A set of plasma exosome tsrna markers related to liver cancer and application thereof
Patent Information
- Application Number
- CN202311832394.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-28
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2043-12-28
AI Technical Summary
[0029] The advantages of plasma exosomal tsRNAs provided by this invention as biomarkers for the diagnosis of liver cancer are as follows:
Smart Images

Figure CN117568481B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular biology, and relates to a group of plasma exosome tsRNAs markers related to liver cancer and application thereof. BACKGROUND
[0002] Liver cancer is one of the main causes of death from malignant tumors in the world and in China, more than 90% of which are hepatocellular carcinoma. The latest tumor data report shows that the incidence of liver cancer in China is still high, and liver cancer has become a major public disease endangering the health of the nation.
[0003] Exosomes are microvesicles with a membrane structure, about 50-150 nm in diameter, which are secreted by cells, and their contents include proteins, lipids and nucleic acids and other biological active ingredients, and are involved in mediating long-range communication between cells in the body. A large number of tumor-specific exosomes are secreted in the blood of tumor patients, and an assessment of the tumor progression of the patient can be made by capturing these exosomes. At the same time, one of the key technical principles of the mainstream liquid biopsy in the field of early screening of tumors is to detect the expression of tumor-related exosomes for early diagnosis of tumors.
[0004] Non-coding RNA is a key component of the contents of exosomes and is also a hot spot in the field of tumor molecular biology in recent years. The development of RNA high-throughput sequencing technology has made it possible to sequence structured RNA, so researchers have a more clear and clear understanding of the types and expression levels of non-coding small RNA. One of the small RNAs derived from tRNA (tRNA-drived small RNAs, tsRNAs) is about 18-40 nt long, derived from tRNA mature or precursor, involved in the regulation of various physiological and pathological functions, closely related to tumor occurrence and development, and it has been reported that tsRNAs are abnormally expressed in various tumor patients such as lung cancer, breast cancer and ovarian cancer. This suggests that tsRNAs have the potential to become tumor diagnostic markers.
[0005] There is a close relationship between the expression of tsRNAs and liver cancer, and tsRNAs have abnormal expression profiles in liver cancer patients, liver cancer cell lines and liver cancer animal models, and participate in the occurrence and development of liver cancer through various pathways. Compared with conventional tumor diagnosis methods, exosome tsRNAs detection has the advantages of simple sampling and low detection cost, and has broad development and application prospects in tumor diagnosis biomarkers. If the plasma exosome tsRNAs abnormally expressed in liver cancer can be screened as biomarkers, and the corresponding diagnostic reagents and kits are developed, the diagnosis of liver cancer will be greatly promoted. SUMMARY
[0006] The main objective of this invention is to address the problems encountered in the non-invasive clinical diagnosis of liver cancer by proposing a set of plasma exosomal tsRNAs markers related to liver cancer, and the application of these plasma tsRNAs markers in the preparation of liver cancer diagnostic reagents and kits.
[0007] To achieve the above objectives, the present invention provides a set of plasma exosomal tsRNAs markers associated with liver cancer, wherein the plasma exosomal tsRNAs markers are any one or a combination of the following sequences:
[0008] tRF5-Ser-AGA-1-1-030: The sequence is shown in SEQ ID No. 1;
[0009] tRF5-Val-CAC-3-1-019: The sequence is shown in SEQ ID No. 2;
[0010] tRF5-Val-TAC-1-1-029: The sequence is shown in SEQ ID No. 3;
[0011] tRF5-Val-CAC-3-1-030: The sequence is shown in SEQ ID No. 4;
[0012] tRF5-iMet-CAT-1-1-030: The sequence is shown in SEQ ID No. 5.
[0013] This invention also provides applications of reagents for detecting the above-mentioned tsRNA biomarkers, including any of the following applications:
[0014] (1) Application in the preparation of products for early screening or auxiliary screening of liver cancer;
[0015] (2) Applications in the preparation of products for early diagnosis or auxiliary diagnosis of liver cancer;
[0016] (3) Application in the preparation of products for assessing the risk of liver cancer in patients;
[0017] (4) Application in the preparation of products for assessing the prognostic effects of liver cancer patients;
[0018] (5) Application in the preparation of products for predicting the efficacy of drugs for treating liver cancer.
[0019] A further technical solution is provided, wherein the reagents include reagents for detecting the expression level of tsRNAs, wherein the tsRNAs include tRF5-Ser-AGA-1-1-030, and / or tRF5-Val-CAC-3-1-019, and / or tRF5-Val-TAC-1-1-029, and / or tRF5-Val-CAC-3-1-030, and / or tRF5-iMet-CAT-1-1-030.
[0020] This invention also provides applications of kits for detecting the above-mentioned tsRNAs, including any of the following applications:
[0021] (1) Application in the preparation of products for early screening or auxiliary screening of liver cancer;
[0022] (2) Applications in the preparation of products for early diagnosis or auxiliary diagnosis of liver cancer;
[0023] (3) Application in the preparation of products for assessing the risk of liver cancer in patients;
[0024] (4) Application in the preparation of products for assessing the prognostic effects of liver cancer patients;
[0025] (5) Application in the preparation of products for predicting the efficacy of drugs for treating liver cancer.
[0026] A further technical solution is that the kit includes probes for detecting the expression level of biomarkers, wherein the tsRNAs include tRF5-Ser-AGA-1-1-030, and / or tRF5-Val-CAC-3-1-019, and / or tRF5-Val-TAC-1-1-029, and / or tRF5-Val-CAC-3-1-030, and / or tRF5-iMet-CAT-1-1-030.
[0027] A further technical solution is that the kit includes reagents and enzymes commonly used in PCR reactions, dNTP / AMV reverse transcriptase, buffer, MgCl2, DEPC water, and Taq enzyme.
[0028] In a further technical solution, the kit also includes an exosome separation reagent. Beneficial effects
[0029] The advantages of plasma exosomal tsRNAs provided by this invention as biomarkers for the diagnosis of liver cancer are as follows:
[0030] (1) Unlike traditional protein biomarkers, plasma tsRNAs are a novel biomarker that is stable in expression, minimally invasive, easy to detect, and accurately quantified. This will greatly improve the sensitivity and specificity of disease diagnosis, help in the auxiliary diagnosis of liver cancer, and provide a reference for the development of biomarkers for other diseases.
[0031] (2) This invention systematically studied the role of plasma exosomal tsRNAs in the progression of liver cancer. This invention screened a group of tsRNA biomarkers: tRF5-Ser-AGA-1-1-030, tRF5-Val-CAC-3-1-019, tRF5-Val-TAC-1-1-029, tRF5-Val-CAC-3-1-030, and tRF5-iMet-CAT-1-1-030, which exhibit high sensitivity and specificity and can be used for liver cancer screening, diagnosis, and prognostic treatment. Furthermore, the combined use of these five tsRNA biomarkers resulted in even higher sensitivity and specificity, and better efficacy. The development and application of plasma exosomal tsRNA biomarkers and diagnostic kits can make liver cancer diagnosis more convenient and easier, providing a foundation for clinical treatment and aiding in the discovery of novel small molecule drug targets with potential therapeutic value.
[0032] (3) The plasma exosome tsRNAs kit is a comprehensive and systematic diagnostic and monitoring kit that combines the advantages of exosome technology for the auxiliary early screening of liver cancer, such as safety, accuracy and non-invasiveness. At the same time, the use of the biomarkers of this invention increases the sensitivity and accuracy of liver cancer diagnosis, which is more helpful in responding to the disease status of liver cancer patients and provides better support for clinical treatment.
[0033] (4) This invention adopts a rigorous design and evaluation system. In the early stage, high-throughput sequencing technology was used to directly sequence plasma exosomes, and qRT-PCR was used to perform multi-stage verification on a large number of samples from various sources. Two different analytical methods (absolute quantification and relative quantification) were used for verification. This ensured the application of plasma exosome tsRNAs biomarkers and diagnostic kits, and also provided a reference for the development of biomarkers for other diseases in terms of methods and strategies. Attached Figure Description
[0034] Figure 1(a) is a transmission electron microscope image of plasma exosomes from a liver cancer patient in an embodiment of the present invention;
[0035] Figure 1(b) is a Nanosight diagram of plasma exosomes from patients with liver cancer in an embodiment of the present invention;
[0036] Figure 1(c) is a Western blotting diagram of plasma exosomes from patients with liver cancer in an embodiment of the present invention.
[0037] Figure 2(a) shows the expression profile of tsRNAs in plasma exosomes of the liver cancer patient group compared with the healthy group in this invention;
[0038] Figure 2(b) is a sequencing clustering heatmap of the nine tsRNAs with the most significant differences in expression in the plasma of liver cancer patients and healthy controls in this embodiment of the invention.
[0039] Figure 3 In this embodiment of the invention, the expression of five tsRNAs in the blood of liver cancer patients was detected by QRT-PCR.
[0040] Figure 4 In this embodiment of the invention, the expression of five tsRNAs in liver cancer patient tissues was detected using QRT-PCR.
[0041] Figure 5 The ROC plots for liver cancer diagnosis using five tsRNAs individually versus CA19-9 and CEA in this embodiment of the invention are shown.
[0042] Figure 6 This is a ROC plot showing the combined use of five tsRNAs in this embodiment of the invention, along with CA19-9 and CEA, for the diagnosis of liver cancer. Detailed Implementation
[0043] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Example
[0044] This invention first separates plasma exosome samples from liver cancer patients and healthy controls whose age, gender, and other information are matched. RNA is extracted and analyzed using small RNA high-throughput sequencing. After preliminary screening, the samples are validated with a large sample size. A group of tsRNAs that are highly associated with liver cancer and have high sensitivity and specificity are then selected. Based on this, a kit for clinical diagnosis of liver cancer is developed, providing a foundation for liver cancer screening and early diagnosis.
[0045] The specific technical solutions include:
[0046] (1) Collect blood samples that meet the standards using standard operating procedures (SOPs) and systematically collect complete clinical case information.
[0047] (2) Screening and analysis of differential expression profiles of plasma exosomal tsRNAs: Screening of liver cancer patients and healthy controls matched for age and sex, isolation of plasma exosomal tsRNAs, analysis of plasma exosomal tsRNA expression profiles by sequencing, screening of differentially expressed tsRNAs, and multi-stage validation with large sample size.
[0048] (3) Quantitative analysis was performed on the differentially expressed plasma exosomal tsRNAs identified in the previous screening to identify plasma exosomal tsRNAs associated with the pathogenesis of liver cancer.
[0049] (4) Based on the plasma tsRNAs screened above, develop a diagnostic kit.
[0050] This invention collects standard blood samples according to SOPs, gathers complete pathological data (including age, sex, pathological type, WHO classification, TMN stage, etc.), and then uses methods such as small RNA high-throughput sequencing and Real-time PCR for detection.
[0051] Specifically, it includes the following parts:
[0052] (1) Collection of patient samples: ① Hepatocellular carcinoma cases diagnosed by imaging and confirmed by pathology; ② All samples were taken before surgery and had not undergone radiotherapy, chemotherapy, or neoadjuvant therapy; ③ Healthy controls were normal individuals matched for age and sex with the patients. A total of 100 plasma samples from eligible hepatocellular carcinoma patients were used in this study.
[0053] (2) Use the Total Exosome Isolation Kit (from plasma) (Invitrogen ThermosFisher) to isolate exosomes from plasma samples.
[0054] (3) Exosome quality detection: plasma exosomes were identified by transmission electron microscopy, Nanosight, and Western blotting.
[0055] (4) Total RNA was extracted from plasma exosomes using the Trizol (Invitrogen Life Technologies) method.
[0056] (5) RNA quality detection: 28S and 18S ribosomal RNA bands were detected by denaturing agarose gel electrophoresis.
[0057] (6) Small RNA high-throughput sequencing:
[0058] ① The total RNA extracted above was recovered by PAGE electrophoresis;
[0059] ② tsRNAs contain numerous RNA modifications, which can interfere with the construction of small RNA seq libraries. Before preparing libraries from total RNA samples, the following steps were performed: ligation primers were attached to the 3′ and 5′ ends of the small RNA molecules. All sRNA library construction and deep sequencing were performed by Aksomics (Shanghai, China). The size of the sequencing library was selected for RNA biotype sequencing using an automated gel cutter. These libraries were rigorously quantified using an Agilent Bioanalyst 2100. sRNA libraries were constructed using the Agilent Bioanalyst 2100. Standard small RNA sequencing was performed using an Illumina NextSeq instrument, with a sequencing type of 50bp single read.
[0060] ③ Sequencing is performed after the RT-PCR reaction.
[0061] ④ Data Analysis and Processing
[0062] (7) qRT-PCR method:
[0063] ① Total RNA was extracted from plasma exosomes and cDNA samples were obtained through RNA reverse transcription.
[0064] ② Reverse synthesis of cDNA was performed using TaqMan tsRNA stem-loop primers from Applied Biosystems;
[0065] ③ PCR reaction was performed using TaqMan tsRNAs fluorescent probes from Applied Biosystems.
[0066] ④ Detect and compare the expression changes of tsRNAs in plasma exosome samples from liver cancer patients and healthy controls.
[0067] (8) Preparation of a diagnostic kit for liver cancer tsRNAs
[0068] ① Initially, high-throughput small RNA sequencing was used to detect differentially expressed and copied tsRNAs between liver cancer patients and healthy controls. qRT-PCR was then used to further detect plasma exosomal tsRNAs showing significant differences between the two groups, serving as an auxiliary indicator for liver cancer diagnosis. Finally, plasma exosomal tsRNAs associated with liver cancer were screened to form diagnostic biomarkers (tRF5-Ser-AGA-1-1-030, tRF5-Val-CAC-3-1-019, tRF5-Val-TAC-1-1-029, tRF5-Val-CAC-3-1-030, tRF5-iMet-CAT-1-1-030). Based on this, a liver cancer diagnostic kit was developed. This kit includes probes for five tsRNAs, as well as reagents such as AMV reverse transcriptase, Taq enzyme, MgCl2, DEPC water, and dNTPs.
[0069] (9) Data Analysis
[0070] All statistical tests were performed using GraphPad Prism software 7 (San Diego, CA). Data are expressed as mean ± SEMs. P < 0.05 was considered statistically significant. Normality and equal variance between groups were assessed using the Shapiro-Wilk test and the Brown-Forsythe test, respectively. When normality and equal variance were found between groups, one-way ANOVA (followed by Bonferroni multiple comparisons test), two-way ANOVA (followed by Bonferroni multiple comparisons test), or t-tests were used.
[0071] The following is a further description of the present invention:
[0072] First, the exosomes extracted from the plasma of liver cancer patients were identified. The morphology of the exosomes was observed by transmission electron microscopy, as shown in Figure 1(a). Nanosight was used to analyze the particle size of the exosomes, as shown in Figure 1(b). Western blotting was used to detect the exosome marker proteins, as shown in Figure 1(c). It can be seen that the morphology, size and biochemical indicators of the extracted exosomes all meet the testing and research standards.
[0073] In the exploratory phase, plasma exosomes were collected from liver cancer patients and healthy controls. High-throughput sequencing of small RNAs was used to screen and identify tsRNAs as the main significantly altered non-coding small RNAs. Compared to plasma exosomes from healthy groups, 186 tsRNAs were upregulated and 174 tsRNAs were downregulated in plasma exosomes from liver cancer patients, as shown in Figure 2(a).
[0074] Based on the sequencing results, the inventors selected tsRNAs that showed significant changes (fold change > 10) and significantly increased expression (fold increase > 10) in exosome samples from the plasma of liver cancer patients for analysis. Considering limiting factors such as length, a total of 9 types met the requirements. The clustering heatmap of these 9 tsRNAs is shown in Figure 2(b).
[0075] Nine screened tsRNAs were detected using custom-synthesized TaqMan probes from Applied Biosystems, including: tRF5-Ser-AGA-1-1-030, tRF3-Val-AAC-1-1-030, tRF3-Ile-AAT-1-1-030, tRF5-Val-CAC-3-1-019, tRF5-Val-TAC-1-1-029, tRF5-Val-CAC-3-1-030, tRF5-Ala-CGC-3-1-027, tRF5-Gly-CCC-2-1-030, and tRF5-iMet-CAT-1-1-030.
[0076] Two analytical methods were used to detect the above nine tsRNAs. Based on the following two methods, the tsRNAs with statistically significant differences were further verified in plasma samples from another 100 liver cancer cases and 100 controls, so as to observe the stability of the results of this study.
[0077] (1) Absolute quantitative analysis: The corresponding tsRNAs standards were synthesized, a standard curve was prepared, and exosomal RNA was extracted from 100uL plasma samples. The CT value of the samples was obtained by QRT-PCR detection, and the absolute concentration was calculated by standard curve.
[0078] (2) Relative quantitative analysis: Plant-derived MIR2911 was added as an external reference when extracting each plasma sample (100uL). The expression level of tsRNAs was expressed as 2-ΔCt, where ΔCt = CT sample - CT external reference. The relative expression level was calculated.
[0079] The results of absolute and relative quantitative analysis showed that five tsRNAs met both screening criteria: tRF5-Ser-AGA-1-1-030 (SEQ ID No. 1); tRF5-Val-CAC-3-1-019 (SEQ ID No. 2); tRF5-Val-TAC-1-1-029 (SEQ ID No. 3); tRF5-Val-CAC-3-1-030 (SEQ ID No. 4); and tRF5-iMet-CAT-1-1-030 (SEQ ID No. 5). These five tsRNAs showed significant differences in expression between the hepatocellular carcinoma case group and the healthy control group. The sequences of these five biomarkers are shown in Table 1.
[0080] Table 1: Five tsRNA biomarkers
[0081] AccID Marker sequence SEQ ID No. 1 GUAGUCGUGGCCGAGUGGUUAAGGCGAUGG SEQ ID No. 2 GUUUCCGUAGUGUAGCGGU SEQ ID No. 3 GGUUCCAUAGUGUAGUGGUUAUCACGUCU SEQ ID No. 4 GUUUCCGUAGUGUAGCGGUUAUCACAUUCG SEQ ID No. 5 AGCAGAGUGGCGCAGCGGAAGCGUGCUGGG
[0082] Based on the above results, further detection and validation of the above five tsRNAs were performed in the plasma of another 32 healthy controls and 32 liver cancer patients. The results showed that tRF5-Ser-AGA-1-1-030, tRF5-Val-CAC-3-1-019, tRF5-Val-TAC-1-1-029, tRF5-Val-CAC-3-1-030, and tRF5-iMet-CAT-1-1-030 were all significantly elevated in liver cancer samples. The results are as follows: Figure 3 As shown.
[0083] Based on the above results, RNA was extracted from the tumor area and corresponding adjacent normal tissue of 20 liver cancer patients. Further detection and validation of the five tsRNAs were performed. The results showed that tRF5-Ser-AGA-1-1-030, tRF5-Val-CAC-3-1-019, tRF5-Val-TAC-1-1-029, tRF5-Val-CAC-3-1-030, and tRF5-iMet-CAT-1-1-030 were all significantly elevated in liver cancer tissue samples. The results are as follows: Figure 4 As shown.
[0084] Further analysis was conducted on the efficacy of the aforementioned five tsRNAs in the diagnosis of liver cancer in another 100 liver cancer patients and 110 healthy controls, and a comparative analysis was performed with existing liver cancer diagnostic markers CEA and CA19-9. The results are as follows: Figure 5As shown, ROC curve (Receiver Operating Characteristic Curve) analysis revealed that tRF5-Ser-AGA-1-1-030, tRF5-Val-CAC-3-1-019, tRF5-Val-TAC-1-1-029, tRF5-Val-CAC-3-1-030, and tRF5-iMet-CAT-1-1-030 have higher sensitivity and specificity for the diagnosis of CEA and CA19-9 in existing technologies. These five tsRNA biomarkers can be used for the diagnosis, screening, and prognostic monitoring of liver cancer.
[0085] Further analysis was conducted on the efficacy of the combined use of the above five tsRNA markers for the diagnosis of liver cancer in 100 liver cancer patients and 110 healthy controls. The results are as follows: Figure 6 As shown in the results, the combined use of the above five tsRNA biomarkers significantly increased the AUC (Area Under the ROC Curve) for the diagnosis of liver cancer compared with the use of the five tsRNA biomarkers alone, indicating that the combined use of these five tsRNA biomarkers was more effective.
Claims
1. Applications of products for detecting plasma exosomal tsRNA markers, including any of the following applications: (1) Application in the preparation of products for early screening or auxiliary screening of liver cancer; (2) Applications in the preparation of products for early diagnosis or auxiliary diagnosis of liver cancer; (3) Application in the preparation of products for assessing the risk of liver cancer in patients; The plasma exosomal tsRNA markers are combinations of the following sequences: tRF5-Ser-AGA-1-1-030: The sequence is shown in SEQ ID No. 1; tRF5-Val-CAC-3-1-019: The sequence is shown in SEQ ID No. 2; tRF5-Val-TAC-1-1-029: The sequence is shown in SEQ ID No. 3; tRF5-Val-CAC-3-1-030: The sequence is shown in SEQ ID No. 4; tRF5-iMet-CAT-1-1-030: The sequence is shown in SEQ ID No.
5.
2. The application according to claim 1, characterized in that, The products mentioned are reagents and kits.
3. The application according to claim 2, characterized in that, The reagents described include those for detecting tsRNA expression levels.
4. The application according to claim 2, characterized in that, The kit includes probes for detecting the expression levels of biomarkers.
5. The application according to claim 2, characterized in that, The kit includes dNTP / AMV reverse transcriptase, buffer, MgCl2, DEPC water, and Taq enzyme.