMCS-2 plasmid was taken out from -80℃ and streaked onto an LB solid plate with Kana. After overnight culture, a single colony was picked and inoculated into an LB liquid medium containing Kana. After overnight culture, the plasmid was extracted and linearized with a single restriction enzyme SacI. After gel electrophoresis and gel purification, the single-enzyme-cut pBBRMCS-2 plasmid was used as a template, and primers pBBR1MCS-2Δ(lacZα)-F / R were added for amplification, and then purified and recovered.

[0228] (3) Seamless cloning (recombination reaction)

[0229] Use a pipette to add samples according to Table 3 on ice at 4°C, pipette gently to mix, centrifuge briefly, place in a 50°C water bath for 10 min, and then immediately place on ice.

[0230] Table 3 Ligation reaction system

[0231]

[0232] (4) Transformation of recombinant fluid and identification of complementing plasmid

[0233] Take 10μL of the connection solution and add it to 100uL of WM3064 E. coli competent cells. After ice bathing for 30min, place it on ice immediately for 3min at 42℃ for 90s. Add LB medium containing DAP and culture it on a shaker for 1.5h. Spread it on a solid LB plate with DAP and kanamycin. After 12-16h, use pBBR1MCS-2 identification-F / R primer colony PCR for verification. The amplification system is as shown in the table below. After the colony PCR verification is correct, extract the plasmid and use pBBR1MCS-2 identification-F / R as primers for verification. If the band is correct, send the PCR product for sequencing. The remaining bacterial solution is stored in a 30% glycerol tube.

[0234] (5) Screening of complement strains

[0235] The ΔugdΔphoB double mutant strain and WM3064 Escherichia coli containing the complementing plasmid were combined in the same way as the above-mentioned construction of the ΔugdΔphoB mutant strain. The colonies after the combination were scraped off, washed twice with LB liquid, and diluted 1000 times. 50μL was spread on a solid LB plate containing 50μg / mL of kanamycin and ampicillin. After culturing at 37°C, a single colony was picked, and primers pBBR1MCS-2 identification-F / R (product size 1350bp) and phoB primers phoB-F / R were added for colony PCR. After electrophoresis verification, the colony was inoculated into LB liquid culture medium for overnight culture, and the plasmid was extracted and PCR amplified with primers pBBR1MCS-2 identification-F / R. The electrophoresis product was sent for sequencing, and the remaining bacterial liquid was stored with 30% glycerol.

[0236] 1.4 Construction of ΔugdΔphoB+pBBR1MCS-2 empty deletion strain

[0237] The ΔugdΔphoB double mutant strain stored at -80°C was combined with the pBBRMCS-2 vector strain using the same method as the above-mentioned conjugation of the ΔugdΔphoB mutant strain, followed by screening using the same method as the screening of the complemented strain, using the primers pBBR1MCS-2 identification-F / R designed on the vector for colony PCR to verify that the ΔugdΔphoB (pBBR1MCS-2) empty vector double knockout strain was correctly dissolved in equal proportions in 30% glycerol and stored at -80°C.

[0238] 1.5 Phenotypic analysis of the ΔugdΔphoB double mutant

[0239] (1) Genetic stability testing

[0240] The ΔugdΔphoB double mutant strain was taken out from -80°C and streaked onto a solid LB plate containing ampicillin. A single colony was picked and inoculated into LB liquid culture medium. It was subcultured 30 times in a row and the genetic stability of the mutant strain was detected by colony PCR method.

[0241] (2) Growth curve determination

[0242] Growth curves of wild-type C160501 strain, Δugd, ΔugdΔphoB double mutant, ΔugdΔphoB+CphoB, and ΔugdΔphoB+pBBR1MCS-2 empty vector deletion strain were cultured at 30°C and 180 r / min, and potassium dihydrogen phosphate (K 2 HPO 4 ) into the phosphorus-based medium. The phosphorus ion concentration was adjusted to 0.5 mol / L and 10 mmol / L. The growth status was recorded using a spectrophotometer for 24 hours, and the OD600 value was measured every 2 hours. The experiment was repeated three times for each group.

[0243] (3)H 2 O 2 Resistance testing

[0244] The overnight cultures of wild-type C160501 strain, Δugd, ΔugdΔphoB double mutant strain, ΔugdΔphoB+CphoB, and ΔugdΔphoB+pBBR1MCS-2 empty deletion strain were cultured to an OD600 value of 1.0, and 100 μL of each bacterial solution was spread on an LB solid plate, and a filter paper disk (6 mm) soaked in 0.5 mol / L, 1 mol / L, and 2 mol / L H2O2 solution was attached to the center of the LB solid plate. Each group was repeated three times, and the inhibition zone was determined after incubation at 30°C for 24 hours (Wu et al., 2018).

[0245] (4) Virulence detection of the ΔugdΔphoB double mutant

[0246] The wild-type Aeromonas dakar, Δugd, ΔugdΔphoB double mutant, ΔugdΔphoB+CphoB, and ΔugdΔphoB+pBBR1MCS-2 empty deletion strain were inoculated into 5 mL of LB liquid medium for overnight culture and the bacterial solution concentration was adjusted to 10 8 CFU / mL. After collecting the bacteria by centrifugation, the bacteria were resuspended in PBS. 50 zebrafish in each group were intraperitoneally injected with 10 μL of bacterial solution. The control group was treated with 10 μl PBS. The clinical symptoms and mortality of each group were recorded every 24 hours.

[0247] (5) The median lethal dose (LD) of the ΔugdΔphoB double mutant 50 ) determination

[0248] Wild-type Aeromonas dakar, Δugd, ΔugdΔphoB double mutant, ΔugdΔphoB+CphoB, ΔugdΔphoB+pBBR1MCS-2 empty deletion strain were inoculated into 5 mL of LB liquid medium and cultured to mid-logarithmic phase. The bacterial solution was diluted 10 times with PBS. Eight zebrafish in each group were intraperitoneally injected with 10 μL of bacterial solution. The number of zebrafish deaths was recorded within 72 h, and the median lethal dose (LD 50 ) was measured by the Bliss method (Finney, 1985).

[0249] (6) Vaccination and challenge test of ΔugdΔphoB double mutant

[0250] To evaluate the potential of the ΔugdΔphoB double mutant as a live attenuated vaccine candidate against A. dakar C160501, the immunization efficiency was tested. A total of 30 zebrafish were divided into a PBS-treated group (control group) and an experimental group. Eight zebrafish in each group were injected intraperitoneally with 10 μL of bacterial solution. The number of zebrafish deaths was recorded every day. Two weeks after immunization, all groups were injected intraperitoneally with 10 μL of 108 wild-type strain. The cumulative mortality was monitored for 15 days after challenge. The relative survival rate (RPS) was determined using the following formula: RPS = [1-(mortality rate of experimental group / mortality rate of control group)] × 100% (Ingrametal., 1981). To verify the infection caused by A. dakar, the bacteria were re-isolated and identified from the dead fish at the end of the experiment.

[0251] 1.6 Data Analysis

[0252] Statistical analysis of different strains was performed using one-way analysis of variance (ANOVA) and T-test (TTest) using SPSS software. P values ​​< 0.05 between groups were considered significant differences.

[0253] 2 Results Analysis

[0254] 2.1 Construction of the ΔugdΔphoB double mutant

[0255] 2.1.1 Amplification and fusion of upstream and downstream homology arms

[0256] Using wild-type Aeromonas dakar as template, Up-F-SacI / Up-R as primers amplified the upstream homology arm of 1137 bp, and Down-F / Down-R-XbaI as primers amplified the downstream homology arm of 932 bp. The PCR amplification results are shown in Figure 8As shown in (A), after gel excision and recovery, the upstream and downstream homology arms were used as templates through partial base complementary pairing, and the upstream and downstream homology arms were PCR fused using Up-F-SacI / Down-R-XbaI primers to obtain a fusion fragment of 2069 bp. The fusion fragment is shown in Figure 8 (B) shown.

[0257] 2.1.2 Double restriction digestion of pRE112 plasmid and fusion fragment

[0258] The size of the extracted plasmid was 5760 bp. After the pRE112 plasmid was extracted, the pRE112 plasmid and the fusion fragment were double-digested with the fast restriction endonucleases SacI and XbaI, respectively. The digestion products were recovered after 1% agarose gel electrophoresis. The results were in line with expectations, as shown in Figure 2. Fig. 9 .

[0259] 2.1.3 Identification of ΔphoB-pRE112 recombinant plasmid

[0260] (1) Colony PCR verification

[0261] The fusion fragment recovered from the double-enzyme gel was connected to the pRE112 plasmid, and heat-shocked to transform WM3064 E. coli. After the bacterial solution was revived at 37°C and 180rpm for 1 hour, it was coated on a LB solid plate with DAP and chloramphenicol. After overnight culture, a single colony was picked and identified by colony PCR using the primers pRE112-F / pRE112-R designed on the pRE112 plasmid. Fig.10 The fusion fragment and the pRE112 plasmid were connected to obtain the recombinant plasmid ΔphoB-pRE112, which contained 2 recombinant plasmids. The size of the PCR amplification product was 2452 (including the fusion fragment of 2069 bp), and the result was in line with expectations.

[0262] (2) Double restriction enzyme digestion verification of ΔphoB-pRE112 recombinant plasmid

[0263] The extracted plasmid was double-digested with restriction endonucleases SacI and XbaI, reacted in a constant temperature water bath at 37°C for 2 h, and then the reaction solution was taken out for agarose gel electrophoresis. The double-digestion of ΔphoB-pRE112 recombinant plasmid obtained two target bands of 5760 bp of plasmid and 2069 bp of ΔphoB fusion fragment ( Fig.11 ).

[0264] 2.1.4 Identification of ΔugdΔphoB double knockout strain

[0265] The Δugd Aeromonas dakar strain and WM3064 Escherichia coli with the ΔphoB-pRE112 recombinant plasmid were mixed and cultured overnight, and then spread on a solid LB plate containing CAP (50 μg / mL) but without DAP and cultured overnight for preliminary screening (the recombinant plasmid could not grow), and a single colony was picked and identified with the primers ΔphoB-F designed for the gene outside the ΔphoB fusion fragment / ΔphoB-F identification, such as Fig.12 Lane 1 is the amplified fragment of the ΔugdΔphoB double knockout strain, with a size of 2230 bp, and lane 2 is the amplified fragment of the Aeromonas dakar C160501 strain, with a size of 2920 bp.

[0266] 2.2 Construction of phoB complementation strain

[0267] 2.2.1 Construction of phoB-pBBR1MCS-2 complementing plasmid

[0268] (1) Amplification of the phoB gene and pBBR1MCS-2 plasmid

[0269] The wild-type C160501 strain was used as a template, and the phoB fragment was amplified using primers phoB-F / phoB-R (size 690bp). The 30bp sequence shared by pBBR1MCS-2 and phoB protein was used for PCR bridging, and primers phoB-bridge F / phoB bridge-R were used to amplify (size 720bp). The pBBR1MCS-2 plasmid (size 5148bp) was extracted and pBBR1MCS-2 after single enzyme digestion was used as a template. Primers pBBR1MCS-2Δ(lacZα)-F / R were designed for PCR bridging, and the size was 4781bp. The PCR product was recovered after 1% agarose gel electrophoresis and gel excision ( Fig.13 ).

[0270] (2) Identification of phoB-pBBR1MCS-2 complementing recombinant plasmid

[0271] pBBR1MCS-2 and phoB gene fragment were connected and transformed into WM3064 E. coli competent cells. Colony PCR was performed using primers pBBR1MCS-2 identification-F / R on the plasmid. The product size was 1350 bp ( Fig.14 ).

[0272] 2.2.2 Construction of ΔugdΔphoB+CphoB complementation strain

[0273] The phoB-pBBR1MCS-2 complemented recombinant plasmid and the ΔugdΔphoB double mutant strain were mixed in a certain ratio, cultured overnight, diluted and spread on LB solid plates containing Knan (50 μg / mL) for culture (without DAP), and single colonies were picked for verification using phoB bridge primers phoB-bridge F / R and primers pBBR1MCS-2 identification-F / R on the plasmid, such as Fig.15 , the amplified band sizes are 720bp and 1350bp. The band sizes are correct.

[0274] 2.2.3 Construction of ΔugdΔphoB+pBBR1MCS-2 empty vector deletion strain

[0275] The ΔugdΔphoB mutant strain and the pBBR1MCS-2 vector strain were subjected to a conjugation transfer experiment. The primers pBBR1MCS-2 identification-F / R designed on the vector were used for colony PCR. Lanes 1 and 2 are PCR products with a size of 950 bp ( Fig.16 ).

[0276] 2.3 Phenotypic analysis of Δugd single mutant, ΔugdΔphoB double mutant and their complemented strains

[0277] 2.3.1 Determination of genetic stability of mutants

[0278] The ΔugdΔphoB double mutant was subcultured 30 times, and the genetic stability of the double mutant was detected by PCR using primers for the outer gene of ΔphoB. Lanes 1 and 2 are the PCR product bands of the 30th generation double mutant, with a band size of 2230 bp, and lane 2 is the wild-type Aeromonas dakar strain, with a band size of 2920 bp. The band size is in line with expectations, indicating that the mutant can be stably inherited ( Fig.17 ).

[0279] 2.3.2 Growth curve determination

[0280] To evaluate low PO 4 3- and high PO 4 3- The effects of conditions on the growth of double mutants were compared between the wild type and double mutants, complemented strains and empty deletion strains under 0.5 mM low PO 4 3- and 10 mM high PO 4 3- The growth curve of the phosphorus-based incubation medium is as follows Fig.18As shown in the figure, the growth of the strain was inhibited in the low-phosphorus environment of 0-2h. After 2h, the growth rate of the double mutant strain ΔugdΔphoB began to increase. At 16h, the growth rate of the wild-type strain was higher than that of the mutant strain, indicating that the deletion of the phoB gene was not conducive to the growth of the strain. PhoB can positively regulate the absorption of inorganic phosphorus to promote cell survival ( Fig.18 A); at 10 mM high PO 4 3- Under the same environment, the wild-type strain, double mutant and complement strain showed similar growth levels at 9 h. 600 The value enters a stable period ( Fig.18 B).

[0281] 2.3.3H 2 O 2 Resistance test

[0282] Because biofilms and defense H 2 O 2 Therefore, a hydrogen peroxide resistance test was conducted. Fig.19 It can be seen that at a concentration of 0.5 mol / L H 2 O 2 Under these conditions, the ΔugdΔphoB double mutant was more resistant to H than the wild-type strain and the Δugd mutant. 2 O 2 The ΔugdΔphoB double mutant was more sensitive to H 2 O 2 The resistance was significantly different from that of the wild-type strain (p < 0.05). 2 O 2 At the same concentration, both single and double mutants were sensitive to H 2 O 2 More sensitive and with significant differences, indicating that the phagocytic ability decreased after the deletion of ugd and phoB genes (the ability to resist phagocytic cells), but as the concentration increased to 2 mol / LH 2 O 2 At the concentration of 2 O 2 Compared with the wild-type strain, the phoB gene deletion did not affect the H 2 O 2 Resistance, but the resistance can be restored to wild-type levels by complementary plasmids. 2 O 2 Under these conditions, the Δugd mutant had stronger anti-phagocytic ability than the ΔugdΔphoB double mutant.

[0283] 2.3.4 Virulence test of mutant strains

[0284] In order to understand the virulence of wild-type and mutant strains of Aeromonas dakar, zebrafish were used as the challenge experiment model, and 50 zebrafish in each group were used for the challenge experiment. It was found that the survival rate of the wild-type strain C160501 group was 40%, and the cumulative mortality rate was 60%. The survival rate of zebrafish in the Δugd mutant group was 88%, and the mortality rate was 12%. The survival rate of the ΔugdΔphoB double mutant was 70%, and the cumulative mortality rate was 30%, indicating that the virulence was attenuated after knocking out ugd and phoB (Table 4).

[0285] Table 4 Toxicity test

[0286]

[0287]

[0288] 2.3.5 Median lethal dose (LD 50 ) determination

[0289] In order to understand the changes in the virulence of Aeromonas dakar after the deletion of ugd gene and phoB gene, the LD50 experiment used zebrafish as the experimental model. In zebrafish, the median lethal dose (LD50) of the wild-type C160501 strain was 1.65×10 7 CFU / mL, compared with the wild-type strain, the Δugd mutant (LD 50 ) is 2.87×10 8 CFU / mL, the virulence decreased by more than one order of magnitude (reduced by 17.4 times), and the LD of the ΔugdΔphoB double mutant 50 The value is 1.23×10 8 CFU / ml, the virulence decreased by 7.45 times, and the LD50 of the Δugd mutant was 2.3 times weaker than that of the ΔugdΔphoB double mutant, indicating that knocking out the ugd gene can weaken the virulence of Aeromonas dakar (Table 5).

[0290] Table 5 Median lethal dose (LD 50 )

[0291]

[0292]

[0293] 2.3.6 Analysis of the immune protection effect of mutant strains

[0294] In order to evaluate the potential of Δugd single mutant, ΔugdΔphoB double mutant and their complemented strain ΔugdΔphoB+CphoB as live attenuated vaccine candidates against Aeromonas dakar C160501, the immunization efficiency was tested. A total of 150 zebrafish were divided into 5 groups (30 zebrafish in each group) and injected intraperitoneally twice. The first immunization injection was performed with 10 μL of 11.8×10 7 CFU / mL, 8.4×10 7 CFU / mL, 1.05×10 7 CFU / mL, 9.7×10 7 CFU / mL, and the control group was injected with 10 μL of PBS buffer, and the number of zebrafish deaths was recorded every day. Two weeks after immunization, all groups were injected with a lethal dose of 10 μL of 1.67×10 8 The wild-type strain C160501 was injected intraperitoneally. The cumulative number of deaths was recorded every day after the attack. The results showed that the immune protection rate of the Δugd mutant was 60%, the cumulative mortality rate was 40%, and the immune protection rate of the ΔugdΔphoB double mutant was 36.7%, and the cumulative mortality rate was 63.3%, indicating that the Δugd mutant was more immunoprotective than the ΔugdΔphoB double mutant (Table 6).

[0295] Table 6 Immune protection test

[0296]

Claims

1. A. dhakensis ugd gene deletion mutant, It is characterized in that The ugd gene deletion mutant of Aeromonas dhakensis is obtained by deleting the ugd gene on the basis of the wild strain of Aeromonas dhakensis. The wild strain of Aeromonas dhakensis is A. dhakensis C160501.

2. A double deletion mutant of ugd and phoB genes of Aeromonas dakar or a complemented strain thereof, It is characterized in that The double deletion mutant of ugd and phoB genes of Aeromonas dhaka is obtained by simultaneously deleting the ugd and phoB genes on the basis of the wild strain of Aeromonas dhaka; the complemented strain is obtained by complementing and expressing the phoB gene on the basis of the double deletion mutant of ugd and phoB genes of Aeromonas dhaka, wherein the complemented strain constitutively expresses the phoB gene, and the wild strain of Aeromonas dhaka is A. dhakensis C160501.

3. A method for constructing the Aeromonas dakar ugd gene deletion mutant strain according to claim 1, It is characterized in that The following steps are involved: (1) Design and synthesize the following primers: Up-F: ACGAATTCGAGCATCCGCACCTTGTCT Up-R: GCAGTTGCCGTAGATGATGTTGCGTTGCAGCAGG Down-F:ATCTACGGCAACTGCGACA Down-R:ACAAGCTTCCACTCTCTCACCTCATCGG △ugd-F:CGTGGAAGGAGAAGATGG △ugd-R:CAACATGCTGGTCAATCTG pK18-F:ATGAACATCAAAAAGTTTGCA pK18-R:TTATTTGTTAACTGTTAATTGTCC ugd-F: ACTCTAGAATGAACATTACTGTATTTGG ugd-R: ACGGATCCTTATTTCATTACCGATTCGC (2) Construction of Δugd knockout strain 1) Extraction of the genome of Aeromonas dakar C160501 Aeromonas dakar C160501 frozen in a -80°C ultra-low temperature freezer was taken out and activated on a clean bench. An inoculation loop was used to streak the bacteria on an LB solid plate. After overnight culture at 37°C, a single colony was picked and inoculated into LB liquid culture medium for expansion culture. The bacteria were shaken at 37°C, 180 rpm overnight to extract bacterial genomic DNA. 2) Amplification of upstream and downstream homology arms of ugd gene The upstream and downstream primers Up-F / R and Down-F / R of ugd gene were used to amplify the upstream and downstream homology arms of ugd gene respectively, with the genome of Aeromonas dakar C160501 as template and mixed with other PCR components; 3) PCR amplified fragment recovery Purify and recover the PCR product according to the instructions of the gel recovery / DNA purification kit; 4) Fusion of upstream and downstream homology arms of ugd gene After completing the PCR amplification of the upstream and downstream homologous arms of the ugd gene and the purification and recovery of the products, the fusion PCR method is used to make the upstream and downstream homologous arms perform base complementary pairing through the common 15bp sequence and then amplify the fusion fragment; after the above PCR reaction is completed, the upstream homologous arm primer up-F and the downstream homologous arm primer Down-R are added to the PCR tube to continue amplifying the fusion fragment; after the PCR amplification of the upstream and downstream homologous arm fusion fragments is completed, the PCR product is gel recovered; 5) Construction of Δugd-pK18mobsacB knockout plasmid The upstream and downstream homology arm fusion fragment gel recovery products were double-digested with the pK18mobsacB plasmid using restriction endonucleases EcoR I and Hind III, and the gel containing the target fragment was cut out and then gel-recovered; 6) Ligation reaction Use T4 DNA ligase to connect the double-digested plasmid and the purified and recovered products of the fusion fragment; 7) Transformation of Δugd-pK18mobsacB recombinant plasmid The above ligation solution was added to WM3064 E. coli competent cells, and the bacterial solution was spread on LB solid plates containing kanamycin and DAP in a clean bench, and cultured in a constant temperature incubator at 37°C for 12 hours; 8) Verification of Δugd-pK18mobsacB recombinant plasmid Use the fusion fragment amplification primers Up-F / Down-R to perform colony PCR, and after the PCR amplification is completed, perform gel electrophoresis to detect whether the target band is contained to screen positive clones; perform double enzyme digestion verification on the positive clones screened by colony PCR, and perform gel electrophoresis to detect the enzyme digestion products. After verifying that the bands are correct, purify and recover the enzyme digestion products and send them for sequencing. After the sequencing is correct, save the strains containing the recombinant plasmid; 9) Construction and screening of ugd gene deletion mutants: Activate the Aeromonas dakar C160501 strain and the WM3064 Escherichia coli strain containing the recombinant plasmid Δugd-pK18mobsacB stored in a -80°C refrigerator, co-culture the obtained WM3064 Escherichia coli strain containing the recombinant plasmid Δugd-pK18mobsacB with the Aeromonas dakar C160501 strain, and transfer the recombinant plasmid from the Escherichia coli cells to the Aeromonas dakar C160501 strain by conjugation transfer during this period; extract the single colony on the plate, use the PK18-F / PK18-R primers designed according to the recombinant plasmid sequence as a template to perform colony PCR, detect positive clones, and after verifying that the band is correct, purify and recover the PCR product and send it for sequencing, and after the sequencing result is correct, store the positive clone strain in a -80°C ultra-low temperature refrigerator; Colony PCR was performed using primers Δugd-F / Δugd-R designed based on the gene sequences outside the upstream and downstream homologous arms of the ugd gene to screen positive clones. After colony PCR verification was correct, the PCR products were purified and recovered and sent for sequencing. After the sequencing results were correct, the positive clone strains were stored in a -80°C ultra-low temperature refrigerator to obtain the ugd gene deletion mutant strain of Aeromonas dakar.

4. A method for constructing the Aeromonas dakar ugd and phoB gene double deletion mutant or its complemented strain according to claim 2, It is characterized in that The following steps are involved: (1) Design and synthesize the following primers: Up-F-SacI: AC GAGCTC TTGGCAACGGTCATCCCAATAT Up-R: CAACATAAGTGCCTCATCCCTTCTCTCTCCTCTGTGAA Down-F: GAGGCACTTATGTTGCAACCATAC Down-R-XbaI: AC TCTAGA TGCACCATGAACTCGATCTGG pRE112-F: GTGCGCAACAACCGTCTTC pRE112-R: CCTGGTTGCTACGCCTGAATA ΔphoB identification-F: TTGGCAACGGTCATCCCAATAT ΔphoB identification-R: TCATCCTGCACCGCAAACAG phoB-F: ATGGCTAAGCGAATTCTGGTG phoB-R: TTAGAGACGGGTTGAGAAGCG phoB bridge-F: ACACAGGAAACAGCTATGGCTAAGCGAATTCTGGTG phoB bridge-R: ACAAAATATTAACGCTTAGAGACGGGTTGAGAAGCG pBBR1MCS-2Δ(lacZα)-F: AGCTGTTTCCTGTGTGAAATTG pBBR1MCS-2Δ(lacZα)-R: GCGTTAATATTTTGTTAAAATTCGCG pBBR1MCS-2 Identification-F: TATTTAACGACCCTGCCCTG pBBR1MCS-2 Identification-R: ATCTCATGCTGGAGTTCTTCG (2) Construction of ΔugdΔphoB knockout strain 1) Amplification and fusion of upstream and downstream homology arms of phoB gene The upstream homology arm forward and reverse primers Up-F-SacI and Up-R or the downstream homology arm forward and reverse primers Down-F and Down-R-XbaI were used as templates, and PCR amplification was performed followed by electrophoresis purification and recovery to obtain the upstream and downstream homology arms; 2) Fusion of upstream and downstream homology arms of phoB gene The purified and recovered upstream and downstream homology arm fragments were used as templates for fusion PCR experiments; then primers Up-F-SacI / Down-R-XbaI were added for bridge construction; after PCR amplification, the gel was recovered to obtain the fusion fragment; 3) Double digestion of plasmid and fusion fragment The pRE112 plasmid and the fusion fragment gel recovery products were double-digested with SacI and XbaI restriction endonucleases, respectively, and the temperature was adjusted to 37°C in a thermostatic metal bath. After 2 hours of reaction, gel recovery was performed; 4) Plasmid and fusion fragment ligation The double-digested pRE112 plasmid and fusion fragment product recovered from the gel were ligated using T4 DNA ligase, and the reaction was carried out in a 16°C water bath overnight; 5) Preparation and transformation of competent cells Place the prepared competent cells and ligation solution on ice, add the ligation solution and the competent cells and mix well, and place the mixture on ice for 30 minutes; heat shock at 42°C for one and a half minutes and place on ice for 3 minutes; then add 900 μL of LB liquid culture medium containing 50 μg / mL DAP, and culture at 37°C, 180 rpm for 2 hours in a constant temperature shaking culture; spread the bacterial solution on the LB solid plate containing CAP and DAP, and culture it in a constant temperature incubator at 37°C overnight; 6) Verification of ΔphoB-pRE112 recombinant plasmid Pick a single colony in the clean bench, use the primers pRE112-F / pRE112-R on the pRE112 plasmid to perform colony PCR, and use gel electrophoresis to verify whether the target band is contained to screen positive clones; inoculate the verified positive clones into the LB liquid culture medium of DAP and CAP, extract the plasmid after overnight culture, double enzyme digestion for secondary verification, and purify and recover after verifying that the band is correct, and send it for sequencing. If the sequencing is correct, the strain will be stored at 80°C; 7) Construction of the ΔugdΔphoB double mutant Combined transfer experiment: Take out WM3064 E. coli and Δugd knockout strain containing ΔphoB-pRE112 recombinant plasmid from -80℃ ultra-low temperature refrigerator, streak the E. coli on LB solid plate containing 50μg / mL DAP, pick a single colony, inoculate it in LB liquid culture medium at 37℃, 180rpm overnight culture, mix it in the ratio of 1:3, 5:1, 10:1, let it stand for 1h, then spot the bacterial liquid in the center of the antibiotic-free LB solid plate and culture it for 24h, scrape the bacteria on the plate; dilute it 10 times, 20 times, and 100 times respectively, and then spread it on the LB solid plate containing chloramphenicol but not DAP for overnight culture, pick a single colony, and use the primers pRE112-F / pRE112-R on the pRE112 plasmid for colony PCR; Screening of mutant strains: The verified Δugd Aeromonas dakar containing the recombinant plasmid ΔphoB-pRE112 was inoculated into LB liquid medium containing CAP for overnight culture, and fresh LB liquid medium was used to make 10, 50, and 100-fold gradient dilutions and then spread on a plate containing 20% ​​sucrose, and cultured in a constant temperature shaking incubator at 37°C overnight; a single colony was picked, and the primers ΔphoB identification-F / ΔphoB identification-R designed on the genome outside the phoB homology arm were used for colony PCR verification, and the verified ΔugdΔphoB mutant strain was sequenced. If the sequencing was correct, the strain was expanded and cultured and stored at -80°C to obtain the ΔugdΔphoB double mutant strain; (3) Construction of the ΔugdΔphoB+CphoB complementation strain 1) Amplification of phoB gene Using the genome of wild strain C160501 as a template, the upstream and downstream primers phoB-F / R of phoB were designed to amplify the phoB gene fragment. The product purified by gel electrophoresis after amplification was used as a template, and primers phoB bridge-F / R were added to perform PCR amplification. 2) Linearized cloning vector The pBBRMCS-2 plasmid was linearized by single restriction enzyme digestion with SacI, purified by gel electrophoresis, and amplified with primers pBBR1 MCS-2Δ(lacZα)-F / R using the single restriction enzyme digestion pBBRMCS-2 plasmid as a template, and then purified and recovered; 3) Seamless cloning Use a pipette to add the sample as follows on ice at 4°C, gently pipette to mix, centrifuge briefly, place in a 50°C water bath for 10 min, and then immediately place on ice; 4) Transformation of recombinant fluid and identification of complementing plasmid Take 10 μL of the ligation solution and add it to 100 uL of WM3064 E. coli competent cells. After ice bathing for 30 minutes and incubating at 42°C for 90 seconds, immediately place it on ice for 3 minutes, add LB medium containing DAP and culture on a shaker for 1.5 hours, spread it on a solid LB plate with DAP and kanamycin, and use pBBR1MCS-2 identification-F / R primer colony PCR for verification after 12-16 hours. The amplification system is as shown in the table below. After the colony PCR verification is correct, extract the plasmid and use pBBR1MCS-2 identification-F / R as primers for verification. If the band is correct, send the PCR product for sequencing, and store the remaining bacterial solution in a 30% glycerol tube; 5) Screening of complement strains The ΔugdΔphoB double mutant strain and WM3064 Escherichia coli containing the complementing plasmid were combined using the same method as the above-mentioned conjugation of the ΔugdΔphoB mutant strain. The conjugated colonies were then scraped off, washed twice with LB liquid, diluted 1000 times, and 50 μL was spread on an LB solid plate containing 50 μg / mL kanamycin and ampicillin. After incubation at 37°C, a single colony was picked, and primers pBBR1MCS-2 identification-F / R and phoB primers phoB-F / R were added for colony PCR. After electrophoresis verification, it was inoculated into LB liquid culture medium for overnight culture, the plasmid was extracted, and PCR amplification was performed with primers pBBR1MCS-2 identification-F / R. The electrophoresis product was sent for sequencing, and the remaining bacterial liquid was preserved with 30% glycerol to obtain the complementing strain ΔugdΔphoB+CphoB.

5. Use of the Aeromonas dakar ugd gene deletion mutant according to claim 1 in the preparation of a drug for treating or preventing a disease caused by Aeromonas dakar infection.

6. Use of the Aeromonas dakar ugd and phoB gene double deletion mutant or its complemented strain according to claim 2 in the preparation of a drug for treating or preventing diseases caused by Aeromonas dakar infection.

7. The use according to claim 5 or 6, It is characterized in that The medicine is a vaccine.

Images