A method for increasing anthocyanin content in peanuts using gene editing

Abstract

The present invention discloses a method for increasing the anthocyanin content of peanuts by gene editing, which belongs to the field of genetic engineering technology. The method for increasing the anthocyanin content of peanuts by gene editing comprises the steps of editing the CD1PG8 gene in peanut materials by using the CRISPR-Cas9 gene editing system to obtain a peanut material with a high anthocyanin content. The present invention creates a peanut gene editing material with a CD1PG8 gene mutation by gene editing technology, and the anthocyanin content is significantly increased, thereby cultivating a gene-edited plant variety with a high anthocyanin content, which is of great significance for cultivating a new peanut variety with a high added value and a high anthocyanin content.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a method for increasing the anthocyanin content of peanuts by utilizing gene editing. Background Art

[0002] Peanut is one of the most important oil and cash crops in the world, and is an important source of protein, vegetable oils and other nutrients for humans. my country is the country with the highest annual peanut production in the world. Among my country's oil crops, the planting area of ​​peanuts is second only to rapeseed and soybeans, but the output ranks first. Therefore, peanut production is of great strategic significance to ensuring my country's grain and oil security. Peanut seed coat color is an important quality trait of peanuts. Compared with traditional pink peanuts, dark peanuts such as black peanuts contain more anthocyanins in the seed coat, which has multiple functions such as inhibiting superoxide free radicals and anti-oxidation. Although the unit price of black seed peanuts is often several times that of ordinary peanuts, consumer demand is strong and the market potential is huge. However, the existing black seed peanut varieties generally have low yields and poor resistance, making them difficult to promote on a large scale. Therefore, creating black seed peanut varieties with excellent quality and large yield is the fundamental way to meet market demand.

[0003] The type, content and distribution of anthocyanins in peanut seed coat determine the differences in seed coat color traits (Li Haifen, Qiu Jinmei, Chen Xiaoping et al. Expression of genes related to peanut anthocyanin synthesis and its relationship with seed coat color [J]. Chinese Journal of Oil Crops, 2017, 39(5):6.). Anthocyanins are a class of water-soluble natural pigments widely found in plants and belong to flavonoid compounds. The metabolic pathway of anthocyanin biosynthesis is very conserved in plants and starts from phenylalanine metabolism.The main process is as follows: ① Phenylalanine is converted into cinnamic acid by the action of phenylalanine ammonialyase (PAL); ② Cinnamic acid is converted into coumaric acid by the action of cinnamate 4-hydroxylase (C4H); ③ Coumaric acid combines with coenzyme A under the action of 4-coumaryl CoA ligase (4CL) to generate 4-coumaryl CoA; ④ 4-coumaryl CoA and three malonyl CoAs generate chalcone by the action of chalcone synthase (CHS); ⑤ Chalcone is converted into naringenin by chalcone isomerase (CHI); ⑥ Naringenin is converted into naringenin by flavanone 3-hydroxylase (Flavanone ⑦ Dihydroflavonol is converted into dihydroquercetin under the catalysis of flavonoid 3'-hydroxylase (F3'H), or into dihydroquercetin under the catalysis of flavonoid 3'-hydroxylase (F3'H). ⑧ Dihydroflavonol, dihydromyricetin and dihydroquercetin are converted into three colorless anthocyanidin aglycones, namely colorless pelargonidin, colorless delphinidin and colorless cyanidin, by dihydroxyflavonol reductase (dihydroflavonol4-reductase, DFR); ⑨ Colorless anthocyanidin aglycones are converted into anthocyanidin aglycones by anthocyanidin synthase (anthocyaninsynthase, ANS); ⑩ Anthocyanidin aglycones are converted into sugar groups by glycosyltransferases such as UDP-Glc:flavonoid-3-O-glucosyltransferase (UFGT), and methyltransferase (MT) and acyltransferase (acyltransferase) are involved in the conversion of anthocyanidin aglycones. Transferase, AT) and other enzymes to form anthocyanins with stable properties and various colors (Winkel-Shirley B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology [J]. Plant physiology, 2001, 126 (2): 485-93.).

[0004] Like many other plants, the seed coat of peanuts is also developed from the integuments, and the color of the seed coat is determined by the maternal genotype. Compared with other traits, the seed coat color can only appear in alternate generations. For example, when the pink seed coat is used as the female parent and the black peanut parent is hybridized, the F1 seed coat is pink, the F2 seed coat is light black (intermediate between the parents), and the F3 seed coat shows trait separation. This characteristic greatly limits the cultivation of black seed coat peanut varieties by traditional breeding methods. Therefore, providing a method for creating high anthocyanin content peanut materials using gene editing technology is an urgent problem that technicians in this field need to solve. However, there are no reports on using CRISPR-Cas9 technology to increase the anthocyanin content of peanuts and innovate germplasm.

[0005] In view of the above shortcomings, the present invention discloses a pair of sgRNAs targeting the peanut CD1PG8 gene. The anthocyanin content of peanut gene-edited materials with CD1PG8 gene mutations created by gene editing technology is significantly improved, thereby cultivating gene-edited plant varieties with high anthocyanin content, which is of great significance for cultivating new high-value-added peanut varieties with high anthocyanin content. Summary of the invention

[0006] In order to solve the above technical problems, the present invention proposes a method for increasing the anthocyanin content of peanuts by gene editing. The anthocyanin content of peanut gene-edited materials with CD1PG8 gene mutations created by gene editing technology is significantly increased, and then gene-edited plant varieties with high anthocyanin content are cultivated, which is of great significance for cultivating new high-value-added peanut varieties with high anthocyanin content.

[0007] To achieve the above objectives, the present invention provides a method for increasing the anthocyanin content of peanuts by gene editing, comprising the steps of editing the CD1PG8 gene in peanut materials by using the CRISPR-Cas9 gene editing system to obtain peanut materials with high anthocyanin content.

[0008] Preferably, the specific steps are as follows:

[0009] (1) sgRNA target design: Two sgRNA targets were designed based on the CD1PG8 gene sequence shown in SEQ ID NO.5. The target sequence of sgRNA1 is shown in SEQ ID NO.3, and the target sequence of sgRNA2 is shown in SEQ ID NO.4;

[0010] (2) Construction of CRISPR / Cas9 recombinant plasmid: adding linker ATTG to the sequence shown in SEQ ID NO.3, adding linker AAAC to the sequence shown in SEQ ID NO.4, annealing to form a double-stranded target, connecting with AtU6-26-sgRNA-SK plasmid for transformation, and obtaining expression cassettes of sgRNA1 target and sgRNA2 target after double restriction digestion with Nhe I and Spe I; linking the expression cassettes of sgRNA1 target and sgRNA2 target with CRISPR / Cas9 vector to obtain CRISPR / Cas9 recombinant plasmid;

[0011] (3) The CRISPR / Cas9 recombinant plasmid is transferred into Agrobacterium to infect peanut materials, and peanut materials lacking CD1PG8 gene function and without exogenous gene insertion are obtained through screening and verification, thereby obtaining peanut materials with high anthocyanin content.

[0012] Preferably, in step (2), the annealing reaction system of the double-stranded target is: 10 μM forward primer, 10 μL reverse primer each, added with 80 μL 0.5×TE buffer; the forward primer is the sequence shown in SEQ ID NO.3 plus the linker ATTG; the reverse primer is the sequence shown in SEQ ID NO.4 plus the linker AAAC.

[0013] Preferably, in step (2), the annealing reaction procedure of the double-stranded target is: heating at 98° C. for 3 min and then naturally cooling to room temperature.

[0014] Preferably, in step (2), the expression cassettes of the sgRNA1 target site and the sgRNA2 target site are connected to the CRISPR / Cas9 vector using T4 DNA ligase to obtain a CRISPR / Cas9 recombinant plasmid.

[0015] Preferably, the T4 DNA ligase ligation system is: 1 μL of 10×T4 DNA ligase buffer, 40 ng of pCAMBIA1300-pYAO:Cas9 plasmid after enzyme digestion, 10 ng of sgRNA cassette, 0.2 μL of T4 DNA ligase, and water is added to make up to 10 μL. The reaction procedure is: ligation at room temperature for 25 min.

[0016] The present invention also provides a pair of sgRNAs targeting the peanut CD1PG8 gene, wherein the sgRNAs include sgRNA1 and sgRNA2, wherein the nucleotide sequence of the sgRNA1 is shown in SEQ ID NO.1, and the nucleotide sequence of the sgRNA2 is shown in SEQ ID NO.2.

[0017] Preferably, the sgRNA1 recognizes positions 16 to 35 of the CD1PG8 gene, the sgRNA2 recognizes positions 82 to 101 of the CD1PG8 gene, the target sequence of the sgRNA1 is shown in SEQ ID NO.3, the target sequence of the sgRNA2 is shown in SEQ ID NO.4, and the nucleotide sequence of the CD1PG8 gene is shown in SEQ ID NO.5.

[0018] The present invention also provides the use of the sgRNA in peanut breeding.

[0019] The present invention also provides the use of the sgRNA in obtaining peanut materials with high anthocyanin content.

[0020] Compared with the prior art, the present invention has the following advantages and technical effects:

[0021] The present invention has found that the anthocyanin content of peanut gene-edited materials with CD1PG8 gene mutations created by gene editing technology is significantly increased, thereby cultivating gene-edited plant varieties with high anthocyanin content. Experiments show that a pair of sgRNAs designed by CRISPR-Cas9 technology based on the specific target DNA sequence of CD1PG8 described in the present invention mediate the specific recognition and targeted cutting of the target site by Cas9 nuclease, and introduce mutations using the intracellular error-prone repair mechanism, resulting in CD1PG8 gene mutations in gene-edited peanuts, which can increase the anthocyanin content of gene-edited peanuts. It shows that through gene editing technology, the CD1PG8 gene can be used to rapidly and directional genetically improve the anthocyanin content of rice. The invention uses modern genetic engineering methods to artificially control the accumulation level of anthocyanins, which is of great significance for accelerating the cultivation of high-quality and high-yield new varieties of peanuts with high anthocyanin content and improving the economic benefits of the peanut industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The expression of candidate R2R3-MYB genes in peanut varieties with different anthocyanin contents, where A is the Arahy.J3K16K gene, B is the Arahy.CD1PG8 gene, YH29 and ZH9 in A and B are varieties with high anthocyanin contents, and WH10, ZH8 and DF12 are varieties with low anthocyanin contents;

[0024] Figure 2The phenotypes and anthocyanin content determination results of heterologously expressing JK, CJ and C8 in tobacco, wherein A is the phenotypic result, B is the anthocyanin content determination result, in A and B, JK is the JK gene overexpression plant, CJ is the JK and C8 gene overexpression plant, C8 is the C8 gene overexpression plant, and WT is the normal control plant;

[0025] Figure 3 Selection of editing sites for the CD1PG8 gene;

[0026] Figure 4 Schematic diagram for constructing gene editing vectors;

[0027] Figure 5 is an agarose gel image of the PCR product;

[0028] Figure 6 The control (WH10) and the harvested T2 generation high anthocyanin content peanut new material (WH10+CrisprC8). DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Varieties and sources of peanuts used in the embodiments of the present invention: germplasm resources such as Weihua No. 10 (WH10), Yuhua No. 29 (YH29), GT-C20, Zhonghua No. 8 (ZH8), Zhonghua No. 9 (ZH9) and Fenghua No. 1 (HF001) are all preserved for a long time by the Shandong Academy of Agricultural Sciences and are planted and propagated in the unit test base every year.

[0035] Example 1

[0036] Construction of CRISPR-Cas9 recombinant plasmid

[0037] 1. sgRNA target design

[0038] In order to identify the key genes controlling the anthocyanin content of peanuts, four segregating populations KF1 (WH10×YH29), KF (2GT-C20×YH29), ZH (ZH8×ZH9), and HF (HF001×YH29) were constructed by hybridizing pink seed coat peanut varieties (female parents) with high anthocyanin black seed coat peanut varieties (male parents). The whole genome of the high anthocyanin extreme material mixed pool, low anthocyanin extreme material mixed pool, male parent Yuhua 29, and female parent Weihua 10 in the KF1 population were resequenced using the BSA-seq method. The total sequencing volume was 260Gb, and a total of 640,758 SNP sites were detected between the parents, covering 20 chromosomes of peanuts. After bioinformatics analysis, 1798 candidate SNP sites that may be associated with the anthocyanin content of peanuts were screened, of which 1317 (73.29%) SNPs were located on chromosome 10; on the peanut chromosome A10, the candidate SNP sites were mainly located in three regions, of which about 1 / 3 of the associated SNP sites were located in the region of A10: 108.0-112.7Mb. In addition, BSR-seq analysis was performed on the other three segregating populations, and the results showed that the candidate interval located on chromosome 10 was closely linked to the black seed coat color trait of peanuts.

[0039] According to the functional annotation of the peanut genome, two R2R3-MYB transcription factor genes were found in the candidate interval, namely J3K16K (JK) and CD1PG8 (C8).

[0040] Nucleotide sequence of the J3K16K gene (SEQ ID NO.6): ATGGAGGGATCCATAGGCCTAAGAAA AGGTGCATGGGCTAAGGTGGAAGATGACCTTCTAAGAGCTTGTGTTGAACAATATGGAGAAGGAAAGTGGCACCTAGTTCCTTCTAGAGCGGGGTTGAACAGATGCCGCAAAAGTTGTAGACTGAGATGGTTGAATTATCTGAAACCAAATATAAAGCGTGGAGAGTTCTCTGAAGATGAAGTTGATCTCATGATTAGAATGCACAGACTTTTGGGAAACAGATGGTCCTTAATTGCTGGAAGACTTCCGGGAAGAACGCCAAACGATGTGAAGAATTACTGGAACACCTATGTTCGAAGGAATAATAAGCACACTTCATCATCATCATCAGTACCCTCTCCTTCATCAGTGGTGACGACAGTGAAACGTCATGACCATATTAATCATCAGGTAATAAAACCTCATCCCCGAACTTTCTCGAAAGCATCGCCATGGTTATTATTAAAGAAAACATCTACAAGTGGTTATCATAATAATAACAAGCAGAGGGATGGGGCCAAGGCAGAAGAAGAGTGCACCGATAATAATAATAATAATAATGATAATAATGGTTCTGGTGGTGGATGTGATGATGGGAACACGTGTCGGAACAAGAACGGTGGCAAAGGGGATGAAGAGAAGTTGAACGACGGGTGCTTACTCTCAGTCTCAGGTGCTGAGGAAGAAGAAGAAGAAGACTGGAAGCTGCTTTTACCTGACTTCAATTGGGATGCTCATAATGATGATCACTTCTTGAAGGACGCTTCTGATGCTGACCACGATATGCTTATTAATGTCCATGGTCAAACTTGGAGTGATATCCTTCTTGATATCAATTTGTGGGATCCACAATAA。

[0041]

[0042] Note: The shaded sequences are the target sequences of sgRNA1 and sgRNA2 respectively.

[0043] like Figure 1 As shown, RNA-seq analysis showed that the expression level of JK in peanut varieties with high anthocyanin content was significantly higher than that in peanut varieties with low anthocyanin content, while the opposite was true for C8. The expression level of C8 in peanut varieties with low anthocyanin content was significantly higher than that in peanut varieties with high anthocyanin content, indicating that JK may be a gene that positively regulates anthocyanin synthesis, while C8 may be a gene that negatively regulates anthocyanin synthesis.

[0044] like Figure 2 As shown, to verify the function of the candidate gene, expression vectors for overexpressing JK, overexpressing C8, and overexpressing JK and C8 (CJ, i.e., C8+JK) were constructed, and tobacco was transformed into heterologous cells. Expression analysis showed that overexpressing the JK gene alone could significantly increase the anthocyanin content of tobacco; at the same time, CJ could also increase the anthocyanin content of tobacco, but the increase was significantly lower than that of overexpressing the JK gene alone; while expressing the C8 gene alone could not increase the anthocyanin content of tobacco. The above research results confirmed that the JK gene is a gene that positively regulates anthocyanin synthesis, and the C8 gene is a gene that negatively regulates anthocyanin synthesis.

[0045] 2. gRNA target selection

[0046] Peanut CD1PG8 was used as the target gene, and the target sites were screened using the online software CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISP R2 / ), and the target sites sgRNA1 and sgRNA2 (such as Figure 3 shown).

[0047] The nucleotide sequence of sgRNA1 is: ACGACGCUGUUUCAACCGAA (SEQ ID NO. 1); the nucleotide sequence of sgRNA2 is: AUGUAACUUCUUGUACCGGU (SEQ ID NO. 2).

[0048] The nucleotide sequence of the sgRNA1 target site is: TGCTGCGACAAAGTTGGCTT (SEQ ID NO. 3); the nucleotide sequence of the sgRNA2 target site is: TACATTGAAGAACATGGCCA (SEQ ID NO. 4).

[0049] 3. Construction of sgRNA cassette

[0050] The forward and reverse primers shown in SEQ ID NO.3 and SEQ ID NO.4 were each added with linkers ATTG and AAAC; a double-stranded target was formed by annealing reaction; the AtU6-26-sgRNA-SK plasmid was digested with restriction endonuclease Bsa I, and connected with the double-stranded target to obtain a recombinant plasmid. The recombinant plasmid was double-digested with specific restriction endonucleases Nhe I and Spe I and then recovered by gel cutting. The gel-recovered fragments were 642 bp (sgRNA1 cassette) and 642 bp (sgRNA2 cassette).

[0051] The annealing reaction system of the double-stranded target was as follows: 10 μl of each 10 μM primer was added to 80 μl of 0.5×TE buffer (pH 8.0). The reaction procedure was as follows: heating at 98°C for 3 min and then naturally cooling to room temperature. The target and plasmid connection reaction system was as follows: 1 μl of 10×T4 DNA ligase buffer, 40 ng of AtU626 sgRNA SK vector after enzyme digestion, 1 μl of the annealed double-stranded target, 0.2 μl of T4 DNA ligase, and water was added to make up to 10 μl. The reaction procedure was as follows: connection at room temperature for 25 min.

[0052] 4. Ligate sgRNA1 cassette and sgRNA2 cassette into pCAMBIA1300-pYAO:Cas9 vector

[0053] Reaction system: 1 μL of 10×T4 DNA ligase buffer, 40 ng of pCAMBIA1300-pYAO:Cas9 plasmid after enzyme digestion, 10 ng of sgRNA cassette, 0.2 μL of T4 DNA ligase, and add water to make up to 10 μL.

[0054] PCR reaction program: connect at room temperature for 25 minutes.

[0055] Use T4 DNA ligase to ligate the sgRNA1 and sgRNA2 expression cassettes into the Bsa I site of the pCAMBIA1300-pYAO:Cas9 vector. The recombinant plasmid construction map is shown in Figure 4 shown.

[0056] Example 2

[0057] Gene editing to obtain peanut materials

[0058] 1. Transformation of Ligation Products

[0059] The ligation product was transferred into competent E. coli DH5α by heat shock method, and the specific method was as follows: take a DH5α competent cell with a total volume of 100 μL and put it on ice until it melted; add 10 μL of the ligation product, gently blow and mix, and let it stand on ice for 20 minutes; then heat shock at 42°C for 45 seconds and then immediately let it stand on ice for 2 minutes; add 600 μL of LB liquid culture medium to the competent E. coli, and culture it at 200 r / min and 37°C for 1 hour; after the culture is completed, centrifuge at 5000 r / min for 4 minutes, discard 500 μL of supernatant and resuspend the bacterial solution, aspirate 50 pL of the bacterial solution and spread it on a solid LB culture medium containing kanamycin (50 mg / mL) until the monoclonal colony is 1-2 mm; pick a single colony and expand it in liquid LB culture medium containing kanamycin (50 mg / mL) for sequencing and identification.

[0060] The nucleotide sequences of the primers used for PCR identification are:

[0061] 1300-gRNA-F:5'-CCAGTCACGACGTTGTAAAAC-3' (SEQ ID NO.7);

[0062] 1300-gRNA-R: 5'-CAATGAATTTCCCATCGTCGAG-3' (SEQ ID NO. 8).

[0063] High-fidelity Taq enzyme was used for PCR amplification reaction. The PCR reaction amplification system was shown in Table 1, and the amplification program was shown in Table 2.

[0064] Table 1 PCR reaction amplification system

[0065]

[0066] Table 2 Amplification procedures

[0067]

[0068] The results of agarose gel detection of PCR products are shown in Figure 5 As shown, the target fragment is about 1400 bp in length and the band position is correct. The bacterial solution with the correct band is sequenced and verified, and the positive monoclonal clone with the correct sequence is selected.

[0069] 2. Acquisition of peanut materials and identification of positive plants

[0070] The positive clones were selected and the plasmids were extracted and transferred into Agrobacterium tumefaciens LBA4404, inoculated into 50 mL YEP liquid medium (containing 50 μg / mL kanamycin and 40 μg / mL rifampicin), and cultured overnight at 28°C until OD 600About 0.5-0.6; centrifuge the bacterial solution at 4°C and 5000rpm for 10min, discard the YEP medium, add 50mL MS medium to resuspend the bacteria, and add acetosyringone (AS) 30min before injection to induce transformation, with a final concentration of 100μM. Sow the plump and undamaged WH10 double seeds in the hybridization pool with a spacing of 25cm, and select 15 plants with good growth as transformation recipients. Before the flowering period of peanuts, flowers are manually removed to prevent needles from setting fruits. After the flowering period, the infection solution is injected at 7 am every morning (as early as possible to ensure that it is before self-pollination). The target fragment is transformed into peanuts by calyx tube injection. Use a 1mL disposable syringe to inhale an appropriate amount of Agrobacterium infection solution, select the flowers that are open on the same day, pierce the needle obliquely into the upper part of the calyx tube, and inject downward. During the slow injection process, it can be observed that the liquid level moves down along the calyx tube to the base of the ovary, pull out the syringe, and the injection of one flower is completed. After 30 consecutive days of injection (if the injection cannot be performed due to weather or other reasons, pay attention to manual flower removal on the same day), the flowers are manually removed every day until the flowering period ends. The T0 generation of transgenic peanuts is obtained.

[0071] 3. Observation of transgenic peanut phenotype

[0072] The genetically transformed T0 generation peanut seeds are taken to continue planting the T1 generation, and after planting, the T2 generation seeds are harvested.

[0073] like Figure 6 As shown, the genetically transformed peanut seeds were used to plant the T1 generation, and then the T2 generation seeds were harvested. The seed coat color of the T2 generation positive seeds turned into dark purple, and the anthocyanin content was significantly increased.

[0074] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for increasing the anthocyanin content of peanuts by gene editing, characterized in that: The method includes the steps of using the CRISPR-Cas9 gene editing system to edit the CD1PG8 gene in the peanut material to obtain a peanut material with a high anthocyanin content; The nucleotide sequence of the CD1PG8 gene is shown in SEQ ID NO.5; The specific steps are as follows: (1) sgRNA target design: Two sgRNA targets were designed based on the CD1PG8 gene sequence shown in SEQ ID NO.

5. The target sequence of sgRNA1 is shown in SEQ ID NO.3, and the target sequence of sgRNA2 is shown in SEQ ID NO.4; (2) Construction of CRISPR / Cas9 recombinant plasmid: adding linkers ATTG and AAAC to the forward primer shown in SEQ ID NO.3 or SEQ ID NO.4 and the reverse primer complementary thereto, annealing to form a double-stranded target, connecting with AtU6-26-sgRNA-SK plasmid for transformation, and obtaining expression cassettes of sgRNA1 target and sgRNA2 target after double restriction digestion with Nhe I and Spe I; connecting the expression cassettes of sgRNA1 target and sgRNA2 target to the CRISPR / Cas9 vector to obtain a CRISPR / Cas9 recombinant plasmid; (3) The CRISPR / Cas9 recombinant plasmid is transferred into Agrobacterium, which is used to infect peanut materials to obtain peanut materials lacking CD1PG8 gene function and without foreign gene insertion, thereby obtaining peanut materials with high anthocyanin content.

2. The method according to claim 1, characterized in that In step (2), the annealing reaction system of the double-stranded target is: 10 μM forward primer, 10 μL reverse primer, each, and 80 μL 0.5×TE buffer.

3. The method according to claim 1, characterized in that In step (2), the annealing reaction procedure of the double-stranded target is: heating at 98°C for 3 minutes and then naturally cooling to room temperature.

4. The method according to claim 1, characterized in that In step (2), the expression cassette of the sgRNA1 target site and the expression cassette of the sgRNA2 target site are connected to the CRISPR / Cas9 vector using T4 DNA ligase to obtain a CRISPR / Cas9 recombinant plasmid.

Images