A nucleic acid and use thereof in the preparation of an antitumor drug

Abstract

The present application relates to the technical field of immunotherapy, and particularly relates to nucleic acid fragments and application thereof in preparation of anti-tumor drugs. The nucleic acid fragments provided by the present application can regulate tumor microenvironment and can simultaneously regulate multiple immune checkpoints in tumor infiltrating T lymphocytes (TILs). The nucleic acid fragments provided by the present application up-regulate expression of NEAT1, promote TIL cell proliferation and promote TIL cell killing of bladder cancer cells. The present application provides a promising immunotherapy strategy for tumor patients, and therefore has good practical application value.

Description

Technical Field

[0001] This invention relates to the field of immunotherapy technology, and in particular to nucleic acid fragments and their application in the preparation of antitumor drugs. Background Technology

[0002] The statements in this section are merely background information related to the present invention and do not necessarily constitute prior art.

[0003] T cell exhaustion is a major mechanism of tumor immune tolerance and escape, and a significant reason why cell immunotherapy cannot be widely applied. Studies have shown that abnormally high expression of immune checkpoints on the surface of immune cells can induce T cell exhaustion through multiple mechanisms. Immune checkpoints are a class of molecules expressed on the surface of immune cells. Under normal circumstances, these immune checkpoints maintain the body's own immune tolerance, preventing T cells from attacking its own cells. However, during tumor development, tumor cells can upregulate the expression level of immune checkpoints within T cells by releasing certain cytokines and recruiting suppressive immune cells. These checkpoints, after binding to their corresponding ligands, then induce T cell exhaustion by affecting cell proliferation, cytokine secretion, and metabolism, ultimately leading to tumor immune tolerance and escape.

[0004] Currently, inhibitors targeting immune checkpoints such as PD-1, PD-L1, and CTLA-4 are used clinically to treat some cancer patients who do not respond to traditional chemotherapy, radiotherapy, and targeted therapy, with some efficacy. However, numerous clinical trials have shown that only a portion of patients with non-small cell lung cancer and melanoma respond well to immune checkpoint therapy, while the vast majority of cancer patients, including those with bladder cancer, do not benefit.

[0005] Furthermore, many cancer patients exhibit primary or secondary resistance to immune checkpoint therapy and develop various types of autoimmune diseases. The reasons for this may include: 1. When using a single immune checkpoint inhibitor, other immune checkpoints remain uninhibited, still exerting immunosuppressive effects on T cells; 2. Off-target effects of immune checkpoint inhibitors. Therefore, developing formulations that can simultaneously regulate the expression of multiple immune checkpoints holds great promise.

[0006] NEAT1 (nuclear paraspeckle assembly transcript 1), a long non-coding RNA, is upregulated in various human tumor cells. Multiple studies have shown that elevated NEAT1 levels in cancer cells promote cell growth, migration, and invasion, and inhibit apoptosis. Several articles have also published feedback mechanisms between NEAT1 / miRNA / target networks and various cancer progression processes. However, the role of NEAT1 in the tumor microenvironment remains unclear, especially its function in different cancers; consequently, there are very few treatments specifically targeting cancer. Summary of the Invention

[0007] In view of this, the present invention provides a nucleic acid fragment that addresses the problem of insignificant efficacy in inhibiting bladder cancer against immune checkpoints and the unclear role of NEAT1 in the tumor microenvironment.

[0008] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions:

[0009] A first aspect of the present invention provides the use of a substance that promotes the activity of long non-coding RNA NEAT1 in the preparation of an antitumor product;

[0010] Furthermore, the substance is a substance that promotes the activity of long non-coding RNA NEAT1 in tumor-infiltrating T lymphocytes (TILs);

[0011] Preferably, the substance that promotes the activity of the long non-coding nucleic acid NEAT1 includes nucleic acid fragments;

[0012] The single-stranded nucleic acid sequences of the nucleic acid fragments are shown in SEQ ID NO.1 or SEQ ID NO.2, respectively.

[0013] In a specific embodiment, the tumor includes bladder tumor, oral tumor, lung cancer, stomach cancer, liver cancer, intestinal cancer, uterine tumor, or osteosarcoma;

[0014] The specific application is to promote the killing of tumor cells by tumor-infiltrating T lymphocytes (TILs).

[0015] Secondly, a nucleic acid fragment is provided, wherein the nucleic acid fragment is a double-stranded nucleic acid; the single-stranded sequence of the nucleic acid fragment is shown in SEQ ID NO.1 or SEQ ID NO.2, respectively.

[0016] Thirdly, a recombinant vector is provided, wherein the expression vector comprises the nucleic acid fragment described in the second aspect;

[0017] The recombinant vector also includes lentivirus LV and an expression cassette for expressing dsacas9.

[0018] Fourthly, a host is provided, which is obtained by transfecting tumor-infiltrating T lymphocytes (TILs) with the recombinant vector described in the third aspect.

[0019] Fifthly, the application of the nucleic acid fragment described in the second aspect, the recombinant vector described in the third aspect, or the host described in the fourth aspect in any of the following:

[0020] I) Promote the activity of NEAT1 in TILs or prepare products related to promoting the activity of NEAT1 in TILs;

[0021] II) Inhibiting the activity of immune checkpoints in TILs or its application in the preparation of immune checkpoint inhibition products;

[0022] III) Application in promoting TILs cell proliferation or in the preparation of products that promote TILs cell proliferation;

[0023] IV) Applications in promoting TILs cell secretion of cytokines or in the preparation of reagents that promote TILs cell secretion of cytokines;

[0024] V) Application in promoting the killing of tumor cells or in the preparation of products that promote the killing of tumor cells by TILs;

[0025] Preferably, the immune checkpoints include PD-1, CTLA-4, TIGIT, and LAG3;

[0026] Preferably, the tumor includes bladder tumor, oral tumor, lung cancer, stomach cancer, liver cancer, intestinal cancer, uterine tumor, or osteosarcoma;

[0027] The product can be a drug or an experimental reagent, thus making it suitable for use in basic research.

[0028] In a sixth aspect, an antitumor drug is provided, which is prepared from the nucleic acid fragment described in the second aspect, the recombinant vector described in the third aspect, or the host described in the fourth aspect.

[0029] In a specific embodiment of the present invention, the drug further includes other components with antitumor activity;

[0030] Alternatively, the antitumor drug may also include a buffering agent for the host activity described in the fourth aspect;

[0031] Alternatively, the antitumor drug may also include a pharmaceutically necessary carrier.

[0032] In specific embodiments of the present invention, the other antitumor active ingredients include paclitaxel, doxorubicin, cisplatin, mitomycin, fluorouracil, gemcitabine, or tyrosine kinase inhibitors.

[0033] In a specific embodiment of the present invention, the antitumor drug includes an antitumor model drug;

[0034] Alternatively, the antitumor drugs may include preparations for treating brain tumors, oral tumors, lung cancer, gastric cancer, liver cancer, intestinal cancer, bladder cancer, uterine and / or uterine tumors, or osteosarcoma.

[0035] Preferably, the drug of the present invention can be administered into the body by known means. For example, it can be delivered to the tissue of interest via intravenous systemic delivery or local injection. Alternatively, it can be administered via intravenous, percutaneous, intranasal, mucosal, or other delivery methods. Such administration can be performed via single or multiple doses. It will be understood by those skilled in the art that the actual dose to be administered in the present invention can vary considerably depending on a variety of factors, such as target cells, biological type or tissue thereof, the general condition of the subject to be treated, route of administration, manner of administration, etc.

[0036] Preferably, the drug can be administered to humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, and chimpanzees.

[0037] The above one or more technical solutions have the following beneficial effects:

[0038] The nucleic acid fragment provided by this invention can efficiently target NEAT1 without off-target effects; efficiently regulate the expression of NEAT1 and its downstream genes; simultaneously inhibit multiple immune checkpoints including PD-1, CTLA-4, TIGIT, and LAG3; promote the proliferation of TILs cells in the bladder cancer tumor microenvironment; and promote the killing of bladder cancer cells by TILs cells. This provides a promising immunotherapy strategy for cancer patients and therefore has significant practical application value.

[0039] Advantages of additional aspects of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0040] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0041] Figure 1 This is a schematic diagram of the target design for the present invention.

[0042] Figure 2 This is a schematic diagram of the final carrier in Embodiment 1 of the present invention; 2A: LV-2136, 2B: LV-2137.

[0043] Figure 3The figures represent cytokines and TILs cell viability in bladder cancer tissue and tumor microenvironment in Example 2 of this invention; A: IL-2 content; B: IFN-γ content; C: TILs cell viability.

[0044] Figure 4 The expression levels of NEAT1 in TILs and PBMCs in Embodiment 3 of the present invention are shown.

[0045] Figure 5 In Example 4 of this invention, small nucleic acids were used in TILs to increase the expression level of NEAT1.

[0046] Figure 6 This represents the level at which small nucleic acids inhibit the expression of multiple immune checkpoint molecules within TILs in Example 5 of the present invention.

[0047] Figure 7 This shows the proliferation of TILs at different time points in Embodiment Six of the present invention.

[0048] Figure 8 In Example 7 of this invention, small nucleic acids promote the secretion of cytokines IFN-γ and IL-2 by TILs cells; A: IFN-γ, B: IL-2.

[0049] Figure 9 This shows the proliferation of bladder cancer cells in Example 8 of the present invention. Detailed Implementation

[0050] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer.

[0051] It should be noted that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the exemplary embodiments of the present invention. Experimental procedures not described in detail in this invention should be performed in accordance with molecular biology and cell biology experimental guides.

[0052] In this invention, the term "treatment" has its general meaning, and specifically refers to the treatment of a mammalian individual (preferably a human) with colitis by means of the drug of this invention, with the aim of producing a therapeutic, curative, alleviating, or reducing effect on the disease, and obtaining the desired pharmacological and / or physiological effects.

[0053] In this invention, the expression cassette is an independent component of the vector DNA, consisting of the gene to be expressed in the transfected cell and a regulatory sequence. The expression cassette comprises three parts: a promoter sequence, an open reading frame, and a 3' untranslated region, which in eukaryotes typically contains a polyadenylation site. Different expression cassettes can be transfected into various organisms such as bacteria, yeast, and plants. It can also be used in mammalian cells, provided the correct regulatory sequence is used. The Cas9 expression cassette is available at DOI 10.1111 / pbi.13559.

[0054] "Pharmaceutically acceptable carriers" are recognized in the art and include pharmaceutically acceptable materials, compositions, or carriers suitable for administering the compounds of the present invention to mammals. These carriers include liquid or solid fillers, diluents, excipients, solvents, or encapsulating materials that participate in carrying the host substance or transferring it from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of compatibility with other components in the formulation and harmlessness to the patient. Examples of materials that can be used as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate, powdered tragacanth gum, malt, gelatin, and talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; and other non-toxic and compatible substances used in pharmaceutical preparations.

[0055] The formulations of this invention can be conveniently available in unit dosage form and can be prepared by any method known in the pharmaceutical field. The amount of active ingredient that can be prepared in a single-dose form, in combination with a carrier substance, is generally the amount of the compound that produces the therapeutic effect.

[0056] Materials used in this invention:

[0057] (1) Reagent kits: CCK8 kit: purchased from Solarbio, catalog number CA1210. ELISA kit: purchased from Qiaoyi Biotechnology, catalog numbers JEEH-03 and JEH-17. Reverse transcription kit: purchased from TOYOBO, catalog number FSQ-301. Real-time PCR kit: purchased from TOYOBO, catalog number QPK-201.

[0058] Reagents and materials related to primary cell isolation and culture:

[0059] (2) Reagents for TILs cell isolation and culture: Recombinant human interleukin-2 (rhIL-2) was purchased from Chiron Corp., Emeryville, CA. RPMI 1640 (21875091), HEPES pH 7.2 (15630080), penicillin-streptomycin (15140163), and glutamine (25030081) were purchased from Life Technologies. Human serum (H4522) was purchased from Sigma Aldrich.

[0060] (3) Reagents for primary tumor cell isolation and culture: DMEM / F-12 (11320033), type II collagenase (17101015), and glutaraldehyde (35050038) were purchased from Life Technologies. DNase I (D5025), insulin (I9278), transferrin (T3309), hydrocortisone (H0888), HEPES (PHR1428), and a 40μm cell filter (CLS431750-50EA) were purchased from Sigma-Aldrich. Y-27632 dihydrochloride (M1817) was purchased from AbMole. FBS (10270) was purchased from Gibco. FGF2 (100-18B) and EGF (AF-100-15) were purchased from Peprotech.

[0061] Experimental instruments used in this invention:

[0062] Ultra-micro spectrophotometer: Denovix

[0063] PCR instrument: BioRad

[0064] Real-time quantitative PCR instrument: Roche

[0065] Microplate reader: Tecan

[0066] Cell incubator: Thermo

[0067] The working principle of the plasmid used in this invention:

[0068] CRISPR / Cas9 is one of the most flexible systems in genome regulation technology. This system has two main components: guide RNA (gRNA) and endonuclease (Cas9). Cas9's primary function is DNA cleavage, which depends on the RuvC1 and HNH active regions in its protein structure. dCas9 (dead Cas9) is a mutant of the Cas9 protein, resulting from mutations in both the RuvC1 and HNH nuclease active regions. It loses its cleavage enzyme activity but retains only the ability to be guided into the genome by gRNA. Currently, the CRISPR-dCas9 system is widely used in gene regulation, genome imaging, and epigenetic regulation. In mammalian cells, fusing dCas9 with the VP64 or p65 activation domain (p65AD) can simultaneously activate reporter genes and endogenous genes under the guidance of only one sgRNA. When dCas9 is fused with the typical transcription activator VP64, the dCas9-VP64 complex can typically recruit transcription factors that regulate transcription in mammalian cells when the dCas9-VP64 targets the promoter sequence of the target gene via gRNA. However, it is still necessary to use multiple sgRNAs to achieve significant activation of the source gene. Different sgRNA target regions lead to different degrees of regulation of downstream genes or different numbers of downstream genes, which in turn leads to differences in expression. Therefore, it is particularly important to design a reasonable sgRNA to achieve multiple regulation of the target gene.

[0069] Different immune cells have different activities and physiological characteristics:

[0070] TILs are immune cells that exist in the tumor microenvironment. They mainly include cytotoxic T cells, synergist T cells, regulatory T cells, and B cells. These cells originate from lymphoid immune cells and belong to adaptive immune cells. Their main function is to eliminate tumor cells by secreting cytokines.

[0071] Macrophages originate from myeloid immune cells and belong to innate immune cells. Their main function is to engulf dead cells and cell debris, immune complexes, bacteria, and other waste.

[0072] The present invention will be further described in detail below with reference to specific embodiments. It should be noted that the specific embodiments are explanations of the present invention and not limitations thereof.

[0073] Example 1

[0074] 1. Design nucleic acid fragments

[0075] In this invention, two nucleic acid fragments were designed for the NEAT1 gene, and the single-stranded nucleotide sequences of the nucleic acid fragments are shown in SEQ ID NO.1-2, respectively.

[0076] sgRNA3(SEQ ID NO.1):ATAGCCCTCAGCCGCGTCAC

[0077] sgRNA5(SEQ ID NO.2):GTCATCGGCCGAGCCCGACT

[0078] The NEAT1 gene has the NCBI Gene Accession Number: Gene ID: 283131.

[0079] 2. Carrier Construction:

[0080] Experimental principle: Two single-stranded primers are annealed to form a double strand, which is then assembled by ligation using T4 DNA1 ligase. The sgRNA fragment is constructed into the target vector, transformed into E. coli Stbl3 competent cells, and transformed cells are screened by colony PCR. Positive clones are sent for sequencing, and positive clones are confirmed by sequence alignment.

[0081] 1) Primer annealing

[0082] A. Primer 2136-F: caccGTCATCGGCCGAGCCCGACT and primer 2136-R: aaacAGTCGGGCTCGGCCGATGAC were annealed to form a double-stranded structure, which was named sasgRNA5(NEAT1).

[0083] B. Anneal primers 2137-F (caccGATAGCCCTCAGCCGCGTCAC) and 2137-R (aaacGTGACGCGGCTGAGGGCTATC) to form a double-stranded structure, named SasgRNA3(NEAT1).

[0084] 2) Insertion of small sgRNA fragments into linearized expression vectors

[0085] The vector LV-CMV-NLS-dSaCas9-NLS-VPR-U6-sgRNA (Wuhan Shumi Biotechnology) was digested with BsaI and then ligated with the annealing primers obtained in step 1) using T4 ligase.

[0086] Then, E. coli Stbl3 competent cells were transformed, and colony PCR was performed using U6-F: gagggcctatttcccatgattcc and WPRE-R: CCGCTTCAGCGGTCGC. Correctly sequenced colonies were identified and preserved. Plasmids were extracted for subsequent experiments.

[0087] The plasmid obtained by A was named LV-2136, and its element ligation sequence is as follows: LV-CMV-SV40NLS-dSaCas9-HA-2XSV40-NLS-VPR-nEF1α-Puro-T2A-EGFP-U6-sasgRNA5(NEAT1)-WPRE. Except for sasgRNA5(NEAT1), the sequences of all other elements are the same as those disclosed in the prior art. The plasmid map is shown below. Figure 2 As shown in Figure A.

[0088] The plasmid obtained by B was named LV-2137, and its element ligation sequence is as follows: LV-CMV-SV40NLS-dSaCas9-HA-2XSV40-NLS-VPR-nEF1α-Puro-T2A-EGFP-U6-SasgRNA 3(NEAT1)-WPRE. Except for SasgRNA3(NEAT1), the sequences of all other elements are the same as those disclosed in the prior art. The plasmid map is shown below. Figure 2 As shown in B.

[0089] 3. Obtain host cells

[0090] LV-2136 and LV-2137 were transduced into TILs cells to ensure a multiplicity of infection (MOI) of 1. Subsequent examples followed this standard.

[0091] Example 2

[0092] First, TILs and autologous tumor cells were isolated from bladder cancer tissue. Then, they were incubated in a cell culture incubator at 37°C with 5% carbon dioxide for 48 hours. The contents of IFN-γ and IL-2 in the supernatant were detected by ELISA kit, and the proliferation of tumor cells was detected by CCK8 kit after 24 and 48 hours of co-incubation. Figure 3 Results A and B showed that most TILs isolated from bladder cancer tissues could not be stimulated by their own tumor cells to secrete IFN-γ and IL-2. Figure 3 The results showed that TILs could not inhibit the proliferation of tumor cells. These results indicate that TILs in bladder cancer tissue are in a state of depletion and cannot kill autologous tumor cells.

[0093] Example 3

[0094] TILs were isolated from bladder cancer tissue and peripheral blood mononuclear cells (PBMCs). The expression level of NEAT1 in TILs and PBMCs was detected by real-time quantitative PCR. Figure 4The results showed that the long non-coding nucleic acid NEAT1 was significantly underexpressed in these exhausted TILs.

[0095] Example 4

[0096] After transfecting LV-2136 and LV-2137 plasmids into TILs cells for 24 and 48 hours, respectively, the expression level of NEAT1 in TILs was detected by real-time quantitative PCR. Figure 5 The results showed that NEAT1-gRNA3 and NEAT1-gRNA5 significantly increased the expression level of NEAT1 in TILs. This demonstrates that the NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments successfully targeted NEAT1 and regulated NEAT1 gene expression.

[0097] Example 5

[0098] After LV-2136 and LV-2137 plasmids were transfected into TILs cells for 48 hours, the expression levels of immune checkpoints in TILs were detected by real-time quantitative PCR. Figure 6 The results showed that the NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments could significantly reduce the expression levels of immune checkpoints PD-1, CTLA-4, TIGIT, and LAG3 in TILs.

[0099] Example 6

[0100] After LV-2136 and LV-2137 plasmids were transfected into TILs cells for 48 hours, the proliferation of TILs was detected using the CCK8 assay kit. Figure 7 The results showed that the NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments could promote the proliferation of TILs cells.

[0101] Example 7

[0102] After LV-2136 and LV-2137 plasmids were transfected into TILs cells for 48 hours, the contents of IFN-γ and IL-2 in the supernatant were detected using an ELISA kit. Figure 8 The results showed that the NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments could promote the secretion of cytokines IFN-γ and IL-2 by TILs cells.

[0103] Example 8

[0104] After transfecting TILs cells with LV-2136 and LV-2137 plasmids for 24 hours, they were co-incubated with bladder cancer cells in vitro for 24 and 48 hours, respectively. The proliferation of bladder cancer cells was then detected using the CCK8 assay kit. Figure 9The results showed that the NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments could promote TILs cells to kill bladder cancer cells.

[0105] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of recombinant vectors in the preparation of anti-bladder tumor products; The recombinant vector is LV-2136 or LV-2137; LV-2136, whose element connection sequence is as follows: LV-CMV-SV40NLS-dSaCas9-HA-2XSV40-NLS-VPR-nEF1α-Puro-T2A-EGFP-U6-sasgRNA5(NEAT1)-WPRE; the single-stranded sequence of said sasgRNA5(NEAT1) is shown in SEQ ID NO.2; LV-2137, the element connection sequence of which is as follows: LV-CMV-SV40 NLS-dSaCas9-HA-2XSV40-NLS-VPR-nEF1α-Puro-T2A-EGFP-U6-SasgRNA3(NEAT1)-WPRE; the single-stranded sequence of SasgRNA3(NEAT1) is shown in SEQ ID NO.1; The recombinant vector was used to transfect tumor-infiltrating T lymphocytes (TILs).

2. An anti-bladder tumor drug, characterized in that, It was prepared by transfecting tumor-infiltrating T lymphocytes (TILs) with a recombinant vector, wherein the recombinant vector is LV-2136 or LV-2137; LV-2136, whose element connection sequence is as follows: LV-CMV-SV40NLS-dSaCas9-HA-2XSV40-NLS-VPR-nEF1α-Puro-T2A-EGFP-U6-sasgRNA5(NEAT1)-WPRE; the single-stranded sequence of said sasgRNA5(NEAT1) is shown in SEQ ID NO.2; LV-2137, whose element connection order is as follows: LV-CMV-SV40 NLS-dSaCas9-HA-2XSV40-NLS-VPR-nEF1α-Puro-T2A-EGFP-U6-SasgRNA3(NEAT1)-WPRE; the single-stranded sequence of SasgRNA3(NEAT1) is shown in SEQ ID NO.

1.

3. The anti-bladder tumor drug as described in claim 2, characterized in that, The anti-bladder tumor drug also includes a pharmaceutically necessary carrier.

Images