Streptococcus salivarius a2, compositions and methods of making same

CN117603866BActive Publication Date: 2026-08-28XIAMEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311575278.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-23
Publication Date
2026-08-28
Estimated Expiration
2043-11-23

AI Technical Summary

Technical Problem

尽管目前的策略,如手术、放疗和化疗有助于治疗CRC,但这种疾病仍然是癌症相关死亡的主要原因

Benefits of technology

[0054]为使本发明的目的、技术方案及优点更加清楚明白,以下结合实施例,对本发明进行进一步的详细说明。此处所描述的具体实施例仅用于解释本发明,并不用于构成对本发明的任何限制。此外,在以下说明中,省略了对公知结构和技术的描述,以避免不必要地混淆本公开的概念。这样的结构和技术在许多出版物中也进行了描述。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117603866B_ABST
    Figure CN117603866B_ABST
Patent Text Reader

Abstract

The application provides a Streptococcus salivarius strain, the strain name is Streptococcus salivarius A2, which has been preserved in the China Center for Type Culture Collection on October 23, 2023, and the preservation number is CCTCC NO: M20231986. The new Streptococcus salivarius strain screened in the application is subjected to genome comparison with a current Streptococcus salivarius model strain, and the average similarity (ANIb) of the genome with the model strain is 94.14%-95.86%, at least 4% more than other strains, and the maximum difference reaches nearly 6%. The Streptococcus salivarius has a significant effect on the treatment of colorectal inflammation and colorectal cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to Streptococcus salivarius A2, its composition, and its preparation method. Background Technology

[0002] Streptococcus salivarius (S.sp.) is a Gram-positive coccus that is one of the first naturally occurring bacteria to colonize the oral cavity and intestines after birth, playing a wide role in establishing host immune homeostasis and regulating inflammatory responses. Studies have found that some strains of Streptococcus salivarius can exert antibacterial functions by secreting antimicrobial peptides, inhibiting the colonization of pathogenic bacteria such as Streptococcus pyogenes and Fusobacterium nucleatum in the digestive tract. Currently, research on Streptococcus salivarius is ongoing, and in clinical studies, the K12 strain of Streptococcus salivarius has been shown to play an important role in the treatment of infectious diseases such as pharyngeal tonsillitis and otitis media.

[0003] A recent study isolated Streptococcus salivarius strain F286 from breast milk and found that strain F286 could significantly reduce intestinal inflammation levels and improve gut microbiota structure in mice; it also found that using strain F286 could prolong the lifespan of Caenorhabditis elegans.

[0004] Inflammatory bowel disease (IBD) is a group of chronic, nonspecific inflammatory bowel diseases with unclear etiologies, mainly including Crohn's disease (CD) and ulcerative colitis (UC). The main symptoms of IBD are recurrent abdominal pain, diarrhea, and weight loss. Approximately 5%–30% of patients also experience extraintestinal symptoms, and about 18% of IBD patients eventually develop bowel cancer [Wu, S., et al., Inflammatory Bowel Disease and Long-term Risk of Cancer: A Prospective Cohort Study Among Half a Million Adults in UK Biobank. InflammBowel Dis, 2022.]. The specific role of gut microbiota in the pathogenesis of IBD and the specific molecular mechanisms of probiotic therapy for IBD remain unclear.

[0005] Colorectal cancer (CRC) is one of the most common forms of cancer. Despite current strategies such as surgery, radiation therapy, and chemotherapy that help treat CRC, the disease remains a leading cause of cancer-related deaths. CRC is known to either develop spontaneously or may be caused by chronic inflammation such as IBD. It typically begins with the formation of polyps on the lining of the colon or rectum, and 95% of CRC cases are adenocarcinomas.

[0006] The human gut microbiota comprises approximately 100 trillion microorganisms, playing a crucial role in maintaining host health, whether in the gastrointestinal tract or through systemic absorption of metabolites. Recent studies have shown that specific bacterial strains are involved in the regulation of gut homeostasis, transmitting regulatory signals to epithelial cells, the mucosal immune system, and the neuromuscular activity of the gut. Furthermore, some symbiotic and pathogenic organisms in the human gut microbiome are essential in the pathogenesis of IBD and CRC. Therefore, controlling gut bacterial composition and the production of local metabolites through the use of probiotics has been explored as a promising approach for therapeutic intervention in CRC. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention, through screening, obtained a strain of *Streptococcus salivarius* that exhibits significant therapeutic effects in colorectal cancer. This is entirely different from the conclusions presented in existing technologies. Existing technologies, when studying *Streptococcus thermophilus*, used *Streptococcus salivarius* and a PBS control as a comparative study, concluding that there was no significant difference between the two strains, indicating that *Streptococcus salivarius* had no therapeutic effect on CRC. The novel *Streptococcus salivarius* obtained by this invention, after genomic comparison with current *Streptococcus salivarius* model strains, showed an average genomic similarity (ANIb) of only 94.14%-95.86%, indicating a significant difference. This difference may enable *Streptococcus salivarius* to possess entirely new applications. The *Streptococcus salivarius* strain of this invention demonstrates superior technical efficacy in colitis and opens a new chapter in its application in the field of colorectal cancer.

[0008] Specifically, on the one hand, the present invention provides a strain of Streptococcus salivarius, named Streptococcus salivarius A2, which was deposited at the China Center for Type Culture Collection on October 23, 2023, with accession number CCTCCNO: M20231986.

[0009] On the other hand, the present invention also provides a pharmaceutical composition characterized by comprising the Streptococcus salivarius A2 described in the present invention.

[0010] In some embodiments, the pharmaceutical composition further includes pharmaceutically acceptable excipients.

[0011] In some embodiments, the pharmaceutically acceptable excipients include one or more of pharmaceutically acceptable carriers, diluents, excipients, binders, and fillers.

[0012] In some embodiments, the pharmaceutical composition further includes probiotics and / or colorectal cancer treatment agents and / or other enteritis treatment agents.

[0013] In some embodiments, the probiotics include one or more of L. acidophilus, L. reuteri, L. acidophilus, L. bulgaricus, L. plantarum, L. casei, L. gasseri, L. GG, Streptococcus thermophilus, Bifidobacterium, and Saccharomyces boulardii.

[0014] In some embodiments, the colorectal cancer treatment agent includes small molecule antitumor drugs and / or large molecule antibody drugs.

[0015] In some embodiments, the other enteritis treatment agents include one or more of amoxicillin, norfloxacin, levofloxacin, mesalazine, azithromycin, rifaximin, furazolidone, cefixime, ceftriaxone sodium, roxithromycin, albendazole, ciprofloxacin, vancomycin, tetracycline, tinidazole, metronidazole, and ganciclovir.

[0016] In some embodiments, the composition is in a form suitable for oral or rectal administration; preferably a suspension, powder, tablet, suppository, or capsule.

[0017] On the other hand, the present invention also provides a screening method for Streptococcus salivarius A2 described in this invention, comprising taking fecal samples from healthy individuals and performing 10 tests with sterile water. -1 Up to 10 -10 The culture was serially diluted and spread onto BHI solid medium using a sterile glass rod, and incubated at 37°C for 2–3 days. Single colonies were picked using a sterile inoculation loop, purified, and passaged 3 times. Single colonies were then transferred into 5 mL of BHI liquid medium and incubated overnight at 37°C. 1 mL of the bacterial culture was collected to obtain Streptococcus salivarius A2.

[0018] Studies have reported that oral administration of Streptococcus thermophilus can significantly reduce the formation of colorectal tumors (CRC) in mice (LIQ, HUW, LIU WX, et al. Streptococcus thermophilus Inhibits Colorectal Tumorigenesis Through Secreting β-Galactosidase[J]. Gastroenterology, 2021, 160(4). https: / / doi.org / 10.1053 / j.gastro.2020.09.003). However, in the process of this study, Streptococcus salivarius and PBS control were used as comparative studies, and it was found that there was no significant difference between Streptococcus salivarius and PBS control, that is, Streptococcus salivarius has no therapeutic effect on CRC. In this invention, a Streptococcus salivarius A2 strain was obtained through screening, and its genome draft was sequenced and compared with the genome of the existing Streptococcus salivarius model strain. The Streptococcus salivarius A2 strain described in this invention is significantly different from the existing model strain. This invention studies the novel strain in CRC and finds that, through examination of various aspects such as body weight, number of tumors, tumor burden, and H&E plots in AOM / DSS model mice, the *Streptococcus salivarius* A2 described in this invention can play a very significant and positive role in the treatment of CRC. This is completely different from the effects of existing validated *Streptococcus salivarius*, breaking through the known uses of *Streptococcus salivarius* and showing high application prospects in the treatment of CRC.

[0019] Terminology Explanation

[0020] Certain embodiments of the invention will now be described in detail, examples of which are illustrated in the accompanying drawings. The invention is intended to cover all alternatives, modifications, and equivalents, all of which are included within the scope of the invention as defined in the claims. Those skilled in the art will recognize that many similar or equivalent methods and materials can be used to practice the invention. The invention is by no means limited to the methods and materials described herein. In the event that one or more of the incorporated documents, patents, and similar materials differ from or contradict this application (including, but not limited to, defined terminology, application of terminology, described techniques, etc.), this application shall prevail.

[0021] It should be further appreciated that certain features of the invention, for clarity, have been described in multiple independent embodiments, but may also be provided in combination in a single embodiment. Conversely, various features of the invention, for brevity, have been described in a single embodiment, but may also be provided individually or in any suitable sub-combination.

[0022] Unless otherwise stated, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. All patents and publications related to this invention are incorporated herein by reference in their entirety.

[0023] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0024] In the following content, all figures disclosed herein, whether or not they use words such as "approximately" or "about," are approximate values. The value of each figure may vary by 1%, 2%, 5%, 7%, 8%, 10%, 15%, or 20%, etc. Whenever a figure with a value of N is disclosed, any figure with a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15%, or N+ / -20% will be explicitly disclosed, where "+ / -" indicates addition or subtraction.

[0025] The term "pharmaceutically acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with other components of the formulation and / or the mammals to which it is treated.

[0026] As used herein, the term “pharmaceutically acceptable carrier” means a substance that can be used in the preparation or use of a pharmaceutical composition, and includes, for example, suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffers, emulsifiers, absorption delay agents, salts, pharmaceutical stabilizers, binders, excipients, disintegrants, lubricants, wetting agents, sweeteners, flavoring agents, dyes, and combinations thereof, as known to those skilled in the art (see, for example, Remington: The Science and Practice of Pharmacy, 22nd ed., Pharmaceutical Press, 2013, pp. 1049–1070).

[0027] The term "pharmaceutical composition" refers to a mixture of the *Streptococcus salivarius* described in this invention with other components, such as physiologically / pharmaceutically acceptable carriers, diluents, and further excipients such as excipients, binders, fillers, etc., as well as adjunctive therapeutic agents for the prevention and treatment of colorectal cancer. The purpose of the pharmaceutical composition is to facilitate the delivery of the active ingredient to the organism.

[0028] The *Streptococcus salivarius* and probiotics or colorectal cancer treatment agents in the pharmaceutical composition of the present invention can be formulated separately, or partially or entirely together. Preferably, the components of the pharmaceutical composition are formulated separately, or each is formulated into a suitable pharmaceutical composition. In some embodiments, the pharmaceutical composition of the present invention can be formulated into a pharmaceutical composition suitable for single or multiple administration.

[0029] The salicylic streptococci and probiotics or colorectal cancer treatment agents in the pharmaceutical compositions of the present invention can be administered individually or in combination, either partially or entirely. The salicylic streptococci and probiotics or colorectal cancer treatment agents in the pharmaceutical compositions of this application can be administered substantially separately or in combination, either partially or entirely simultaneously.

[0030] The components of the pharmaceutical composition of this application may be administered individually or in combination, either independently or by a suitable route, including, but not limited to, oral or parenteral administration (via intravenous, intramuscular, local, or subcutaneous routes). In some embodiments, the components of the pharmaceutical composition of this application may be administered orally or by injection, such as intravenous or intraperitoneal injection, either independently or in combination.

[0031] The components in the pharmaceutical composition of this application may be individually, or some or all of them together, suitable dosage forms, including, but not limited to, tablets, lozenges, pills, capsules (e.g., hard capsules, soft capsules, enteric-coated capsules, microcapsules), elixirs, granules, syrups, injections (intramuscular, intravenous, intraperitoneal), granules, emulsions, suspensions, solutions, dispersants, and sustained-release formulations for oral or non-oral administration.

[0032] The pharmaceutical compositions of this invention are particularly useful for treating neoplastic diseases, especially cancer, as described herein. The compositions can be formulated for non-parenteral administration, such as nasal, oral, rectal, lung, vaginal, sublingual, topical, transdermal, ocular, or especially for oral administration, for example in oral solid dosage forms such as granules, pills, powders, tablets, film-coated tablets or sugar-coated tablets, effervescent tablets, hard capsules and soft capsules or hydroxypropyl methylcellulose (HPMC) capsules (suitably coated), orally disintegrating tablets, oral solutions, lipid emulsions or suspensions, particularly for humans, for example in the form of solutions, lipid emulsions or suspensions containing microparticles or nanoparticles. These compositions may contain a single active ingredient, or preferably, together with a pharmaceutically acceptable carrier.

[0033] The present invention relates to *Streptococcus salivarius* that can be processed with pharmaceutically inert inorganic or organic excipients for the production of oral solid dosage forms, such as granules, pills, powders, tablets, film-coated tablets or sugar-coated tablets, effervescent tablets, hard capsules or HPMC capsules or orally disintegrating tablets. Fillers such as lactose, cellulose, mannitol, sorbitol, calcium phosphate, starch or derivatives thereof, binders such as cellulose, starch, polyvinylpyrrolidone or derivatives thereof, flow aids such as talc, stearic acid or salts thereof, and flow agents such as calcined silica can be used as such excipients for the formulation and manufacture of oral solid dosage forms, such as granules, pills, powders, tablets, film-coated tablets or sugar-coated tablets, effervescent tablets, hard capsules or HPMC capsules or orally disintegrating tablets. Suitable excipients for soft capsules include, for example, vegetable oils, waxes, fats, semi-solid and liquid polyols.

[0034] Suitable excipients for manufacturing oral solutions, lipid emulsions or suspensions include, for example, water, alcohol, polyol, sucrose, invert sugar, glucose, etc.

[0035] Suitable excipients for parenteral preparations include water, alcohol, polyol, glycerin, vegetable oil, lecithin, surfactant, etc.

[0036] In addition, pharmaceutical preparations may contain preservatives, solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, flavoring agents, salts for altering osmotic pressure, buffers, masking agents, or antioxidants. Pharmaceutical preparations may also contain other substances of therapeutic value.

[0037] The term "therapeuticly effective amount" for a compound of the present invention refers to an amount of the compound of the present invention that will elicit a biological or medical response in a subject (e.g., a reduction or inhibition of enzyme or protein activity, or improvement of symptoms, relief of condition, slowing or delaying disease progression, or prevention of disease, etc.). In a non-limiting embodiment, the term "therapeuticly effective amount" refers to an amount of the compound of the present invention that, when administered to a subject, effectively at least partially relieves, inhibits, prevents, and / or improves CRBN-mediated disease or condition.

[0038] As used herein in the context of treating a disease or disorder, the term "treatment" generally refers to the treatment and therapy of humans or animals (e.g., in veterinary applications) in which some desired therapeutic effect is achieved, such as inhibiting the progression of the disease or disorder, and includes reducing the rate of progression, stopping the rate of progression, alleviating the symptoms of the disease or disorder, improving the disease or disorder, and curing the disease or disorder. It also includes treatment as a preventative measure (i.e., prevention). For example, treatment for patients who have not yet developed the disease or disorder but are at risk of developing it is covered by the term "treatment." For example, treatment includes cancer prevention, reducing cancer incidence, alleviating cancer symptoms, etc.

[0039] The small molecule targeted anti-tumor drugs mentioned are imatinib, nilotinib, bosutinib, sunitinib, cicatinib, pazopanib, trabectin, carfilzomib, ixazomib, sildenafil, bortezomib, apatinib, regorafenib, nintedanib, fruquintinib, aflibercept, lapatinib, vandetanib, sumetinib, sorafenib, oxomotinib, voritinib, entrectinib, dasatinib, ensartinib, lenvatinib, itatinib, pyrotinib, bimetinib, erdatinib, axitinib, lenatatinib, and others. Lotinib, Afatinib, Crizotinib, Ceritinib, Vemurafenib, Dabrafenib, Cabozantinib, Gefitinib, Dacomitinib, Osimertinib, Olemtinib, Alectinib, Brigatinib, Lorlatinib, Trametinib, Larotrectinib, Icotinib, Cobitinib, Acalatinib, Famitinib, Macitinib, Ibrutinib, Trifluridine, Tipyrimidine Hydrochloride, Rositinib, Lenalidomide, Everolimus, Voronib, Besentinib, Carmatinib, Entricinib, Palbociclib, Famitinib Maleate, Nintedanib Tepirafenib, Pozidinavir, Conexant, Metformin, Adalaris, Leroxithib, Seliciclib, Berzosertib, Cerasertib, Tomoivosertib, Allitinib, Lirafenib, Vastosertib, Milvebuxel, Nabucacin, Stratinib, Molibresib, Apatinib, Simotinib, Masatitinib, Terpotinib, Mesatinib, Pego-Olatice, Galunise One or more of the following: rtib, gidalice, defactinib, lazertinib, duroquinol, panatinib, epiperinib succinate, tervatinib, cupanixinib, niraparib, olaparib, veriparib, tapazopanib tosylate, siredrine, tilagagstat, bortezomib, pabistana, chidamide, vorinostat, macitentan, icocadolstat, tazestat, entenitol, mocetinostat, quisinostat.

[0040] The macromolecular antibody drugs mentioned are bevacizumab, ramucirumab, pertuzumab, trastuzumab, cetuximab, nimotuzumab, panitumumab, materutuzumab, nexituzumab, bonatumab, nivolumab, pembrolizumab, durvalumab, toripalimab, sintilimab, camrelizumab, tislelizumab, genolimab, lizhuzumab, denutucizumab, rituximab, teimozimab, oflambumab, obbituzumab, alemtuzumab, daratumumab, gemtuzumab, erlotuzumab, bentuximab, olimituzumab, olentuzumab, HLX-10, and B. Any one or more of the following: AT-1306, AK103, AK104, CS1003, SCT-I10A, F520, SG001, GLS-010, atezolizumab, avelumumab, durvalumab, KL-A167, SHR-1316, BGB-333, JS003, STI-A1014, KN035, MSB2311, HLX-20, CS-1001, ipilimumab, teximumab, AGEN-1884, BMS-986249, BMS-986218, AK-104, and IBI310. Attached Figure Description

[0041] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the following detailed description to explain the invention, but do not constitute a limitation thereof.

[0042] Figure 1 The changes in body weight in AOM / DSS model mice.

[0043] Figure 2 This is an anatomical diagram of the colon in AOM / DSS model mice.

[0044] Figure 3 The number of tumors in AOM / DSS model mice.

[0045] Figure 4 The tumor burden in AOM / DSS model mice.

[0046] Figure 5 The image shows the colonic H&E results in AOM / DSS model mice.

[0047] Figure 6 The changes in body weight of DSS model mice.

[0048] Figure 7 A representative anatomical diagram of the colon in a DSS model mouse.

[0049] Figure 8 This is a statistical graph showing the comparison of colon length in DSS model mice.

[0050] Figure 9 The image shows the colonic H&E results of the DSS model mouse.

[0051] Figure 10 A statistical graph of colonic H&E scores in DSS model mice.

[0052] Figure 11 A comparison of MPO content in the colon tissue of DSS model mice.

[0053] Figure 12 This is a comparative diagram showing the relative quantitative analysis of mRNA levels in colon tissue of DSS model mice. Detailed Implementation

[0054] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0055] All reagents used in this invention can be purchased commercially or prepared by the methods described in this invention.

[0056] I. Screening for Streptococcus salivarius:

[0057] Take stool samples from healthy individuals and test them with sterile water for 10 minutes. -1 up to 10 -10 The culture was serially diluted and spread onto BHI solid medium using a sterile glass rod, and incubated at 37°C for 2–3 days. Single colonies were picked using a sterile inoculation loop, purified, and subcultured 3 times. Single colonies were then transferred into 5 mL of BHI liquid medium and incubated overnight at 37°C. 1 mL of the bacterial culture was collected to obtain Streptococcus salivarius A2.

[0058] II. Identification of Streptococcus salivarius A2:

[0059] The genomes of Streptococcus salivarius A2 (S. sal A2) were compared with those of the model strain, and the comparative structures are shown in Table 1.

[0060] Table 1. Comparison of genomes between Streptococcus salivarius A2 and the type strain.

[0061]

[0062] ANIb: Average genetic similarity of genomes.

[0063] The genome draft of S. sal A2 strain was sequenced and compared with the genome of the current model strain of Streptococcus salivarius. The average genome similarity (ANIb) with the model strain was 94.14%-95.86% (intraspecific similarity is generally greater than 95%). Compared with other strains, there was at least 4% difference, and the maximum difference reached nearly 6%, which suggests that S. sal A2 is significantly different from the existing model strain.

[0064] III. Verification of the role of Streptococcus salivarius A2 in colon cancer.

[0065] The materials and methods are as follows:

[0066] 1. Commonly used medicines and reagents:

[0067] Most of the pharmaceuticals and reagents used in this invention were purchased from Sigma, Sangon Biotech, and MedChemExprs (MCE), respectively, and the DSS used was purchased from MP.

[0068] 2. Construction of AOM / DSS model for colorectal cancer

[0069] The azomethane (AOM) / sodium dextran sulfate (DSS) model is a rat CRC model combining DSS-induced experimental colitis and AOM exposure. Azomethane (AOM) is a carcinogen that undergoes a hydroxylation reaction catalyzed by liver ethanol-induced cytochrome p450 subtype (CYP2E1) to produce the reactive metabolite methylazocyclomethanol (MAM). MAM is a highly reactive alkylating agent that can induce G→A transitions in DNA by inducing methylguanine adducts. MAM enters the intestine via bile or blood, where it is broken down into free compounds by intestinal flora enzymes. These free compounds are then acted upon by colonic tissue enzymes or by the colonic tissue activation system, inducing mutagenesis. Sodium dextran sulfate (DSS) is a synthetic sulfated polysaccharide used as a chemical inflammatory agent. Mice fed a drinking water containing DSS can develop an inflammatory bowel disease model. This model often presents with colitis characterized by bloody stools, intestinal mucosal ulcers, and granulocyte infiltration. Combining AOM and DSS can provide a tumor model for CAC.

[0070] Construction process: SPF-grade C57 / B6J mice were purchased from the Experimental Animal Center of Xiamen University. Three days before the start of the experiment, AOM (sigma) was injected intraperitoneally at a dose of 12.5 mg / kg body weight. The mice were given free access to 3% DSS water for 7 days, followed by normal water for 14 days as one cycle, and 3 cycles were completed.

[0071] 3. Experiment

[0072] Experimental and control groups were set up.

[0073] Preparation of bacterial suspension: Using BHI medium, S. sal A2 was inoculated at 1% and cultured at 37°C for 12 hours. After centrifugation at 3000 rpm for five minutes, the bacterial pellet was collected and resuspended in sterile PBS. The bacterial density was detected using a McFarland turbidimeter and adjusted to 5*108 cfu / mL for oral administration to mice.

[0074] Experimental groups (S.sal A2 group and Ss group in the attached figure): After DSS free drinking water at the end of each cycle, patients were given gavage with a suspension of Streptococcus salivarius A2 every 2 days for 7 times, with a treatment dose of 108 CFU per dose.

[0075] The control group (Control group and PBS group in the attached figure) differed from the experimental group in that it was given sterile PBS by gavage.

[0076] 3.1 Monitoring and comparing the body weight of AOM / DSS model mice

[0077] From the perspective of AOM / DSS model mouse weight detection (e.g.) Figure 1 The study found that the tumor mice in the experimental group treated with Streptococcus salivarius A2 recovered significantly more body weight than the control group mice.

[0078] 3.2 Detection and comparison of tumor number and tumor burden in AOM / DSS model mice

[0079] Colonic anatomy diagram from AOM / DSS model mice ( Figure 2 ), number of tumors (e.g.) Figure 3 ) and tumor burden (e.g. Figure 4 It can be seen that the number of tumors and the tumor burden in the bacteria-drenched group were significantly lower than those in the control group.

[0080] 3.3 Results of colonic H&E in AOM / DSS model mice

[0081] From the colonic H&E results of AOM / DSS model mice, as shown in the figure. Figure 5 It can be seen that the inflammation, crypt atrophy, hyperplasia, dysplasia, and area of ​​the mice in the bacterial irrigation group were all smaller than those in the control group.

[0082] In summary, the Streptococcus salivarius A2 provided by this invention has a significant effect on AOM / DSS model mice, suggesting that Streptococcus salivarius A has potential therapeutic value in the treatment of colorectal cancer.

[0083] IV. Verification of the role of Streptococcus salivarius A2 (S. sal A2) in colitis

[0084] The materials and methods are as follows:

[0085] 1. Commonly used medicines and reagents:

[0086] Most of the reagents and pharmaceutical products used in this report were purchased from Sigma-Aldrich, Sangon Biotech, and MedChemExprs (MCE), respectively. The DSS used was purchased from MP. Antibodies used for Western blotting analysis were purchased from Sigma-Aldrich, Cell Signaling (CST), and Proteintech. Flow cytometry antibodies and other flow cytometry-related reagents were purchased from BD Biosciences. Bacterial genome mapping and mouse colon RNA sequencing were performed by Novogene.

[0087] 2. Construction of a DSS model for colitis

[0088] Construction process: SPF-grade C57 / B6J mice were purchased from the Experimental Animal Center of Xiamen University. They were given free access to water and induced with 3% DSS for 5-7 days to induce colitis.

[0089] 3. Experiment

[0090] The experiment group, positive control group (using standard strains of Streptococcus salivarius K12 and M18), and blank control group were set up.

[0091] Preparation of bacterial suspension: Using BHI medium, 1% of *Streptococcus salicifolius* (experimental group: *S. sal* A2; positive control group 1: *S. sal* K12; positive control group 2: *S. sal* M18) was inoculated and cultured at 37°C for 12 hours. After centrifugation at 3000 rpm for 5 minutes, the bacterial pellet was collected and resuspended in sterile PBS. The bacterial density was measured using a McFarland turbidimeter and adjusted to 10⁻⁶. 8 cfu / mL was used for oral administration to mice.

[0092] Experimental group: The experimental group received S. sal A2 bacterial suspension via gavage for 3 days, with a bacterial concentration of 10. 8 cfu / mL, 200μL / animal / day.

[0093] Positive control groups: Two positive control groups were set up. Compared with the experimental group, the two positive control groups were administered S. sal K12 and S. sal M18 bacterial suspensions by gavage, respectively, with a bacterial concentration of 10. 8 cfu / mL, 200μL / animal / day.

[0094] Blank control group: Compared with the experimental group, the blank control group was given sterile PBS by gavage.

[0095] Daily weight changes were monitored, and inflammatory indicators such as colon length were measured after mice were euthanized.

[0096] 3.1 Monitoring and comparing the body weight of DSS model mice

[0097] From the perspective of DSS model mouse weight detection (e.g.) Figure 6 The study found that mice in the *Streptococcus salivarius* A2 experimental group recovered significantly more body weight than the two positive control groups (standard strain K12 and standard strain M18) and the blank control group. There were no statistically significant differences among the blank control group, the standard strain K12 group, and the standard strain M18 group. This indicates that *S. sal* A2 can significantly alleviate overall inflammation in mice, and its effect is superior to that of standard strains *S. sal* K12 and *S. sal* M18.

[0098] 3.2 Comparison of intestinal inflammatory contractures in DSS model mice

[0099] Following S. sal A2 gavage treatment, the intestinal inflammatory contractures in DSS-induced colitis mice were as follows: Figure 7 and Figure 8 , Figure 7 This is a representative anatomical diagram of the colon. Figure 8 This is a statistical chart comparing colon lengths. The degree of intestinal inflammatory contracture in mice was significantly lower than that in the control group, the standard strain K12 group, and the standard strain M18 group. This shows that S. sal A2 can significantly alleviate intestinal contracture in mice, and its effect is better than that of standard strains S. sal K12 and S. sal M18.

[0100] 3.3 Comparison of H&E results with DSS model mice

[0101] The H&E pathological scores of DSS-induced colitis mice after S. sal A2 gavage treatment are as follows: Figure 9 and Figure 10 , Figure 9 This is a representative image of H&E in colon mice. Figure 10 The H&E score statistical chart shows that the scores of local intestinal inflammation and tissue damage in the S. sal A2 gavage treatment group were significantly lower and less severe compared to the control group and the standard strain M18 group. There were no statistically significant differences among the control group, the standard strain K12 group, and the standard strain M18 group. This indicates that S. sal A2 can significantly alleviate local intestinal inflammation and tissue damage in mice, and its effect is superior to that of the standard strains S. sal K12 and S. sal M18.

[0102] 3.3 Comparison of colonic myeloperoxidase (MPO) results in DSS model mice

[0103] Following S. sal A2 gavage treatment, the peroxidase (MPO) results in DSS-induced colitis mice were as follows: Figure 11 It can be seen that the MPO content in the colonic tissue of mice treated with S. sal A2 via gavage was significantly lower than that in the control group and the standard strain M18 group. Similarly, the MPO content in the colonic tissue of mice in the K12 group was significantly lower than that in the control group and the standard strain M18 group. This indicates that S. sal A2 can significantly alleviate local intestinal inflammation in mice, and its effect is superior to that of the standard strain S. sal M18.

[0104] 3.4 Functional comparison experiment with our own strain S. sal 1802

[0105] The experimental group and the positive control group 3 (S. sal 1802) were administered bacteria via gavage for 3 days at a concentration of 10⁸ cfu / mL and 200 μL / mouse / day. After the experiment, the mice were sacrificed, and a 2 cm segment of the colon near the anus was collected. RNA was extracted and reverse transcribed. Using Gapdh as an internal control, quantitative PCR was performed to detect the expression levels of Tnf-α and Ifn-γ.

[0106] Amplification reaction system: Amplification system (20 μL); TransStart Green qPCR SuperMix (10 μL), DNA template (2 μL), front primer (1 μL), back primer (1 μL), ultrapure water (6 μL).

[0107] Amplification program: 95℃: 15min, (95℃: 30s, 60℃: 30s) x 40 cycles.

[0108] Primer sequences:

[0109] mouse-TNF-aF:AGTCCGGGCAGGTCTACTTT;

[0110] mouse-TNF-aR:TTGGACCCTGAGCCATAATC;

[0111] mouse-IFN-gF: CCTTTGGACCCTCTGACTTG;

[0112] mouse-IFN-gR:TCTTCCACATCTATGCCACTTG;

[0113] mouse-GAPDH-F:CCATTTGCAGTGGCAAAG;

[0114] mouse-GAPDH-R:CACCCCATTTGATGTTAGTG.

[0115] The results are as follows Figure 12 It can be seen that the expression levels of Tnf-α and Ifn-γ in the colon tissue of mice treated with S.sal A2 by gavage were significantly lower than those in the positive control group treated with S.sal 1802 by gavage. This shows that S.sal A2 can significantly alleviate the expression of local inflammatory factors in the mouse intestine at the mRNA level, and the effect is better than that of the self-existing strain S.sal 1802.

[0116] Streptococcus salivarius 1802 was deposited at the China Center for Type Culture Collection (CCTCC) on April 11, 2019, with accession number CCTCC NO: M 2019251. The applicant filed a patent application for this strain of Streptococcus salivarius (CN 110452860 A) in 2019. The Streptococcus salivarius A2 (S. sal A2) provided by this invention exhibits superior inhibitory effects on enteritis in the DSS model.

[0117] In summary, the *Streptococcus salivarius* A2 (S.sal A2) described in this invention has a positive effect on enteritis, and its effect is superior to that of the standard strains K12 and M18. Moreover, compared with *S.sal 1802*, it has a stronger ability to inhibit the expression of inflammatory factors at the mRNA level, indicating that it has a better inhibitory effect on enteritis in the DSS model. *Streptococcus salivarius* A2 (S.sal A2) has an inhibitory effect on colitis, especially ulcerative colitis.

[0118] The method of this invention has been described through preferred embodiments. Those skilled in the art will readily be able to modify or appropriately alter and combine the methods and applications described herein within the scope, spirit, and context of this invention to implement and apply the technology of this invention. Those skilled in the art can refer to the content herein to appropriately improve process parameters. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included within the scope of this invention.

Claims

1. A strain of *Streptococcus salivarius*, strain name Streptococcus salivarius A2 It was deposited at the China Center for Type Culture Collection on October 23, 2023, with accession number CCTCC NO: M20231986, for the preparation of drugs for colon cancer or enteritis.

2. A pharmaceutical composition, characterized in that, Including the Streptococcus salivarius as described in claim 1 Streptococcus salivarius A2 .

3. The pharmaceutical composition according to claim 2, characterized in that, The pharmaceutical composition also includes pharmaceutically acceptable excipients.

4. The pharmaceutical composition according to claim 3, characterized in that, Pharmaceutically acceptable excipients include one or more of pharmaceutically acceptable carriers, diluents, excipients, binders, and fillers.

5. The pharmaceutical composition according to claim 2, characterized in that, The pharmaceutical composition is in a form suitable for oral or rectal administration.

6. The pharmaceutical composition according to claim 5, characterized in that, The pharmaceutical composition is a suspension, powder, tablet, suppository, or capsule.

Citation Information

Patent Citations

  • Streptococcus salivarius and application thereof to preparation of medicines for treatment of inflammatory bowel diseases

    CN110452860A